16S rRNA Refseq V15.21 Genomic RefSeq V9.14
Sequence Meta Information:
Alloprevotella rava F0020
Info available in HOMD database:  
1Oral Taxon ID302
2HOMD Sequence IDSEQF1020
3HOMD Name (Genus, Species)Alloprevotella rava
4Genome Sequence Name
(Name associated with genomic sequence)
Alloprevotella rava
5Comments on NameNA
6Culture Collection Entry NumberF0020
7Isolate OriginNA
8Sequencing StatusSurvey
9NCBI Taxonomy IDNA
10NCBI Genome BioProject IDNA
11NCBI Genome BioSample IDNA
12GenBank Accession IDNA
13Genbank Assembly IDNA
14Number of Contigs and Singlets404
15Combined Length (bps)362,201
16GC Percentage44.54
17Sequencing CenterThe Forsyth Institute
18ATCC Medium NumberNA
19Non-ATCC MediumNA
2016S rRNA Gene Sequence
>16S rRNA from   Prevotella sp. oral taxon 302 F0020  contig 93 [125 - 1012 bps] 
GAGTTTGATCCTGGCTCAGGATGAACGCTAGCTACAGGCTTAACACATGC
AAGTCGAGGGGAAACGACATTGAAAGCTTGCTTTTGATGGGCGTCGACCG
GCGCACGGGTGCGTAACGCGTATCGAACCTGCCCTTTACTCAGGGATAGC
CTTGCGAAAGTAAGATTAATACCTGATAGTGTTGCGATGAGGCATCTTGT
TGCAACTAAAGATTTATTGGTAAAGGATGGCGATGCGTCTGATTAGGTAG
TAGGCGGGGTAATGGCCCACCTAGCCTTCGATCAGTAGGGGTTCTGAGAG
GAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGG
CAGCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTA
GCGTGCAGGACGACGGCCCTCTGGGTTGTAAACTGCTTTTAGTTGGGAAC
AAAAAAGGCGACGTGTCGCCTCTGGAGTGTACCATCAGAAAAAGGACCGG
CTAATTCCGTGCCAGCAGCCGCGGTAATACGGAAGGTCCAGGCGTTATCC
GGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGATTAAGTCAGCTGTG
AAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGTTGTCTTGAG
TGCACGCAGGGACGTTGGAATTCATGGTGTAGCGGTGAAATGCTTAGATA
TCATGAAGAACTCCGATCGCGAAGGCATATGTCTGGAGTGCAACTGACGC
TGAGGCTCGAAAGTGCGGGTATCGAACAGGATTAGATACCCTGGTAGTCC
GCACAGTAAACGATGAATACTCGCAGTATGCGATATAATGTATGCTGCCA
AGTGAAAACGTTAAGTATTCCACCTGGGGAGTACGCCG
21Comments for 16s rRNA Gene SequenceNA
Copyright 2007-2021 The Forsyth Institute
Hosted on Amazon AWS EC2
192.168.0.51