Sequence Meta Information:
Alloprevotella rava F0020 [ HOMD Survey ]
Info available in HOMD database:  
1Oral Taxon ID302
2HOMD Sequence IDSEQF1020
3HOMD Name (Genus, Species)Alloprevotella rava
4Genome Sequence Name
(Name associated with genomic sequence)
Prevotella sp. oral taxon 302
5Comments on NameNA
6Culture Collection Entry NumberF0020
7Isolate OriginNA
8Sequencing StatusSurvey
9NCBI Genome Project IDNA
10NCBI Taxonomy IDNA
11Genomes Online Goldstamp IDNA
12GenBank Accession IDNA
13JCVI (TIGR) CMR IDNA
14Sequencing CenterThe Forsyth Institute
15Comments on GC PercentageNA
16ATCC Medium NumberNA
17Non-ATCC MediumNA
1816S rRNA Gene Sequence
>16S rRNA from   Prevotella sp. oral taxon 302 F0020  contig 93 [125 - 1012 bps] 
GAGTTTGATCCTGGCTCAGGATGAACGCTAGCTACAGGCTTAACACATGC
AAGTCGAGGGGAAACGACATTGAAAGCTTGCTTTTGATGGGCGTCGACCG
GCGCACGGGTGCGTAACGCGTATCGAACCTGCCCTTTACTCAGGGATAGC
CTTGCGAAAGTAAGATTAATACCTGATAGTGTTGCGATGAGGCATCTTGT
TGCAACTAAAGATTTATTGGTAAAGGATGGCGATGCGTCTGATTAGGTAG
TAGGCGGGGTAATGGCCCACCTAGCCTTCGATCAGTAGGGGTTCTGAGAG
GAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGG
CAGCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTA
GCGTGCAGGACGACGGCCCTCTGGGTTGTAAACTGCTTTTAGTTGGGAAC
AAAAAAGGCGACGTGTCGCCTCTGGAGTGTACCATCAGAAAAAGGACCGG
CTAATTCCGTGCCAGCAGCCGCGGTAATACGGAAGGTCCAGGCGTTATCC
GGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGATTAAGTCAGCTGTG
AAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGTTGTCTTGAG
TGCACGCAGGGACGTTGGAATTCATGGTGTAGCGGTGAAATGCTTAGATA
TCATGAAGAACTCCGATCGCGAAGGCATATGTCTGGAGTGCAACTGACGC
TGAGGCTCGAAAGTGCGGGTATCGAACAGGATTAGATACCCTGGTAGTCC
GCACAGTAAACGATGAATACTCGCAGTATGCGATATAATGTATGCTGCCA
AGTGAAAACGTTAAGTATTCCACCTGGGGAGTACGCCG
19Comments for 16s rRNA Gene SequenceNA

Copyright 2007-2016 The Forsyth Institute