16S rRNA Refseq V15.22 Genomic RefSeq V9.14
Sequence Meta Information:
Saccharibacteria (TM7) [G-1] bacterium HMT 488
Info available in HOMD database:  
1Oral Taxon ID488
2HOMD Sequence IDSEQF2844
3HOMD Name (Genus, Species)Saccharibacteria (TM7) [G-1] bacterium HMT 488
4Genome Sequence Name
(Name associated with genomic sequence)
Candidate division TM7 single-cell isolate TM7-488
5Comments on Name
6Culture Collection Entry NumberNA
7Isolate OriginNA
8Sequencing StatusComplete
9NCBI Taxonomy ID1895827
10NCBI Genome BioProject IDNA
11NCBI Genome BioSample IDNA
12GenBank Accession IDNA
13Genbank Assembly ID<DIV id=ViEtDeVdIvId style="POSITION:Relative;FONT-FAMILY:Arial;FONT-SIZE:11px"></DIV>
14Number of Contigs and Singlets1
15Combined Length (bps)847,999
16GC Percentage50.81
17Sequencing CenterNA
18ATCC Medium NumberNA
19Non-ATCC MediumNA
2016S rRNA Gene Sequence
>fig|6666666.232436.rna.10 Small Subunit Ribosomal RNA ssuRNA SSU rRNA 144773-146244
cctggacgcggggatttccgaagggaaatcagccgcatcatttccaaaggagtgagtgtc
tggggtgatttcaaactgatagtgcagaatgccggcgagcggcgaacggctgagtaacgc
gtaggaatttgccccaaagtgagggataactgcccgaaagggtagctaataccgcatatg
gtcttcggattaaaggatttatccgctttgggagaagcctgcgttggattaggttgttgg
tgaggtaatggctcaccaagccgacgatccatagctggtctgagaggatgatcagccaga
ctggaactgagacacggtccagactcctacgggaggcagcagtgaggaatcttccacaat
gggcgaaagcctgatggagcaacgccgcgtgaaggatgaaggccttcgggttgtaaactt
cttttatgagtgaagaatatgacggtaactcatgaataagcaccggctaactacgtgcca
gcagccgcggtcatacgtagggtgcaagcattatccggagtgactgggcgtaaagagttg
cgtaggcggtaagtcaagtgaatagtgaaacctggtggctcaaccatacagactattatt
caaactggcttactcgagaatggtagaggtaactggaatttcttgtgtaggagtgaaatc
cgtagatataagaaggaacaccaatggcgtaggcaggttactgggccatttctgacgcta
aggcacgaaagcgtggggagcgaaccggattagatacccgggtagtccacgccgtaaacg
atggatactagctgttggaggtatcgaccccttcagtagcgaagctaacgcgttaagtat
cccgcctgtggagtacggccgcaaggctaaaacataaaggaattgacggggacccgcaca
agcggtggattatgttctttaattcgatgataaccgaagaaccttaccagggcttgacat
ctagggaaggtctgcgaaagtagactgtgccttttggaaccctgtgacaggtgatgcatg
gccgtcgtcagctcgtgtcgtgagatgttaggttaagtccttcaacgagcgcaacccttg
caagtagttgtatttttctacttggactgccccggtaacggggaggaaggaggggatgat
gtcaggtcagtatttcccttacgtcctgggctagaaacgtaatacaatggctagtacaat
gcgcagcgaagccgcgaggtgaagcaaatcgcatcaaagctagtcccagttcggattgga
ggctgaaactcgcctccatgaagtcggaatcgctagtaatcgcaaatcagcaagttgcgg
tgaatacgttcccgggtcttgtacacaccgcccgtcaaaccatgaaagtgaccaacaccc
gaagtccgattcgtcggcctaaggtggggggcatgattggggttaagtcgtaacaaggta
tccgtaccggaaggtgcggatggattacctcc
21Comments for 16s rRNA Gene Sequence
Copyright 2007-2022 The Forsyth Institute
Hosted on Amazon AWS EC2
192.168.0.51