BAKTAGenome Explorer: Finegoldia magna (GCA_000010185.1)
Select a Genome:
|
BAKTA Annotations for GCA_000010185.1
|
Search & Sort all 3838 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP008971.1 | GCA000010185_00370 | gene | open | 396998-397359 | ssrA | ||
| 2 | AP008971.1 | GCA000010185_00370 | tmRNA | open | 396998-397359 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP008971.1 | rep_origin | open | 1823-2109 | ||||
| 4 | AP008971.1 | GCA000010185_00195 | gene | open | 197838-199359 | rrs | ||
| 5 | AP008971.1 | GCA000010185_00197 | gene | open | 199618-202619 | rrl | ||
| 6 | AP008971.1 | GCA000010185_00198 | gene | open | 202661-202777 | rrf | ||
| 7 | AP008971.1 | GCA000010185_00341 | gene | open | 364491-364616 | SpR18_sRNA | ||
| 8 | AP008971.1 | GCA000010185_00469 | gene | open | 496156-496419 | Bacteria_large_SRP | ||
| 9 | AP008971.1 | GCA000010185_00470 | gene | open | 496207-496306 | Bacteria_small_SRP | ||
| 10 | AP008971.1 | GCA000010185_00591 | gene | open | 611796-613317 | rrs | ||
| 11 | AP008971.1 | GCA000010185_00593 | gene | open | 613576-616577 | rrl | ||
| 12 | AP008971.1 | GCA000010185_00594 | gene | open | 616619-616735 | rrf | ||
| 13 | AP008971.1 | GCA000010185_00891 | gene | open | 891852-892181 | RNaseP_bact_a | ||
| 14 | AP008971.1 | GCA000010185_01164 | gene | open | 1182759-1182875 | rrf | ||
| 15 | AP008971.1 | GCA000010185_01165 | gene | open | 1182917-1185920 | rrl | ||
| 16 | AP008971.1 | GCA000010185_01167 | gene | open | 1186126-1187647 | rrs | ||
| 17 | AP008971.1 | GCA000010185_01405 | gene | open | 1442198-1442314 | rrf | ||
| 18 | AP008971.1 | GCA000010185_01406 | gene | open | 1442356-1445357 | rrl | ||
| 19 | AP008971.1 | GCA000010185_01407 | gene | open | 1445476-1446997 | rrs | ||
| 20 | AP008971.1 | GCA000010185_01485 | gene | open | 1541949-1541985 | abiF | ||
| 21 | AP008971.1 | GCA000010185_00341 | ncRNA | open | 364491-364616 | Streptococcus sRNA SpR18 | ||
| 22 | AP008971.1 | GCA000010185_00469 | ncRNA | open | 496156-496419 | Bacterial large signal recognition particle RNA | ||
| 23 | AP008971.1 | GCA000010185_00470 | ncRNA | open | 496207-496306 | Bacterial small signal recognition particle RNA | ||
| 24 | AP008971.1 | GCA000010185_00891 | ncRNA | open | 891852-892181 | Bacterial RNase P class A | ||
| 25 | AP008971.1 | GCA000010185_01485 | ncRNA | open | 1541949-1541985 | abiF | abiF RNA | |
| 26 | AP008971.1 | regulatory_region | open | 258840-259066 | T-box leader | |||
| 27 | AP008971.1 | regulatory_region | open | 418370-418442 | Ribosomal protein L21 leader | |||
| 28 | AP008971.1 | regulatory_region | open | 485391-485428 | Selenocysteine insertion sequence 4 | |||
| 29 | AP008971.1 | regulatory_region | open | 600028-600151 | Ribosomal protein L10 leader | |||
| 30 | AP008971.1 | regulatory_region | open | 601208-601445 | T-box leader | |||
| 31 | AP008971.1 | regulatory_region | open | 687824-688003 | T-box leader | |||
| 32 | AP008971.1 | regulatory_region | open | 927865-928044 | T-box leader | |||
| 33 | AP008971.1 | regulatory_region | open | 943105-943292 | T-box leader | |||
| 34 | AP008971.1 | regulatory_region | open | 956470-956558 | THF (Tetrahydrofolate) riboswitch aptamer | |||
| 35 | AP008971.1 | regulatory_region | open | 1004133-1004197 | pemK RNA | |||
| 36 | AP008971.1 | regulatory_region | open | 1262597-1262692 | SAM riboswitch aptamer (S box leader) | |||
| 37 | AP008971.1 | regulatory_region | open | 1324222-1324363 | glmS glucosamine-6-phosphate activated ribozyme aptamer | |||
| 38 | AP008971.1 | regulatory_region | open | 1329623-1329737 | FMN riboswitch aptamer (RFN element) | |||
| 39 | AP008971.1 | regulatory_region | open | 1394604-1394844 | T-box leader | |||
| 40 | AP008971.1 | regulatory_region | open | 1428519-1428769 | T-box leader | |||
| 41 | AP008971.1 | regulatory_region | open | 1623832-1623869 | Selenocysteine insertion sequence 4 | |||
| 42 | AP008971.1 | regulatory_region | open | 1640963-1641037 | Fluoride riboswitch aptamer (crcB RNA motif) | |||
| 43 | AP008971.1 | regulatory_region | open | 1776078-1776115 | Selenocysteine insertion sequence 4 | |||
| 44 | AP008971.1 | GCA000010185_00195 | rRNA | open | 197838-199359 | rrs | 16S ribosomal RNA | |
| 45 | AP008971.1 | GCA000010185_00197 | rRNA | open | 199618-202619 | rrl | 23S ribosomal RNA | |
| 46 | AP008971.1 | GCA000010185_00198 | rRNA | open | 202661-202777 | rrf | 5S ribosomal RNA | |
| 47 | AP008971.1 | GCA000010185_00591 | rRNA | open | 611796-613317 | rrs | 16S ribosomal RNA | |
| 48 | AP008971.1 | GCA000010185_00593 | rRNA | open | 613576-616577 | rrl | 23S ribosomal RNA | |
| 49 | AP008971.1 | GCA000010185_00594 | rRNA | open | 616619-616735 | rrf | 5S ribosomal RNA | |
| 50 | AP008971.1 | GCA000010185_01164 | rRNA | open | 1182759-1182875 | rrf | 5S ribosomal RNA | |
| 51 | AP008971.1 | GCA000010185_01165 | rRNA | open | 1182917-1185920 | rrl | 23S ribosomal RNA | |
| 52 | AP008971.1 | GCA000010185_01167 | rRNA | open | 1186126-1187647 | rrs | 16S ribosomal RNA | |
| 53 | AP008971.1 | GCA000010185_01405 | rRNA | open | 1442198-1442314 | rrf | 5S ribosomal RNA | |
| 54 | AP008971.1 | GCA000010185_01406 | rRNA | open | 1442356-1445357 | rrl | 23S ribosomal RNA | |
| 55 | AP008971.1 | GCA000010185_01407 | rRNA | open | 1445476-1446997 | rrs | 16S ribosomal RNA | |
| 56 | AP008971.1 | repeat_region | open | 79845-80816 | CRISPR array with 15 repeats of length 36%2C consensus sequence GTTTGAGAATGATGTAATTTCATATAGGTATTAAAC and spacer length 30 | |||
| 57 | AP008971.1 | GCA000010185_00001 | CDS | open | 365-1822 | _na 485_aa | dnaA | chromosomal replication initiator protein DnaA |
| 58 | AP008971.1 | GCA000010185_00002 | CDS | open | 2110-3213 | _na 367_aa | dnaN | DNA polymerase III subunit beta |
| 59 | AP008971.1 | GCA000010185_00003 | CDS | open | 3206-3412 | _na 68_aa | ybcJ | S4 domain-containing protein YaaA |
| 60 | AP008971.1 | GCA000010185_00004 | CDS | open | 3412-4479 | _na 355_aa | recF | DNA replication/repair protein RecF |
| 61 | AP008971.1 | GCA000010185_00005 | CDS | open | 4481-4723 | _na 80_aa | DUF370 domain-containing protein | |
| 62 | AP008971.1 | GCA000010185_00006 | CDS | open | 4723-6639 | _na 638_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 63 | AP008971.1 | GCA000010185_00007 | CDS | open | 6649-9069 | _na 806_aa | gyrA | DNA gyrase subunit A |
| 64 | AP008971.1 | GCA000010185_00008 | CDS | open | 9080-9391 | _na 103_aa | spoIIAA | Anti-sigma factor antagonist |
| 65 | AP008971.1 | GCA000010185_00009 | CDS | open | 9391-9735 | _na 114_aa | Histidine kinase/HSP90-like ATPase domain-containing protein | |
| 66 | AP008971.1 | GCA000010185_00010 | CDS | open | 9740-10516 | _na 258_aa | RNA polymerase sigma B factor | |
| 67 | AP008971.1 | GCA000010185_00011 | CDS | open | 10517-11128 | _na 203_aa | rbbA | Glutamine ABC transporter ATP-binding protein |
| 68 | AP008971.1 | GCA000010185_00012 | CDS | open | 11130-11903 | _na 257_aa | fetB | Glutamine ABC transporter permease protein |
| 69 | AP008971.1 | GCA000010185_00013 | CDS | open | 11916-13274 | _na 452_aa | fumC | class II fumarate hydratase |
| 70 | AP008971.1 | GCA000010185_00014 | CDS | open | 13346-13570 | _na 74_aa | Transaldolase | |
| 71 | AP008971.1 | GCA000010185_00015 | CDS | open | 13836-14306 | _na 156_aa | Putative acetyltransferase | |
| 72 | AP008971.1 | GCA000010185_00016 | CDS | open | 14418-15062 | _na 214_aa | DUF3841 domain-containing protein | |
| 73 | AP008971.1 | GCA000010185_00017 | CDS | open | 15059-15718 | _na 219_aa | yoaK | ABC transporter |
| 74 | AP008971.1 | GCA000010185_00018 | CDS | open | 15980-16135 | _na 51_aa | hicA | Addiction module toxin%2C HicA family |
| 75 | AP008971.1 | GCA000010185_00019 | CDS | open | 16174-16572 | _na 132_aa | hicB | HicB family protein |
| 76 | AP008971.1 | GCA000010185_00020 | CDS | open | 16646-17080 | _na 144_aa | DUF3139 domain-containing protein | |
| 77 | AP008971.1 | GCA000010185_00021 | CDS | open | 17090-17488 | _na 132_aa | DUF3139 domain-containing protein | |
| 78 | AP008971.1 | GCA000010185_00022 | CDS | open | 17596-17781 | _na 61_aa | DUF1659 domain-containing protein | |
| 79 | AP008971.1 | GCA000010185_00023 | CDS | open | 17793-18011 | _na 72_aa | DUF2922 domain-containing protein | |
| 80 | AP008971.1 | GCA000010185_00024 | CDS | open | 18021-18167 | _na 48_aa | yvrJ | YvrJ family protein |
| 81 | AP008971.1 | GCA000010185_00025 | CDS | open | 18350-19294 | _na 314_aa | znuA | Putative zinc ABC transporter substrate-binding protein |
| 82 | AP008971.1 | GCA000010185_00026 | CDS | open | 19287-19949 | _na 220_aa | znuC | ABC transporter%2C ATP-binding protein |
| 83 | AP008971.1 | GCA000010185_00027 | CDS | open | 19957-20748 | _na 263_aa | znuB | ABC 3 transport family protein |
| 84 | AP008971.1 | GCA000010185_00028 | CDS | open | 20757-23078 | _na 773_aa | Histidine triad protein | |
| 85 | AP008971.1 | GCA000010185_00029 | CDS | open | 23139-23921 | _na 260_aa | Restriction endonuclease | |
| 86 | AP008971.1 | GCA000010185_00030 | CDS | open | 24016-25128 | _na 370_aa | yebA | Putative transglutaminase family protein |
| 87 | AP008971.1 | GCA000010185_00031 | CDS | open | 25198-25734 | _na 178_aa | pspE | Rhodanese domain-containing protein |
| 88 | AP008971.1 | GCA000010185_00032 | CDS | open | 25971-27560 | _na 529_aa | nhaP2 | potassium/proton antiporter |
| 89 | AP008971.1 | GCA000010185_00033 | CDS | open | 27629-28810 | _na 393_aa | fieF | Ferrous-iron efflux pump FieF |
| 90 | AP008971.1 | GCA000010185_00034 | CDS | open | 28812-29450 | _na 212_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 91 | AP008971.1 | GCA000010185_00035 | CDS | open | 29702-30061 | _na 119_aa | ABC transporter permease | |
| 92 | AP008971.1 | GCA000010185_00036 | CDS | open | 30125-30625 | _na 166_aa | eCF-S | ECF transporter S component |
| 93 | AP008971.1 | GCA000010185_00037 | CDS | open | 31023-36905 | _na 1960_aa | lytB | Cell wall-associated serine proteinase |
| 94 | AP008971.1 | GCA000010185_00038 | CDS | open | 37243-41907 | _na 1554_aa | lytB | N-acetylmuramoyl-L-alanine amidase |
| 95 | AP008971.1 | GCA000010185_00039 | CDS | open | 42004-43179 | _na 391_aa | Carboxypeptidase regulatory-like domain-containing protein | |
| 96 | AP008971.1 | GCA000010185_00040 | CDS | open | 43214-43666 | _na 150_aa | Putative small-multidrug export protein | |
| 97 | AP008971.1 | GCA000010185_00041 | CDS | open | 43675-44325 | _na 216_aa | ycjU | Phosphorylated carbohydrates phosphatase |
| 98 | AP008971.1 | GCA000010185_00042 | CDS | open | 44487-45719 | _na 410_aa | ampS | Aminopeptidase 2 |
| 99 | AP008971.1 | GCA000010185_00043 | CDS | open | 45719-47515 | _na 598_aa | pepF | oligoendopeptidase F |
| 100 | AP008971.1 | GCA000010185_00044 | CDS | open | 47566-48450 | _na 294_aa | rbbA | Glutamine transport ATP-binding protein GlnQ |
| 101 | AP008971.1 | GCA000010185_00045 | CDS | open | 48443-49195 | _na 250_aa | Antibiotic ABC transporter permease | |
| 102 | AP008971.1 | GCA000010185_00046 | CDS | open | 49185-49856 | _na 223_aa | Antibiotic ABC transporter permease | |
| 103 | AP008971.1 | GCA000010185_00047 | CDS | open | 49856-51157 | _na 433_aa | Macrolide-efflux pump | |
| 104 | AP008971.1 | GCA000010185_00048 | CDS | open | 51213-51572 | _na 119_aa | sORL | Superoxide reductase |
| 105 | AP008971.1 | GCA000010185_00049 | CDS | open | 51715-52617 | _na 300_aa | Fido domain-containing protein | |
| 106 | AP008971.1 | GCA000010185_00050 | CDS | open | 53034-60317 | _na 2427_aa | Repeat protein | |
| 107 | AP008971.1 | GCA000010185_00051 | CDS | open | 60341-68017 | _na 2558_aa | lytB | Putative N-acetylmuramoyl-L-alanine amidase |
| 108 | AP008971.1 | GCA000010185_00052 | CDS | open | 68142-69050 | _na 302_aa | ygiQ | Oxygen-independent coproporphyrinogen III oxidase |
| 109 | AP008971.1 | GCA000010185_00053 | CDS | open | 69050-69778 | _na 242_aa | birA | Bifunctional ligase/repressor BirA |
| 110 | AP008971.1 | GCA000010185_00054 | CDS | open | 69791-70018 | _na 75_aa | relB | type II toxin-antitoxin system RelB family antitoxin |
| 111 | AP008971.1 | GCA000010185_00055 | CDS | open | 70111-70512 | _na 133_aa | arsR | HTH arsR-type domain-containing protein |
| 112 | AP008971.1 | GCA000010185_00056 | CDS | open | 70557-70772 | _na 71_aa | copZ | Putative cation-transporting P-type ATPase |
| 113 | AP008971.1 | GCA000010185_00057 | CDS | open | 70772-72583 | _na 603_aa | zntA | Cd(2+)-exporting ATPase |
| 114 | AP008971.1 | GCA000010185_00058 | CDS | open | 72630-72941 | _na 103_aa | DUF3899 domain-containing protein | |
| 115 | AP008971.1 | GCA000010185_00059 | CDS | open | 72981-73556 | _na 191_aa | eCF-S | Riboflavin transporter |
| 116 | AP008971.1 | GCA000010185_00060 | CDS | open | 73918-77964 | _na 1348_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 117 | AP008971.1 | GCA000010185_00061 | CDS | open | 77964-78836 | _na 290_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 118 | AP008971.1 | GCA000010185_00062 | CDS | open | 78841-79146 | _na 101_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 119 | AP008971.1 | GCA000010185_00063 | CDS | open | 79143-79790 | _na 215_aa | csn2 | type II-A CRISPR-associated protein Csn2 |
| 120 | AP008971.1 | GCA000010185_00064 | CDS | open | 80888-81919 | _na 343_aa | yhcG | DUF1016 domain-containing protein |
| 121 | AP008971.1 | GCA000010185_00065 | CDS | open | 82089-82205 | _na 38_aa | hypothetical protein | |
| 122 | AP008971.1 | GCA000010185_00066 | CDS | open | 82670-83824 | _na 384_aa | thiH | 2-iminoacetate synthase ThiH |
| 123 | AP008971.1 | GCA000010185_00067 | CDS | open | 83832-84596 | _na 254_aa | thiG | thiazole synthase |
| 124 | AP008971.1 | GCA000010185_00068 | CDS | open | 84586-85182 | _na 198_aa | thiF | sulfur carrier protein ThiS adenylyltransferase ThiF |
| 125 | AP008971.1 | GCA000010185_00069 | CDS | open | 85184-85381 | _na 65_aa | thiS | sulfur carrier protein ThiS |
| 126 | AP008971.1 | GCA000010185_00070 | CDS | open | 85601-86212 | _na 203_aa | gstA | Glutathione S-transferase GST-4-5 |
| 127 | AP008971.1 | GCA000010185_00071 | CDS | open | 86392-87912 | _na 506_aa | yifB | Competence protein ComM |
| 128 | AP008971.1 | GCA000010185_00072 | CDS | open | 88190-88474 | _na 94_aa | rimL | N-acetyltransferase domain-containing protein |
| 129 | AP008971.1 | GCA000010185_00073 | CDS | open | 88558-89523 | _na 321_aa | fadB | L-carnitine dehydrogenase |
| 130 | AP008971.1 | GCA000010185_00074 | CDS | open | 89630-90685 | _na 351_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 131 | AP008971.1 | GCA000010185_00075 | CDS | open | 90672-91250 | _na 192_aa | acrR | Tetracyclin repressor YgfC-like C-terminal domain-containing protein |
| 132 | AP008971.1 | GCA000010185_00076 | CDS | open | 91446-93158 | _na 570_aa | hsdM | site-specific DNA-methyltransferase (adenine-specific) |
| 133 | AP008971.1 | GCA000010185_00077 | CDS | open | 93161-93667 | _na 168_aa | hypothetical protein | |
| 134 | AP008971.1 | GCA000010185_00078 | CDS | open | 93910-96396 | _na 828_aa | hsdM | site-specific DNA-methyltransferase (adenine-specific) |
| 135 | AP008971.1 | GCA000010185_00079 | CDS | open | 96390-97424 | _na 344_aa | rhuM | Bro-N domain-containing protein |
| 136 | AP008971.1 | GCA000010185_00080 | CDS | open | 97417-98544 | _na 375_aa | hsdS | Type I restriction-modification enzyme specificity subunit |
| 137 | AP008971.1 | GCA000010185_00081 | CDS | open | 98554-101670 | _na 1038_aa | Type I restriction enzyme endonuclease subunit | |
| 138 | AP008971.1 | GCA000010185_00082 | CDS | open | 101660-102370 | _na 236_aa | ygjP | Zinc-dependent protease |
| 139 | AP008971.1 | GCA000010185_00083 | CDS | open | 102466-103659 | _na 397_aa | tuf | elongation factor Tu |
| 140 | AP008971.1 | GCA000010185_00084 | CDS | open | 103744-104127 | _na 127_aa | ATP-cone domain-containing protein | |
| 141 | AP008971.1 | GCA000010185_00085 | CDS | open | 104140-106512 | _na 790_aa | Putative cell wall binding repeat 2 | |
| 142 | AP008971.1 | GCA000010185_00086 | CDS | open | 106667-107980 | _na 437_aa | lytB | Cell wall protein V |
| 143 | AP008971.1 | GCA000010185_00087 | CDS | open | 108083-108352 | _na 89_aa | ABC transporter permease | |
| 144 | AP008971.1 | GCA000010185_00088 | CDS | open | 108435-108977 | _na 180_aa | DUF11 domain-containing protein | |
| 145 | AP008971.1 | GCA000010185_00089 | CDS | open | 109078-109947 | _na 289_aa | DUF2232 domain-containing protein | |
| 146 | AP008971.1 | GCA000010185_00090 | CDS | open | 109934-111922 | _na 662_aa | gdpP | Cyclic-di-AMP phosphodiesterase |
| 147 | AP008971.1 | GCA000010185_00091 | CDS | open | 111903-112349 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 148 | AP008971.1 | GCA000010185_00092 | CDS | open | 112383-113720 | _na 445_aa | dnaB | replicative DNA helicase |
| 149 | AP008971.1 | GCA000010185_00093 | CDS | open | 113717-114280 | _na 187_aa | rimL | Acetyltransferase |
| 150 | AP008971.1 | GCA000010185_00094 | CDS | open | 114285-115043 | _na 252_aa | dnaD | DnaD domain protein |
| 151 | AP008971.1 | GCA000010185_00095 | CDS | open | 115046-116023 | _na 325_aa | dnaC | ATP-binding protein |
| 152 | AP008971.1 | GCA000010185_00096 | CDS | open | 116020-116664 | _na 214_aa | nnrE | NAD(P)H-hydrate epimerase |
| 153 | AP008971.1 | GCA000010185_00097 | CDS | open | 117167-117709 | _na 180_aa | ECF transporter S component | |
| 154 | AP008971.1 | GCA000010185_00098 | CDS | open | 117693-118379 | _na 228_aa | raSEA | Elp3/MiaA/NifB-like radical SAM core domain-containing protein |
| 155 | AP008971.1 | GCA000010185_00099 | CDS | open | 118446-119150 | _na 234_aa | EF-hand domain-containing protein | |
| 156 | AP008971.1 | GCA000010185_00100 | CDS | open | 119208-119435 | _na 75_aa | hypothetical protein | |
| 157 | AP008971.1 | GCA000010185_00101 | CDS | open | 119448-119630 | _na 60_aa | DUF1328 domain-containing protein | |
| 158 | AP008971.1 | GCA000010185_00102 | CDS | open | 119766-120704 | _na 312_aa | dacC | D-alanyl-D-alanine carboxypeptidase |
| 159 | AP008971.1 | GCA000010185_00103 | CDS | open | 121046-122311 | _na 421_aa | serS | serine--tRNA ligase |
| 160 | AP008971.1 | GCA000010185_00104 | CDS | open | 122339-123475 | _na 378_aa | rfaB | Glycosyltransferase%2C group 1 family protein |
| 161 | AP008971.1 | GCA000010185_00105 | CDS | open | 123484-124668 | _na 394_aa | dacC | serine-type D-Ala-D-Ala carboxypeptidase |
| 162 | AP008971.1 | GCA000010185_00107 | CDS | open | 124944-125969 | _na 341_aa | DUF3644 domain-containing protein | |
| 163 | AP008971.1 | GCA000010185_00108 | CDS | open | 125991-126734 | _na 247_aa | DUF4130 domain-containing protein | |
| 164 | AP008971.1 | GCA000010185_00109 | CDS | open | 126737-127972 | _na 411_aa | Biotin synthase related domain containing protein | |
| 165 | AP008971.1 | GCA000010185_00110 | CDS | open | 128113-129390 | _na 425_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 166 | AP008971.1 | GCA000010185_00111 | CDS | open | 129461-129814 | _na 117_aa | ykvA | DUF1232 domain-containing protein |
| 167 | AP008971.1 | GCA000010185_00112 | CDS | open | 129875-130414 | _na 179_aa | pncA | Isochorismatase-like domain-containing protein |
| 168 | AP008971.1 | GCA000010185_00113 | CDS | open | 130461-131609 | _na 382_aa | Transporter gate domain protein | |
| 169 | AP008971.1 | GCA000010185_00114 | CDS | open | 131667-132443 | _na 258_aa | traX | TraX protein |
| 170 | AP008971.1 | GCA000010185_00115 | CDS | open | 132526-132864 | _na 112_aa | arsD | Arsenic metallochaperone ArsD family protein |
| 171 | AP008971.1 | GCA000010185_00116 | CDS | open | 132946-133635 | _na 229_aa | puuD | Glutamine amidotransferase |
| 172 | AP008971.1 | GCA000010185_00118 | CDS | open | 133886-134797 | _na 303_aa | rhaT | Putative membrane protein |
| 173 | AP008971.1 | GCA000010185_00119 | CDS | open | 134926-135870 | _na 314_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 174 | AP008971.1 | GCA000010185_00120 | CDS | open | 135970-137367 | _na 465_aa | skfB | Fe-S oxidoreductases |
| 175 | AP008971.1 | GCA000010185_00121 | CDS | open | 137519-138076 | _na 185_aa | acrR | HTH-type transcriptional regulator MtrR |
| 176 | AP008971.1 | GCA000010185_00122 | CDS | open | 138168-138494 | _na 108_aa | yurZ | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 177 | AP008971.1 | GCA000010185_00123 | CDS | open | 138674-139606 | _na 310_aa | pstS | Phosphate binding protein |
| 178 | AP008971.1 | GCA000010185_00124 | CDS | open | 139669-140535 | _na 288_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 179 | AP008971.1 | GCA000010185_00125 | CDS | open | 140522-141373 | _na 283_aa | pstA | Phosphate ABC transporter permease protein |
| 180 | AP008971.1 | GCA000010185_00126 | CDS | open | 141351-142028 | _na 225_aa | pstB | Phosphate ABC transporter ATP-binding protein |
| 181 | AP008971.1 | GCA000010185_00127 | CDS | open | 142055-142756 | _na 233_aa | ompR | Response regulator ArlR |
| 182 | AP008971.1 | GCA000010185_00128 | CDS | open | 142749-143831 | _na 360_aa | baeS | histidine kinase |
| 183 | AP008971.1 | GCA000010185_00129 | CDS | open | 143951-146110 | _na 719_aa | Conserved membrane spanning protein | |
| 184 | AP008971.1 | GCA000010185_00130 | CDS | open | 146111-146794 | _na 227_aa | lolD | Lipoprotein-releasing system ATP-binding protein LolD |
| 185 | AP008971.1 | GCA000010185_00131 | CDS | open | 147052-148194 | _na 380_aa | rfaB | Glycosyltransferase%2C group 1 family protein |
| 186 | AP008971.1 | GCA000010185_00132 | CDS | open | 148208-149434 | _na 408_aa | wecC | UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase |
| 187 | AP008971.1 | GCA000010185_00133 | CDS | open | 149489-150580 | _na 363_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 188 | AP008971.1 | GCA000010185_00134 | CDS | open | 150697-150870 | _na 57_aa | NADH azoreductase | |
| 189 | AP008971.1 | GCA000010185_00135 | CDS | open | 150920-151069 | _na 49_aa | NADH azoreductase | |
| 190 | AP008971.1 | GCA000010185_00136 | CDS | open | 151082-151246 | _na 54_aa | NADH azoreductase | |
| 191 | AP008971.1 | GCA000010185_00137 | CDS | open | 151755-152786 | _na 343_aa | frvX | Aminopeptidase YpdE |
| 192 | AP008971.1 | GCA000010185_00138 | CDS | open | 152887-154401 | _na 504_aa | baeS | histidine kinase |
| 193 | AP008971.1 | GCA000010185_00139 | CDS | open | 154388-155056 | _na 222_aa | ompR | Two-component response regulator |
| 194 | AP008971.1 | GCA000010185_00140 | CDS | open | 155108-155860 | _na 250_aa | ABC-2 type transporter | |
| 195 | AP008971.1 | GCA000010185_00141 | CDS | open | 155860-156723 | _na 287_aa | rbbA | ABC transporter%2C ATP-binding protein |
| 196 | AP008971.1 | GCA000010185_00142 | CDS | open | 156829-157326 | _na 165_aa | Nucleoside 2-deoxyribosyltransferase | |
| 197 | AP008971.1 | GCA000010185_00143 | CDS | open | 157428-157667 | _na 79_aa | DUF3953 domain-containing protein | |
| 198 | AP008971.1 | GCA000010185_00144 | CDS | open | 157935-159191 | _na 418_aa | purA | adenylosuccinate synthase |
| 199 | AP008971.1 | GCA000010185_00145 | CDS | open | 159233-160114 | _na 293_aa | hypothetical protein | |
| 200 | AP008971.1 | GCA000010185_00146 | CDS | open | 160198-161217 | _na 339_aa | ugpC | Sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC |
| 201 | AP008971.1 | GCA000010185_00147 | CDS | open | 161236-162516 | _na 426_aa | ugpB | Sugar ABC transporter substrate-binding protein |
| 202 | AP008971.1 | GCA000010185_00148 | CDS | open | 162582-163433 | _na 283_aa | ugpA | Sugar ABC transporter permease protein |
| 203 | AP008971.1 | GCA000010185_00149 | CDS | open | 163443-164288 | _na 281_aa | ugpE | Sugar ABC transporter permease protein |
| 204 | AP008971.1 | GCA000010185_00150 | CDS | open | 164620-165210 | _na 196_aa | acrR | Transcriptional regulator TetR/AcrR family |
| 205 | AP008971.1 | GCA000010185_00151 | CDS | open | 165222-167276 | _na 684_aa | mMPL | SSD domain-containing protein |
| 206 | AP008971.1 | GCA000010185_00152 | CDS | open | 167289-169622 | _na 777_aa | smc | Chromosome segregation protein |
| 207 | AP008971.1 | GCA000010185_00153 | CDS | open | 169888-171618 | _na 576_aa | proS | proline--tRNA ligase |
| 208 | AP008971.1 | GCA000010185_00154 | CDS | open | 171758-171958 | _na 66_aa | xRE | DNA-binding helix-turn-helix protein |
| 209 | AP008971.1 | GCA000010185_00155 | CDS | open | 171959-172408 | _na 149_aa | DUF2178 domain-containing protein | |
| 210 | AP008971.1 | GCA000010185_00156 | CDS | open | 172539-173582 | _na 347_aa | Fido domain-containing protein | |
| 211 | AP008971.1 | GCA000010185_00157 | CDS | open | 173632-174696 | _na 354_aa | ubiE | Arsenite methyltransferase |
| 212 | AP008971.1 | GCA000010185_00158 | CDS | open | 174723-175556 | _na 277_aa | glpF | Glycerol uptake facilitator protein |
| 213 | AP008971.1 | GCA000010185_00159 | CDS | open | 175720-176682 | _na 320_aa | rimL | Conserved hpothetical protein |
| 214 | AP008971.1 | GCA000010185_00160 | CDS | open | 176774-178114 | _na 446_aa | norM | putative multidrug resistance protein NorM |
| 215 | AP008971.1 | GCA000010185_00161 | CDS | open | 178195-178728 | _na 177_aa | hdeD | DUF308 domain-containing protein |
| 216 | AP008971.1 | GCA000010185_00162 | CDS | open | 179479-179787 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 217 | AP008971.1 | GCA000010185_00163 | CDS | open | 179862-180491 | _na 209_aa | rplC | 50S ribosomal protein L3 |
| 218 | AP008971.1 | GCA000010185_00164 | CDS | open | 180507-181130 | _na 207_aa | rplD | 50S ribosomal protein L4 |
| 219 | AP008971.1 | GCA000010185_00165 | CDS | open | 181130-181420 | _na 96_aa | rplW | 50S ribosomal protein L23 |
| 220 | AP008971.1 | GCA000010185_00166 | CDS | open | 181437-182267 | _na 276_aa | rplB | 50S ribosomal protein L2 |
| 221 | AP008971.1 | GCA000010185_00167 | CDS | open | 182280-182564 | _na 94_aa | rpsS | 30S ribosomal protein S19 |
| 222 | AP008971.1 | GCA000010185_00168 | CDS | open | 182582-182920 | _na 112_aa | rplV | 50S ribosomal protein L22 |
| 223 | AP008971.1 | GCA000010185_00169 | CDS | open | 182932-183666 | _na 244_aa | rpsC | 30S ribosomal protein S3 |
| 224 | AP008971.1 | GCA000010185_00170 | CDS | open | 183688-184131 | _na 147_aa | rplP | 50S ribosomal protein L16 |
| 225 | AP008971.1 | GCA000010185_00171 | CDS | open | 184121-184327 | _na 68_aa | rpmC | 50S ribosomal protein L29 |
| 226 | AP008971.1 | GCA000010185_00172 | CDS | open | 184333-184587 | _na 84_aa | rpsQ | 30S ribosomal protein S17 |
| 227 | AP008971.1 | GCA000010185_00173 | CDS | open | 184612-184980 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 228 | AP008971.1 | GCA000010185_00174 | CDS | open | 184999-185307 | _na 102_aa | rplX | 50S ribosomal protein L24 |
| 229 | AP008971.1 | GCA000010185_00175 | CDS | open | 185326-185868 | _na 180_aa | rplE | 50S ribosomal protein L5 |
| 230 | AP008971.1 | GCA000010185_00176 | CDS | open | 185881-186066 | _na 61_aa | rpsZ | type Z 30S ribosomal protein S14 |
| 231 | AP008971.1 | GCA000010185_00177 | CDS | open | 186088-186483 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 232 | AP008971.1 | GCA000010185_00178 | CDS | open | 186510-187049 | _na 179_aa | rplF | 50S ribosomal protein L6 |
| 233 | AP008971.1 | GCA000010185_00179 | CDS | open | 187064-187426 | _na 120_aa | rplR | 50S ribosomal protein L18 |
| 234 | AP008971.1 | GCA000010185_00180 | CDS | open | 187447-187953 | _na 168_aa | rpsE | 30S ribosomal protein S5 |
| 235 | AP008971.1 | GCA000010185_00181 | CDS | open | 187967-188149 | _na 60_aa | rpmD | 50S ribosomal protein L30 |
| 236 | AP008971.1 | GCA000010185_00182 | CDS | open | 188161-188610 | _na 149_aa | rplO | 50S ribosomal protein L15 |
| 237 | AP008971.1 | GCA000010185_00183 | CDS | open | 188612-189886 | _na 424_aa | secY | preprotein translocase subunit SecY |
| 238 | AP008971.1 | GCA000010185_00184 | CDS | open | 189897-190544 | _na 215_aa | adk | adenylate kinase |
| 239 | AP008971.1 | GCA000010185_00185 | CDS | open | 190550-190834 | _na 94_aa | rPL14A | KOW domain-containing protein |
| 240 | AP008971.1 | GCA000010185_00186 | CDS | open | 190815-191030 | _na 71_aa | infA | translation initiation factor IF-1 |
| 241 | AP008971.1 | GCA000010185_00187 | CDS | open | 191045-191158 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 242 | AP008971.1 | GCA000010185_00188 | CDS | open | 191171-191521 | _na 116_aa | rpsM | 30S ribosomal protein S13 |
| 243 | AP008971.1 | GCA000010185_00189 | CDS | open | 191537-191944 | _na 135_aa | rpsK | 30S ribosomal protein S11 |
| 244 | AP008971.1 | GCA000010185_00190 | CDS | open | 192000-192953 | _na 317_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 245 | AP008971.1 | GCA000010185_00191 | CDS | open | 192967-193362 | _na 131_aa | rplQ | 50S ribosomal protein L17 |
| 246 | AP008971.1 | GCA000010185_00192 | CDS | open | 193495-195468 | _na 657_aa | lytB | Putative N-acetylmuramoyl-L-alanine amidase |
| 247 | AP008971.1 | GCA000010185_00193 | CDS | open | 195563-196159 | _na 198_aa | rpsD | 30S ribosomal protein S4 |
| 248 | AP008971.1 | GCA000010185_00194 | CDS | open | 196263-197498 | _na 411_aa | YoaR-like putative peptidoglycan binding domain-containing protein | |
| 249 | AP008971.1 | GCA000010185_00210 | CDS | open | 205042-219801 | _na 4919_aa | clfA | G5 domain-containing protein |
| 250 | AP008971.1 | GCA000010185_00211 | CDS | open | 220115-222505 | _na 796_aa | Cell wall surface anchor family protein | |
| 251 | AP008971.1 | GCA000010185_00212 | CDS | open | 222629-224020 | _na 463_aa | clfA | Putative cell wall surface anchor family protein |
| 252 | AP008971.1 | GCA000010185_00213 | CDS | open | 224195-225061 | _na 288_aa | srtA | Sortase family protein |
| 253 | AP008971.1 | GCA000010185_00214 | CDS | open | 225048-225887 | _na 279_aa | srtA | Sortase family protein |
| 254 | AP008971.1 | GCA000010185_00215 | CDS | open | 225874-226728 | _na 284_aa | srtA | Sortase family protein |
| 255 | AP008971.1 | GCA000010185_00216 | CDS | open | 226831-227334 | _na 167_aa | yhbS | Acetyltransferase%2C GNAT family |
| 256 | AP008971.1 | GCA000010185_00217 | CDS | open | 227334-228068 | _na 244_aa | nit1 | CN hydrolase domain-containing protein |
| 257 | AP008971.1 | GCA000010185_00218 | CDS | open | 229294-229869 | _na 191_aa | fic | protein adenylyltransferase Fic |
| 258 | AP008971.1 | GCA000010185_00219 | CDS | open | 230897-231475 | _na 192_aa | Lipoprotein | |
| 259 | AP008971.1 | GCA000010185_00220 | CDS | open | 231558-232484 | _na 308_aa | elyC | DUF218 domain-containing protein |
| 260 | AP008971.1 | GCA000010185_00221 | CDS | open | 232561-233346 | _na 261_aa | rssA | PNPLA domain-containing protein |
| 261 | AP008971.1 | GCA000010185_00222 | CDS | open | 233453-233947 | _na 164_aa | hypothetical protein | |
| 262 | AP008971.1 | GCA000010185_00223 | CDS | open | 234008-235756 | _na 582_aa | mdlB | Putative multidrug resistance ABC transporter ATP-binding/permease protein YheI |
| 263 | AP008971.1 | GCA000010185_00224 | CDS | open | 235734-237470 | _na 578_aa | mdlB | Putative multidrug resistance ABC transporter ATP-binding/permease protein YheH |
| 264 | AP008971.1 | GCA000010185_00225 | CDS | open | 237472-238935 | _na 487_aa | malQ | 4-alpha-glucanotransferase |
| 265 | AP008971.1 | GCA000010185_00226 | CDS | open | 238995-239798 | _na 267_aa | thiD | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase |
| 266 | AP008971.1 | GCA000010185_00227 | CDS | open | 239791-240429 | _na 212_aa | thiE | Thiamine-phosphate synthase |
| 267 | AP008971.1 | GCA000010185_00228 | CDS | open | 241168-241608 | _na 146_aa | marR | HTH-type transcriptional regulator SarZ |
| 268 | AP008971.1 | GCA000010185_00229 | CDS | open | 241586-242431 | _na 281_aa | yhaK | Pirin family protein |
| 269 | AP008971.1 | GCA000010185_00230 | CDS | open | 242445-243017 | _na 190_aa | fMR2 | Nitroreductase family protein |
| 270 | AP008971.1 | GCA000010185_00231 | CDS | open | 244145-245455 | _na 436_aa | norM | Multidrug export protein MepA |
| 271 | AP008971.1 | GCA000010185_00232 | CDS | open | 245477-245977 | _na 166_aa | mug | DNA-deoxyinosine glycosylase |
| 272 | AP008971.1 | GCA000010185_00233 | CDS | open | 246198-247451 | _na 417_aa | cdsB | UPF0597 protein FMG_0209 |
| 273 | AP008971.1 | GCA000010185_00234 | CDS | open | 247461-248186 | _na 241_aa | puuD | Putative glutamine amidotransferase |
| 274 | AP008971.1 | GCA000010185_00235 | CDS | open | 248198-249568 | _na 456_aa | potE | Putative amino acid transporter |
| 275 | AP008971.1 | GCA000010185_00236 | CDS | open | 250011-251222 | _na 403_aa | DUF819 domain-containing protein | |
| 276 | AP008971.1 | GCA000010185_00237 | CDS | open | 251307-252722 | _na 471_aa | pepD2 | Beta-Ala-His dipeptidase |
| 277 | AP008971.1 | GCA000010185_00238 | CDS | open | 253437-254600 | _na 387_aa | aspB | Aminotransferase |
| 278 | AP008971.1 | GCA000010185_00239 | CDS | open | 254602-255957 | _na 451_aa | paaK | CoF synthetase |
| 279 | AP008971.1 | GCA000010185_00240 | CDS | open | 255950-256843 | _na 297_aa | porB | Pyruvate/ferredoxin oxidoreductase beta subunit |
| 280 | AP008971.1 | GCA000010185_00241 | CDS | open | 256836-257981 | _na 381_aa | porA | Pyruvate ferredoxin oxidoreductase |
| 281 | AP008971.1 | GCA000010185_00242 | CDS | open | 257978-258271 | _na 97_aa | porD | 4Fe-4S ferredoxin-type domain-containing protein |
| 282 | AP008971.1 | GCA000010185_00243 | CDS | open | 258252-258788 | _na 178_aa | porG | Pyruvate/ferredoxin oxidoreductase gamma subunit |
| 283 | AP008971.1 | GCA000010185_00244 | CDS | open | 259151-259462 | _na 103_aa | DUF5960 domain-containing protein | |
| 284 | AP008971.1 | GCA000010185_00245 | CDS | open | 259465-259821 | _na 118_aa | YolD-like protein | |
| 285 | AP008971.1 | GCA000010185_00246 | CDS | open | 259790-261208 | _na 472_aa | dinP | DNA polymerase IV |
| 286 | AP008971.1 | GCA000010185_00247 | CDS | open | 261219-261761 | _na 180_aa | immA | IrrE N-terminal-like domain-containing protein |
| 287 | AP008971.1 | GCA000010185_00248 | CDS | open | 261766-262170 | _na 134_aa | hipB | Transcriptional regulator |
| 288 | AP008971.1 | GCA000010185_00249 | CDS | open | 262351-262476 | _na 41_aa | hypothetical protein | |
| 289 | AP008971.1 | GCA000010185_00250 | CDS | open | 262839-263510 | _na 223_aa | zinT | ZinT/AdcA family metal-binding protein |
| 290 | AP008971.1 | GCA000010185_00251 | CDS | open | 263578-264894 | _na 438_aa | znuA | High-affinity zinc uptake system binding-protein ZnuA |
| 291 | AP008971.1 | GCA000010185_00252 | CDS | open | 264895-265566 | _na 223_aa | znuC | ATP-binding cassette domain-containing protein |
| 292 | AP008971.1 | GCA000010185_00253 | CDS | open | 265560-266399 | _na 279_aa | znuB | Zinc ABC transporter permease protein |
| 293 | AP008971.1 | GCA000010185_00254 | CDS | open | 266428-266637 | _na 69_aa | SpoVT-AbrB domain-containing protein | |
| 294 | AP008971.1 | GCA000010185_00255 | CDS | open | 266838-272519 | _na 1893_aa | Putative surface protein | |
| 295 | AP008971.1 | GCA000010185_00256 | CDS | open | 272922-273800 | _na 292_aa | yejR | Metal chaperone YciC |
| 296 | AP008971.1 | GCA000010185_00257 | CDS | open | 273793-274575 | _na 260_aa | Uroporphyrinogen decarboxylase (URO-D) domain-containing protein | |
| 297 | AP008971.1 | GCA000010185_00258 | CDS | open | 274577-275230 | _na 217_aa | mtbC1 | Putative dimethylamine corrinoid protein |
| 298 | AP008971.1 | GCA000010185_00259 | CDS | open | 275368-276945 | _na 525_aa | 2Fe-2S ferredoxin-type domain-containing protein | |
| 299 | AP008971.1 | GCA000010185_00260 | CDS | open | 276948-277394 | _na 148_aa | Transcobalamin-like C-terminal domain-containing protein | |
| 300 | AP008971.1 | GCA000010185_00261 | CDS | open | 277394-277903 | _na 169_aa | ECF transporter S component | |
| 301 | AP008971.1 | GCA000010185_00262 | CDS | open | 277976-278707 | _na 243_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 302 | AP008971.1 | GCA000010185_00263 | CDS | open | 278720-279904 | _na 394_aa | tVP38 | TVP38/TMEM64 family membrane protein |
| 303 | AP008971.1 | GCA000010185_00264 | CDS | open | 280088-281383 | _na 431_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 304 | AP008971.1 | GCA000010185_00265 | CDS | open | 281522-282460 | _na 312_aa | rbbA | Antibiotic ABC transporter ATP-binding protein |
| 305 | AP008971.1 | GCA000010185_00266 | CDS | open | 282462-283559 | _na 365_aa | Antibiotic ABC transporter permease protein | |
| 306 | AP008971.1 | GCA000010185_00267 | CDS | open | 283546-284658 | _na 370_aa | yadH | Putative ABC transporter |
| 307 | AP008971.1 | GCA000010185_00268 | CDS | open | 284706-285971 | _na 421_aa | gntT | Gluconate permease |
| 308 | AP008971.1 | GCA000010185_00269 | CDS | open | 285973-287103 | _na 376_aa | glxK | Glycerate kinase |
| 309 | AP008971.1 | GCA000010185_00270 | CDS | open | 287207-288289 | _na 360_aa | cdaR | Sugar diacid recognition |
| 310 | AP008971.1 | GCA000010185_00271 | CDS | open | 288550-289404 | _na 284_aa | brkB | Ribonuclease |
| 311 | AP008971.1 | GCA000010185_00272 | CDS | open | 289408-291303 | _na 631_aa | dAP2 | Peptidase%2C S9A/B/C family%2C catalytic domain protein |
| 312 | AP008971.1 | GCA000010185_00273 | CDS | open | 291688-292287 | _na 199_aa | DUF1129 domain-containing protein | |
| 313 | AP008971.1 | GCA000010185_00274 | CDS | open | 292393-294141 | _na 582_aa | mdlB | Multidrug export ATP-binding/permease protein |
| 314 | AP008971.1 | GCA000010185_00275 | CDS | open | 294179-294577 | _na 132_aa | DUF3139 domain-containing protein | |
| 315 | AP008971.1 | GCA000010185_00276 | CDS | open | 294770-295930 | _na 386_aa | gspE | Type II secretion system protein E |
| 316 | AP008971.1 | GCA000010185_00277 | CDS | open | 295920-297011 | _na 363_aa | gspF | Type II secretion system protein F |
| 317 | AP008971.1 | GCA000010185_00278 | CDS | open | 297268-298326 | _na 352_aa | malK | Sugar ABC transportor ATP-binding protein |
| 318 | AP008971.1 | GCA000010185_00279 | CDS | open | 298482-299714 | _na 410_aa | ugpB | Sugar ABC transporter substrate-binding protein |
| 319 | AP008971.1 | GCA000010185_00280 | CDS | open | 299716-300582 | _na 288_aa | ugpA | Sugar ABC transporter permease protein |
| 320 | AP008971.1 | GCA000010185_00281 | CDS | open | 300572-301396 | _na 274_aa | ugpE | Sugar ABC transporter permease protein |
| 321 | AP008971.1 | GCA000010185_00282 | CDS | open | 301396-303072 | _na 558_aa | Glycoside hydrolase 123 catalytic domain-containing protein | |
| 322 | AP008971.1 | GCA000010185_00283 | CDS | open | 303177-306077 | _na 966_aa | cym1 | Peptidase M16 inactive domain protein |
| 323 | AP008971.1 | GCA000010185_00284 | CDS | open | 306249-307010 | _na 253_aa | xthA | exodeoxyribonuclease III |
| 324 | AP008971.1 | GCA000010185_00285 | CDS | open | 307020-307865 | _na 281_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 325 | AP008971.1 | GCA000010185_00286 | CDS | open | 307901-309166 | _na 421_aa | gltP | Proton glutamate symport protein |
| 326 | AP008971.1 | GCA000010185_00287 | CDS | open | 309253-309936 | _na 227_aa | tVP38 | TVP38/TMEM64 family membrane protein |
| 327 | AP008971.1 | GCA000010185_00288 | CDS | open | 310031-311395 | _na 454_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 328 | AP008971.1 | GCA000010185_00289 | CDS | open | 311398-312450 | _na 350_aa | ddl | D-alanine--D-alanine ligase |
| 329 | AP008971.1 | GCA000010185_00290 | CDS | open | 312623-315001 | _na 792_aa | glgP | Alpha-1%2C4 glucan phosphorylase |
| 330 | AP008971.1 | GCA000010185_00291 | CDS | open | 314988-315323 | _na 111_aa | Thioredoxin | |
| 331 | AP008971.1 | GCA000010185_00292 | CDS | open | 315333-316382 | _na 349_aa | corA | magnesium/cobalt transporter CorA |
| 332 | AP008971.1 | GCA000010185_00293 | CDS | open | 316398-316952 | _na 184_aa | hypothetical protein | |
| 333 | AP008971.1 | GCA000010185_00294 | CDS | open | 316952-317440 | _na 162_aa | folA | dihydrofolate reductase |
| 334 | AP008971.1 | GCA000010185_00295 | CDS | open | 317742-318929 | _na 395_aa | Zinc-ribbon domain-containing protein | |
| 335 | AP008971.1 | GCA000010185_00296 | CDS | open | 318938-319852 | _na 304_aa | fruK | Tagatose-6-phosphate kinase |
| 336 | AP008971.1 | GCA000010185_00297 | CDS | open | 320400-321395 | _na 331_aa | dppD | Oligopeptide ABC transporter ATP-binding protein |
| 337 | AP008971.1 | GCA000010185_00298 | CDS | open | 321405-322343 | _na 312_aa | yejF | Oligopeptide transport ATP-binding protein OppF |
| 338 | AP008971.1 | GCA000010185_00299 | CDS | open | 322345-323313 | _na 322_aa | dppB | Oligopeptide ABC transporter permease protein |
| 339 | AP008971.1 | GCA000010185_00300 | CDS | open | 323323-324243 | _na 306_aa | dppC | Oligopeptide ABC transporter permease protein |
| 340 | AP008971.1 | GCA000010185_00301 | CDS | open | 324255-326108 | _na 617_aa | ddpA | Oligopeptide ABC transporter substrate-binding protein |
| 341 | AP008971.1 | GCA000010185_00302 | CDS | open | 326245-327201 | _na 318_aa | SH3 domain-containing protein | |
| 342 | AP008971.1 | GCA000010185_00303 | CDS | open | 327244-328287 | _na 347_aa | dinP | DNA polymerase IV |
| 343 | AP008971.1 | GCA000010185_00304 | CDS | open | 328356-328670 | _na 104_aa | padR | Transcriptional regulator PadR family |
| 344 | AP008971.1 | GCA000010185_00305 | CDS | open | 328671-329705 | _na 344_aa | DUF4097 domain-containing protein | |
| 345 | AP008971.1 | GCA000010185_00306 | CDS | open | 329834-330955 | _na 373_aa | rlmL | THUMP domain-containing protein |
| 346 | AP008971.1 | GCA000010185_00307 | CDS | open | 330968-332074 | _na 368_aa | rsbU | Phosphoserine phosphatase RsbU |
| 347 | AP008971.1 | GCA000010185_00308 | CDS | open | 332083-333360 | _na 425_aa | pgi | glucose-6-phosphate isomerase |
| 348 | AP008971.1 | GCA000010185_00309 | CDS | open | 333362-333871 | _na 169_aa | hypothetical protein | |
| 349 | AP008971.1 | GCA000010185_00310 | CDS | open | 333888-335336 | _na 482_aa | cedB | Helicase HerA-like C-terminal domain-containing protein |
| 350 | AP008971.1 | GCA000010185_00311 | CDS | open | 335380-336081 | _na 233_aa | ubiG | Putative methyltransferase |
| 351 | AP008971.1 | GCA000010185_00312 | CDS | open | 336194-337174 | _na 326_aa | Peptidase C39-like domain-containing protein | |
| 352 | AP008971.1 | GCA000010185_00313 | CDS | open | 337175-337879 | _na 234_aa | spoU | 23S rRNA methyltransferase |
| 353 | AP008971.1 | GCA000010185_00314 | CDS | open | 337879-338574 | _na 231_aa | gph | Phosphoglycolate phosphatase |
| 354 | AP008971.1 | GCA000010185_00315 | CDS | open | 338546-339166 | _na 206_aa | queH | Epoxyqueuosine reductase QueH |
| 355 | AP008971.1 | GCA000010185_00316 | CDS | open | 339290-340045 | _na 251_aa | fdhD | formate dehydrogenase accessory sulfurtransferase FdhD |
| 356 | AP008971.1 | GCA000010185_00317 | CDS | open | 340045-340680 | _na 211_aa | focA | Formate/nitrite transporter |
| 357 | AP008971.1 | GCA000010185_00318 | CDS | open | 340691-341872 | _na 393_aa | moeA | Molybdopterin molybdenumtransferase |
| 358 | AP008971.1 | GCA000010185_00319 | CDS | open | 341869-342876 | _na 335_aa | mobB | molybdopterin-guanine dinucleotide biosynthesis protein B |
| 359 | AP008971.1 | GCA000010185_00320 | CDS | open | 342886-343341 | _na 151_aa | yjhB | Mutator protein MutT/nudix family |
| 360 | AP008971.1 | GCA000010185_00321 | CDS | open | 343341-344249 | _na 302_aa | rhaT | Putative membrane protein |
| 361 | AP008971.1 | GCA000010185_00322 | CDS | open | 344242-344982 | _na 246_aa | sIR2 | NAD-dependent protein deacylase |
| 362 | AP008971.1 | GCA000010185_00323 | CDS | open | 344972-345370 | _na 132_aa | MJ0042 family finger-like domain protein | |
| 363 | AP008971.1 | GCA000010185_00324 | CDS | open | 345583-346443 | _na 286_aa | degV | 6-phosphogluconate dehydratase |
| 364 | AP008971.1 | GCA000010185_00325 | CDS | open | 346603-347757 | _na 384_aa | trxA | Thioredoxin domain-containing protein |
| 365 | AP008971.1 | GCA000010185_00326 | CDS | open | 347917-348816 | _na 299_aa | napH | 4Fe-4S ferredoxin-type domain-containing protein |
| 366 | AP008971.1 | GCA000010185_00327 | CDS | open | 348950-349699 | _na 249_aa | pspE | Thiosulfate sulfurtransferase PspE |
| 367 | AP008971.1 | GCA000010185_00328 | CDS | open | 349754-351235 | _na 493_aa | 2-phospho-L-lactate guanylyltransferase | |
| 368 | AP008971.1 | GCA000010185_00329 | CDS | open | 351207-351869 | _na 220_aa | bcsA | TIGR04283 family arsenosugar biosynthesis glycosyltransferase |
| 369 | AP008971.1 | GCA000010185_00330 | CDS | open | 351844-352791 | _na 315_aa | glpC | 4Fe-4S ferredoxin-type domain-containing protein |
| 370 | AP008971.1 | GCA000010185_00331 | CDS | open | 352788-353708 | _na 306_aa | arsS | arsenosugar biosynthesis radical SAM (seleno)protein ArsS |
| 371 | AP008971.1 | GCA000010185_00332 | CDS | open | 353701-354141 | _na 146_aa | Oxidoreductase | |
| 372 | AP008971.1 | GCA000010185_00333 | CDS | open | 354268-355812 | _na 514_aa | FAD-dependent protein C-terminal domain-containing protein | |
| 373 | AP008971.1 | GCA000010185_00334 | CDS | open | 355881-356834 | _na 317_aa | fruK | Tagatose-6-phosphate kinase |
| 374 | AP008971.1 | GCA000010185_00335 | CDS | open | 357021-358472 | _na 483_aa | guaB | IMP dehydrogenase |
| 375 | AP008971.1 | GCA000010185_00336 | CDS | open | 358482-358955 | _na 157_aa | purE | N5-carboxyaminoimidazole ribonucleotide mutase |
| 376 | AP008971.1 | GCA000010185_00337 | CDS | open | 358955-359980 | _na 341_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 377 | AP008971.1 | GCA000010185_00338 | CDS | open | 359996-361111 | _na 371_aa | hemE | Putative metyhltransferase |
| 378 | AP008971.1 | GCA000010185_00339 | CDS | open | 361247-362842 | _na 531_aa | yheS | Putative ABC transporter ATP-binding protein YheS |
| 379 | AP008971.1 | GCA000010185_00340 | CDS | open | 362851-364383 | _na 510_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 380 | AP008971.1 | GCA000010185_00342 | CDS | open | 365150-366928 | _na 592_aa | gmrSD | DUF262 domain-containing protein |
| 381 | AP008971.1 | GCA000010185_00343 | CDS | open | 366978-367163 | _na 61_aa | DUF4926 domain-containing protein | |
| 382 | AP008971.1 | GCA000010185_00344 | CDS | open | 367882-369171 | _na 429_aa | DUF2254 domain-containing protein | |
| 383 | AP008971.1 | GCA000010185_00345 | CDS | open | 369724-371034 | _na 436_aa | metL1 | aspartate kinase |
| 384 | AP008971.1 | GCA000010185_00346 | CDS | open | 371035-372009 | _na 324_aa | asd | aspartate-semialdehyde dehydrogenase |
| 385 | AP008971.1 | GCA000010185_00347 | CDS | open | 372011-373192 | _na 393_aa | thrA | Homoserine dehydrogenase |
| 386 | AP008971.1 | GCA000010185_00348 | CDS | open | 373189-375483 | _na 764_aa | thrB | homoserine kinase |
| 387 | AP008971.1 | GCA000010185_00349 | CDS | open | 375620-378151 | _na 843_aa | mgtA | magnesium-translocating P-type ATPase |
| 388 | AP008971.1 | GCA000010185_00350 | CDS | open | 378386-378910 | _na 174_aa | hipB | DNA-binding helix-turn-helix protein |
| 389 | AP008971.1 | GCA000010185_00351 | CDS | open | 378952-380241 | _na 429_aa | abgB | Amidohydrolase |
| 390 | AP008971.1 | GCA000010185_00352 | CDS | open | 380257-381189 | _na 310_aa | 2-keto-3-deoxygluconate permease | |
| 391 | AP008971.1 | GCA000010185_00353 | CDS | open | 381356-381448 | _na 30_aa | hypothetical protein | |
| 392 | AP008971.1 | GCA000010185_00354 | CDS | open | 381607-381849 | _na 80_aa | hypothetical protein | |
| 393 | AP008971.1 | GCA000010185_00355 | CDS | open | 381920-383170 | _na 416_aa | PD-(D/E)XK nuclease superfamily protein | |
| 394 | AP008971.1 | GCA000010185_00356 | CDS | open | 383675-383902 | _na 75_aa | hsdM | Putative type I site-specific deoxyribonuclease |
| 395 | AP008971.1 | GCA000010185_00357 | CDS | open | 384130-384657 | _na 175_aa | Thioredoxin family protein | |
| 396 | AP008971.1 | GCA000010185_00358 | CDS | open | 384722-385159 | _na 145_aa | bfd | [2Fe-2S]-binding domain protein |
| 397 | AP008971.1 | GCA000010185_00359 | CDS | open | 385249-386145 | _na 298_aa | Type I restriction enzyme R protein C-terminal domain-containing protein | |
| 398 | AP008971.1 | GCA000010185_00360 | CDS | open | 386306-386767 | _na 153_aa | ctsR | Transcriptional regulator CtsR |
| 399 | AP008971.1 | GCA000010185_00361 | CDS | open | 386778-387377 | _na 199_aa | mcsA | Protein arginine kinase activator |
| 400 | AP008971.1 | GCA000010185_00362 | CDS | open | 387370-388365 | _na 331_aa | mcsB | Phosphagen kinase C-terminal domain-containing protein |
| 401 | AP008971.1 | GCA000010185_00363 | CDS | open | 388362-390782 | _na 806_aa | clpC | ATP-dependent Clp protease ATP-binding subunit ClpC |
| 402 | AP008971.1 | GCA000010185_00364 | CDS | open | 390784-392145 | _na 453_aa | radA | DNA repair protein RadA |
| 403 | AP008971.1 | GCA000010185_00365 | CDS | open | 392174-392479 | _na 101_aa | Lipoprotein | |
| 404 | AP008971.1 | GCA000010185_00366 | CDS | open | 392580-394265 | _na 561_aa | pepF | Oligoendopeptidase F%2C plasmid |
| 405 | AP008971.1 | GCA000010185_00367 | CDS | open | 394380-395192 | _na 270_aa | draG | Dinitrogenase reductase activating glycohydrolase |
| 406 | AP008971.1 | GCA000010185_00368 | CDS | open | 395235-396395 | _na 386_aa | eutG | Alcohol dehydrogenase%2C iron-dependent |
| 407 | AP008971.1 | GCA000010185_00369 | CDS | open | 396624-396956 | _na 110_aa | Lipoprotein | |
| 408 | AP008971.1 | GCA000010185_00371 | CDS | open | 397466-397918 | _na 150_aa | rpiB | ribose 5-phosphate isomerase B |
| 409 | AP008971.1 | GCA000010185_00372 | CDS | open | 397920-400547 | _na 875_aa | polA | DNA polymerase I |
| 410 | AP008971.1 | GCA000010185_00373 | CDS | open | 400534-401142 | _na 202_aa | coaE | dephospho-CoA kinase |
| 411 | AP008971.1 | GCA000010185_00374 | CDS | open | 401139-401780 | _na 213_aa | mltE | Soluble lytic murein transglycosylase |
| 412 | AP008971.1 | GCA000010185_00376 | CDS | open | 401923-403251 | _na 442_aa | rsxC | electron transport complex subunit RsxC |
| 413 | AP008971.1 | GCA000010185_00377 | CDS | open | 403255-404226 | _na 323_aa | rnfD | Ion-translocating oxidoreductase complex subunit D |
| 414 | AP008971.1 | GCA000010185_00378 | CDS | open | 404223-404795 | _na 190_aa | rnfG | Ion-translocating oxidoreductase complex subunit G |
| 415 | AP008971.1 | GCA000010185_00379 | CDS | open | 404806-405435 | _na 209_aa | rnfE | Ion-translocating oxidoreductase complex subunit E |
| 416 | AP008971.1 | GCA000010185_00380 | CDS | open | 405435-406016 | _na 193_aa | rnfA | Ion-translocating oxidoreductase complex subunit A |
| 417 | AP008971.1 | GCA000010185_00381 | CDS | open | 406027-406878 | _na 283_aa | rnfB | Ion-translocating oxidoreductase complex subunit B |
| 418 | AP008971.1 | GCA000010185_00382 | CDS | open | 407064-407738 | _na 224_aa | DUF969 domain-containing protein | |
| 419 | AP008971.1 | GCA000010185_00383 | CDS | open | 407731-408717 | _na 328_aa | DUF979 domain-containing protein | |
| 420 | AP008971.1 | GCA000010185_00384 | CDS | open | 408729-409370 | _na 213_aa | pcp | pyroglutamyl-peptidase I |
| 421 | AP008971.1 | GCA000010185_00385 | CDS | open | 409530-409907 | _na 125_aa | nusG | NusG domain-containing protein |
| 422 | AP008971.1 | GCA000010185_00386 | CDS | open | 409907-410419 | _na 170_aa | Heptaprenyl diphosphate synthase | |
| 423 | AP008971.1 | GCA000010185_00387 | CDS | open | 410422-411093 | _na 223_aa | radC | DNA repair protein RadC |
| 424 | AP008971.1 | GCA000010185_00388 | CDS | open | 411094-412089 | _na 331_aa | mreB | Cell shape-determining protein MreB |
| 425 | AP008971.1 | GCA000010185_00389 | CDS | open | 412090-412944 | _na 284_aa | mreC | Cell shape-determining protein MreC |
| 426 | AP008971.1 | GCA000010185_00390 | CDS | open | 412945-413436 | _na 163_aa | mreD | rod shape-determining protein MreD |
| 427 | AP008971.1 | GCA000010185_00391 | CDS | open | 413445-416771 | _na 1108_aa | mrdA | penicillin-binding protein 2 |
| 428 | AP008971.1 | GCA000010185_00392 | CDS | open | 416752-417348 | _na 198_aa | minD | Cell division inhibitor |
| 429 | AP008971.1 | GCA000010185_00393 | CDS | open | 417345-418349 | _na 334_aa | cafA | Ribonucleases G |
| 430 | AP008971.1 | GCA000010185_00394 | CDS | open | 418455-418763 | _na 102_aa | rplU | 50S ribosomal protein L21 |
| 431 | AP008971.1 | GCA000010185_00395 | CDS | open | 418763-419104 | _na 113_aa | ysxB | Ribosomal processing cysteine protease Prp |
| 432 | AP008971.1 | GCA000010185_00396 | CDS | open | 419107-419391 | _na 94_aa | rpmA | 50S ribosomal protein L27 |
| 433 | AP008971.1 | GCA000010185_00397 | CDS | open | 419518-420783 | _na 421_aa | obgE | GTPase ObgE |
| 434 | AP008971.1 | GCA000010185_00398 | CDS | open | 420792-421082 | _na 96_aa | yhbY | CRM domain-containing protein |
| 435 | AP008971.1 | GCA000010185_00399 | CDS | open | 421075-421674 | _na 199_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 436 | AP008971.1 | GCA000010185_00400 | CDS | open | 421664-422239 | _na 191_aa | yqeK | bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK |
| 437 | AP008971.1 | GCA000010185_00401 | CDS | open | 422240-422542 | _na 100_aa | rsfS | ribosome silencing factor |
| 438 | AP008971.1 | GCA000010185_00402 | CDS | open | 422552-422920 | _na 122_aa | ridA | Reactive intermediate/imine deaminase |
| 439 | AP008971.1 | GCA000010185_00403 | CDS | open | 423104-425446 | _na 780_aa | acm | N-acetylmuramoyl-L-alanine amidase |
| 440 | AP008971.1 | GCA000010185_00404 | CDS | open | 425542-426639 | _na 365_aa | ychF | redox-regulated ATPase YchF |
| 441 | AP008971.1 | GCA000010185_00405 | CDS | open | 426797-428566 | _na 589_aa | pepP | Xaa-Pro dipeptidase |
| 442 | AP008971.1 | GCA000010185_00406 | CDS | open | 428569-430395 | _na 608_aa | uvrC | excinuclease ABC subunit UvrC |
| 443 | AP008971.1 | GCA000010185_00407 | CDS | open | 430468-430977 | _na 169_aa | thiW | energy coupling factor transporter S component ThiW |
| 444 | AP008971.1 | GCA000010185_00408 | CDS | open | 430970-431776 | _na 268_aa | thiM | hydroxyethylthiazole kinase |
| 445 | AP008971.1 | GCA000010185_00409 | CDS | open | 431754-432398 | _na 214_aa | thiE | Thiamine-phosphate synthase |
| 446 | AP008971.1 | GCA000010185_00410 | CDS | open | 432401-432811 | _na 136_aa | DUF5301 domain-containing protein | |
| 447 | AP008971.1 | GCA000010185_00411 | CDS | open | 432932-433282 | _na 116_aa | yhcF | HTH-type transcriptional repressor YtrA |
| 448 | AP008971.1 | GCA000010185_00412 | CDS | open | 433279-434613 | _na 444_aa | Bacterial Pleckstrin-like y domain-containing protein | |
| 449 | AP008971.1 | GCA000010185_00413 | CDS | open | 434707-436362 | _na 551_aa | lytC | N-acetylmuramoyl-L-alanine amidase LytC |
| 450 | AP008971.1 | GCA000010185_00414 | CDS | open | 436796-438511 | _na 571_aa | N-acetylmuramoyl-L-alanine amidase | |
| 451 | AP008971.1 | GCA000010185_00415 | CDS | open | 438733-439692 | _na 319_aa | hprK | HPr(Ser) kinase/phosphatase |
| 452 | AP008971.1 | GCA000010185_00416 | CDS | open | 439828-443508 | _na 1226_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 453 | AP008971.1 | GCA000010185_00417 | CDS | open | 443804-444931 | _na 375_aa | caiA | Putative acyl-CoA dehydrogenase |
| 454 | AP008971.1 | GCA000010185_00418 | CDS | open | 445076-445903 | _na 275_aa | phnD | Phosphonate ABC transporter substrate-binding protein |
| 455 | AP008971.1 | GCA000010185_00419 | CDS | open | 445893-447068 | _na 391_aa | metE | Methionine synthase%2C vitamin-B12 independent |
| 456 | AP008971.1 | GCA000010185_00420 | CDS | open | 447061-447513 | _na 150_aa | Osmotically inducible protein C | |
| 457 | AP008971.1 | GCA000010185_00421 | CDS | open | 447905-448420 | _na 171_aa | Tryptophan transport protein | |
| 458 | AP008971.1 | GCA000010185_00422 | CDS | open | 448478-449251 | _na 257_aa | udp | uridine phosphorylase |
| 459 | AP008971.1 | GCA000010185_00423 | CDS | open | 449389-449922 | _na 177_aa | rae1 | NYN domain-containing protein |
| 460 | AP008971.1 | GCA000010185_00424 | CDS | open | 449912-450646 | _na 244_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 461 | AP008971.1 | GCA000010185_00425 | CDS | open | 450736-452181 | _na 481_aa | amyA | alpha-amylase |
| 462 | AP008971.1 | GCA000010185_00426 | CDS | open | 452174-452782 | _na 202_aa | rnh1 | ribonuclease H |
| 463 | AP008971.1 | GCA000010185_00427 | CDS | open | 452896-454140 | _na 414_aa | mpfA | CBS domain protein |
| 464 | AP008971.1 | GCA000010185_00428 | CDS | open | 454325-454843 | _na 172_aa | apt | adenine phosphoribosyltransferase |
| 465 | AP008971.1 | GCA000010185_00429 | CDS | open | 454923-456371 | _na 482_aa | pncB | nicotinate phosphoribosyltransferase |
| 466 | AP008971.1 | GCA000010185_00430 | CDS | open | 456487-458829 | _na 780_aa | copZ | P-type Cu(+) transporter |
| 467 | AP008971.1 | GCA000010185_00431 | CDS | open | 458829-459029 | _na 66_aa | copZ | Copper chaperone CopZ |
| 468 | AP008971.1 | GCA000010185_00432 | CDS | open | 459029-459292 | _na 87_aa | frmR | Copper-sensing transcriptional repressor CsoR |
| 469 | AP008971.1 | GCA000010185_00433 | CDS | open | 459443-459982 | _na 179_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 470 | AP008971.1 | GCA000010185_00434 | CDS | open | 460052-460315 | _na 87_aa | hypothetical protein | |
| 471 | AP008971.1 | GCA000010185_00435 | CDS | open | 460325-461029 | _na 234_aa | deoD | purine-nucleoside phosphorylase |
| 472 | AP008971.1 | GCA000010185_00436 | CDS | open | 461031-461672 | _na 213_aa | deoC | deoxyribose-phosphate aldolase |
| 473 | AP008971.1 | GCA000010185_00437 | CDS | open | 461721-462512 | _na 263_aa | hIS2 | Histidinol-phosphatase |
| 474 | AP008971.1 | GCA000010185_00438 | CDS | open | 462512-463453 | _na 313_aa | ldhA | 4-phosphoerythronate dehydrogenase |
| 475 | AP008971.1 | GCA000010185_00439 | CDS | open | 463513-464805 | _na 430_aa | Oligosaccharide repeat unit polymerase | |
| 476 | AP008971.1 | GCA000010185_00440 | CDS | open | 464808-465827 | _na 339_aa | yveK | Capsular polysaccharide biosynthesis protein |
| 477 | AP008971.1 | GCA000010185_00441 | CDS | open | 465911-466564 | _na 217_aa | crp | cAMP-activated global transcriptional regulator CRP |
| 478 | AP008971.1 | GCA000010185_00442 | CDS | open | 466653-468314 | _na 553_aa | hcp | hydroxylamine reductase |
| 479 | AP008971.1 | GCA000010185_00443 | CDS | open | 468447-468992 | _na 181_aa | rimL | GNAT family N-acetyltransferase |
| 480 | AP008971.1 | GCA000010185_00444 | CDS | open | 468994-470391 | _na 465_aa | norM | putative multidrug resistance protein NorM |
| 481 | AP008971.1 | GCA000010185_00445 | CDS | open | 470477-471946 | _na 489_aa | gltX | glutamate--tRNA ligase |
| 482 | AP008971.1 | GCA000010185_00446 | CDS | open | 471955-473343 | _na 462_aa | cysS | cysteine--tRNA ligase |
| 483 | AP008971.1 | GCA000010185_00447 | CDS | open | 473343-474104 | _na 253_aa | thyX | FAD-dependent thymidylate synthase |
| 484 | AP008971.1 | GCA000010185_00448 | CDS | open | 474117-474962 | _na 281_aa | degV | EDD domain protein |
| 485 | AP008971.1 | GCA000010185_00449 | CDS | open | 474982-476349 | _na 455_aa | norM | putative multidrug resistance protein NorM |
| 486 | AP008971.1 | GCA000010185_00450 | CDS | open | 476685-477965 | _na 426_aa | gltP | L-cystine uptake protein TcyP |
| 487 | AP008971.1 | GCA000010185_00451 | CDS | open | 478067-479005 | _na 312_aa | yxeI | Choloylglycine hydrolase |
| 488 | AP008971.1 | GCA000010185_00452 | CDS | open | 479007-480392 | _na 461_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 489 | AP008971.1 | GCA000010185_00453 | CDS | open | 480538-481323 | _na 261_aa | pdxK | pyridoxal kinase |
| 490 | AP008971.1 | GCA000010185_00454 | CDS | open | 481425-482297 | _na 290_aa | yitT | DUF2179 domain-containing protein |
| 491 | AP008971.1 | GCA000010185_00455 | CDS | open | 482425-483570 | _na 381_aa | grdD | glycine/sarcosine/betaine reductase complex component C subunit alpha |
| 492 | AP008971.1 | GCA000010185_00456 | CDS | open | 483581-485128 | _na 515_aa | grdC | glycine/sarcosine/betaine reductase complex component C subunit beta |
| 493 | AP008971.1 | GCA000010185_00457 | CDS | open | 485168-486478 | _na 436_aa | grdB | glycine reductase complex selenoprotein B |
| 494 | AP008971.1 | GCA000010185_00458 | CDS | open | 486497-486823 | _na 108_aa | grdA | glycine/sarcosine/betaine reductase complex selenoprotein A |
| 495 | AP008971.1 | GCA000010185_00459 | CDS | open | 486839-486973 | _na 44_aa | grdA | glycine/sarcosine/betaine reductase complex selenoprotein A |
| 496 | AP008971.1 | GCA000010185_00460 | CDS | open | 487034-488326 | _na 430_aa | Glycine reductase complex proprotein | |
| 497 | AP008971.1 | GCA000010185_00461 | CDS | open | 488434-488754 | _na 106_aa | trxA | thioredoxin TrxA |
| 498 | AP008971.1 | GCA000010185_00462 | CDS | open | 488776-489150 | _na 124_aa | Glycine reductase | |
| 499 | AP008971.1 | GCA000010185_00463 | CDS | open | 489484-490890 | _na 468_aa | selA | L-seryl-tRNA(Sec) selenium transferase |
| 500 | AP008971.1 | GCA000010185_00464 | CDS | open | 491171-492304 | _na 377_aa | ykvI | Membrane protein YkvI |

