BAKTAGenome Explorer: Finegoldia magna (GCA_000159695.1)
Select a Genome:
|
BAKTA Annotations for GCA_000159695.1
|
Search & Sort all 3775 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CM000955.1 | GCA000159695_00772 | gene | open | 808911-809272 | ssrA | ||
| 2 | CM000955.1 | GCA000159695_00772 | tmRNA | open | 808911-809272 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | CM000955.1 | rep_origin | open | 1185839-1186125 | ||||
| 4 | CM000955.1 | GCA000159695_00080 | gene | open | 92760-92796 | abiF | ||
| 5 | CM000955.1 | GCA000159695_00246 | gene | open | 260518-260634 | rrf | ||
| 6 | CM000955.1 | GCA000159695_00247 | gene | open | 260678-263661 | rrl | ||
| 7 | CM000955.1 | GCA000159695_00249 | gene | open | 263857-265378 | rrs | ||
| 8 | CM000955.1 | GCA000159695_00440 | gene | open | 474425-474589 | sRNA_0030 | ||
| 9 | CM000955.1 | GCA000159695_00529 | gene | open | 564906-565022 | rrf | ||
| 10 | CM000955.1 | GCA000159695_00660 | gene | open | 701899-702162 | Bacteria_large_SRP | ||
| 11 | CM000955.1 | GCA000159695_00661 | gene | open | 702012-702111 | Bacteria_small_SRP | ||
| 12 | CM000955.1 | GCA000159695_00805 | gene | open | 843518-843644 | SpR18_sRNA | ||
| 13 | CM000955.1 | GCA000159695_01047 | gene | open | 1105456-1105571 | STnc490 | ||
| 14 | CM000955.1 | GCA000159695_01180 | gene | open | 1223801-1223916 | STnc490 | ||
| 15 | CM000955.1 | GCA000159695_01604 | gene | open | 1623021-1623350 | RNaseP_bact_a | ||
| 16 | CM000955.1 | GCA000159695_01878 | gene | open | 1915526-1915642 | rrf | ||
| 17 | CM000955.1 | GCA000159695_00080 | ncRNA | open | 92760-92796 | abiF | abiF RNA | |
| 18 | CM000955.1 | GCA000159695_00440 | ncRNA | open | 474425-474589 | Enterococcus sRNA 30 | ||
| 19 | CM000955.1 | GCA000159695_00660 | ncRNA | open | 701899-702162 | Bacterial large signal recognition particle RNA | ||
| 20 | CM000955.1 | GCA000159695_00661 | ncRNA | open | 702012-702111 | Bacterial small signal recognition particle RNA | ||
| 21 | CM000955.1 | GCA000159695_00805 | ncRNA | open | 843518-843644 | Streptococcus sRNA SpR18 | ||
| 22 | CM000955.1 | GCA000159695_01047 | ncRNA | open | 1105456-1105571 | STnc490 Hfq binding RNA | ||
| 23 | CM000955.1 | GCA000159695_01180 | ncRNA | open | 1223801-1223916 | STnc490 Hfq binding RNA | ||
| 24 | CM000955.1 | GCA000159695_01604 | ncRNA | open | 1623021-1623350 | Bacterial RNase P class A | ||
| 25 | CM000955.1 | regulatory_region | open | 341643-341738 | SAM riboswitch aptamer (S box leader) | |||
| 26 | CM000955.1 | regulatory_region | open | 406331-406472 | glmS glucosamine-6-phosphate activated ribozyme aptamer | |||
| 27 | CM000955.1 | regulatory_region | open | 411732-411846 | FMN riboswitch aptamer (RFN element) | |||
| 28 | CM000955.1 | regulatory_region | open | 477251-477480 | Cis-regulator of HTH transcription factor | |||
| 29 | CM000955.1 | regulatory_region | open | 478699-478797 | pemK RNA | |||
| 30 | CM000955.1 | regulatory_region | open | 535657-535917 | T-box leader | |||
| 31 | CM000955.1 | regulatory_region | open | 580113-580350 | T-box leader | |||
| 32 | CM000955.1 | regulatory_region | open | 581408-581532 | Ribosomal protein L10 leader | |||
| 33 | CM000955.1 | regulatory_region | open | 713601-713638 | Selenocysteine insertion sequence 4 | |||
| 34 | CM000955.1 | regulatory_region | open | 787822-787894 | Ribosomal protein L21 leader | |||
| 35 | CM000955.1 | regulatory_region | open | 1009013-1009087 | Fluoride riboswitch aptamer (crcB RNA motif) | |||
| 36 | CM000955.1 | regulatory_region | open | 1417509-1417689 | T-box leader | |||
| 37 | CM000955.1 | regulatory_region | open | 1659050-1659229 | T-box leader | |||
| 38 | CM000955.1 | regulatory_region | open | 1675410-1675597 | T-box leader | |||
| 39 | CM000955.1 | regulatory_region | open | 1688770-1688858 | THF (Tetrahydrofolate) riboswitch aptamer | |||
| 40 | CM000955.1 | regulatory_region | open | 1745184-1745248 | pemK RNA | |||
| 41 | CM000955.1 | GCA000159695_00246 | rRNA | open | 260518-260634 | rrf | 5S ribosomal RNA | |
| 42 | CM000955.1 | GCA000159695_00247 | rRNA | open | 260678-263661 | rrl | 23S ribosomal RNA | |
| 43 | CM000955.1 | GCA000159695_00249 | rRNA | open | 263857-265378 | rrs | 16S ribosomal RNA | |
| 44 | CM000955.1 | GCA000159695_00529 | rRNA | open | 564906-565022 | rrf | 5S ribosomal RNA | |
| 45 | CM000955.1 | GCA000159695_01878 | rRNA | open | 1915526-1915642 | rrf | 5S ribosomal RNA | |
| 46 | CM000955.1 | repeat_region | open | 986126-986428 | CRISPR array with 5 repeats of length 30%2C consensus sequence ATTTACATTTCAGTATGAGTAGATTTTAAT and spacer length 35 | |||
| 47 | CM000955.1 | repeat_region | open | 986455-986822 | CRISPR array with 6 repeats of length 30%2C consensus sequence ATTTACATTCCACTCTGGGTAGATTTTAAT and spacer length 35 | |||
| 48 | CM000955.1 | repeat_region | open | 986915-987805 | CRISPR array with 14 repeats of length 29%2C consensus sequence TTTACATTTCAGTATGAATAGATTTTAAT and spacer length 36 | |||
| 49 | CM000955.1 | repeat_region | open | 987833-988088 | CRISPR array with 4 repeats of length 30%2C consensus sequence ATTTACATTCCAGTATGATTAGATTTTAAT and spacer length 35 | |||
| 50 | CM000955.1 | repeat_region | open | 988151-988655 | CRISPR array with 8 repeats of length 30%2C consensus sequence ATTTACATTCCATTCTGGTTGGATTTTAAT and spacer length 36 | |||
| 51 | CM000955.1 | repeat_region | open | 988682-991614 | CRISPR array with 45 repeats of length 30%2C consensus sequence ATTTACATTCCACTCTGGGTAGATTTTAAT and spacer length 35 | |||
| 52 | CM000955.1 | GCA000159695_00001 | CDS | open | 784-1425 | _na 213_aa | dAK1 | Dihydroxyacetone kinase |
| 53 | CM000955.1 | GCA000159695_00002 | CDS | open | 1466-2173 | _na 235_aa | rsuA | Pseudouridine synthase |
| 54 | CM000955.1 | GCA000159695_00003 | CDS | open | 2454-3779 | _na 441_aa | adhE | Aldehyde dehydrogenase |
| 55 | CM000955.1 | GCA000159695_00004 | CDS | open | 3839-4438 | _na 199_aa | mrp | non-specific protein-tyrosine kinase |
| 56 | CM000955.1 | GCA000159695_00005 | CDS | open | 4428-5066 | _na 212_aa | yveK | Capsular polysaccharide type 8 biosynthesis protein cap8A |
| 57 | CM000955.1 | GCA000159695_00006 | CDS | open | 5068-5847 | _na 259_aa | ywqE | protein-tyrosine-phosphatase |
| 58 | CM000955.1 | GCA000159695_00007 | CDS | open | 5848-6270 | _na 140_aa | SH3 domain protein | |
| 59 | CM000955.1 | GCA000159695_00008 | CDS | open | 6451-6975 | _na 174_aa | adk | DNA topology modulation protein |
| 60 | CM000955.1 | GCA000159695_00009 | CDS | open | 7065-8279 | _na 404_aa | IS256 family transposase | |
| 61 | CM000955.1 | GCA000159695_00010 | CDS | open | 8670-16790 | _na 2706_aa | LPXTG-motif cell wall anchor domain protein | |
| 62 | CM000955.1 | GCA000159695_00011 | CDS | open | 17619-19244 | _na 541_aa | LPXTG-motif cell wall anchor domain protein | |
| 63 | CM000955.1 | GCA000159695_00012 | CDS | open | 19429-20448 | _na 339_aa | hypothetical protein | |
| 64 | CM000955.1 | GCA000159695_00013 | CDS | open | 20375-23008 | _na 877_aa | G5 domain-containing protein | |
| 65 | CM000955.1 | GCA000159695_00014 | CDS | open | 23209-27069 | _na 1286_aa | hypothetical protein | |
| 66 | CM000955.1 | GCA000159695_00015 | CDS | open | 28756-30633 | _na 625_aa | faf | adhesion factor FAF |
| 67 | CM000955.1 | GCA000159695_00016 | CDS | open | 31339-31773 | _na 144_aa | Acetyltransferase%2C GNAT family | |
| 68 | CM000955.1 | GCA000159695_00017 | CDS | open | 31796-32494 | _na 232_aa | Putative TIGR02206 family protein | |
| 69 | CM000955.1 | GCA000159695_00018 | CDS | open | 32494-33213 | _na 239_aa | Peptidase family S51 | |
| 70 | CM000955.1 | GCA000159695_00019 | CDS | open | 34154-37507 | _na 1117_aa | lolE | ABC transporter permease protein |
| 71 | CM000955.1 | GCA000159695_00020 | CDS | open | 37509-38210 | _na 233_aa | lolD | ABC transporter ATP-binding protein |
| 72 | CM000955.1 | GCA000159695_00021 | CDS | open | 38322-38867 | _na 181_aa | acrR | Transcriptional regulator TetR/AcrR family |
| 73 | CM000955.1 | GCA000159695_00022 | CDS | open | 38909-39703 | _na 264_aa | IS3 family transposase | |
| 74 | CM000955.1 | GCA000159695_00023 | CDS | open | 39747-40094 | _na 115_aa | Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein | |
| 75 | CM000955.1 | GCA000159695_00024 | CDS | open | 40361-40903 | _na 180_aa | Flavin reductase like domain-containing protein | |
| 76 | CM000955.1 | GCA000159695_00025 | CDS | open | 40903-41445 | _na 180_aa | rimL | Bifunctional AAC/APH |
| 77 | CM000955.1 | GCA000159695_00026 | CDS | open | 41469-41981 | _na 170_aa | nfnB | Nitroreductase family protein |
| 78 | CM000955.1 | GCA000159695_00027 | CDS | open | 42096-42323 | _na 75_aa | Spore coat protein | |
| 79 | CM000955.1 | GCA000159695_00028 | CDS | open | 42423-42623 | _na 66_aa | cspC | Cold-shock DNA-binding domain protein |
| 80 | CM000955.1 | GCA000159695_00029 | CDS | open | 42821-43300 | _na 159_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 81 | CM000955.1 | GCA000159695_00030 | CDS | open | 43302-43979 | _na 225_aa | DNA alkylation repair enzyme | |
| 82 | CM000955.1 | GCA000159695_00031 | CDS | open | 43966-44271 | _na 101_aa | hypothetical protein | |
| 83 | CM000955.1 | GCA000159695_00032 | CDS | open | 44342-45250 | _na 302_aa | ytlR | Lipid kinase YtlR |
| 84 | CM000955.1 | GCA000159695_00033 | CDS | open | 45332-45943 | _na 203_aa | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system | |
| 85 | CM000955.1 | GCA000159695_00034 | CDS | open | 45936-46919 | _na 327_aa | Nucleotidyl transferase%2C PF08843 family | |
| 86 | CM000955.1 | GCA000159695_00035 | CDS | open | 46943-47479 | _na 178_aa | Isochorismatase family protein | |
| 87 | CM000955.1 | GCA000159695_00036 | CDS | open | 48124-48702 | _na 192_aa | lemA | LemA family protein |
| 88 | CM000955.1 | GCA000159695_00037 | CDS | open | 48712-49662 | _na 316_aa | DUF3137 domain-containing protein | |
| 89 | CM000955.1 | GCA000159695_00038 | CDS | open | 49841-50083 | _na 80_aa | DUF2700 domain-containing protein | |
| 90 | CM000955.1 | GCA000159695_00039 | CDS | open | 50095-50532 | _na 145_aa | aac(6') | aminoglycoside 6'-N-acetyltransferase |
| 91 | CM000955.1 | GCA000159695_00040 | CDS | open | 50791-51246 | _na 151_aa | tnpA | IS200/IS605 family transposase |
| 92 | CM000955.1 | GCA000159695_00041 | CDS | open | 51395-52054 | _na 219_aa | lolD | ABC transporter ATP-binding protein |
| 93 | CM000955.1 | GCA000159695_00042 | CDS | open | 52055-53242 | _na 395_aa | lolE | Putative hemin transport system permease protein HrtB |
| 94 | CM000955.1 | GCA000159695_00043 | CDS | open | 53232-53633 | _na 133_aa | DUF4418 domain-containing protein | |
| 95 | CM000955.1 | GCA000159695_00044 | CDS | open | 53642-54382 | _na 246_aa | ABC transporter%2C ATP-binding protein | |
| 96 | CM000955.1 | GCA000159695_00045 | CDS | open | 54382-55404 | _na 340_aa | ABC transporter%2C permease protein | |
| 97 | CM000955.1 | GCA000159695_00046 | CDS | open | 55488-56552 | _na 354_aa | SsuA/THI5-like domain-containing protein | |
| 98 | CM000955.1 | GCA000159695_00047 | CDS | open | 56900-57799 | _na 299_aa | lysR | selenium metabolism-associated LysR family transcriptional regulator |
| 99 | CM000955.1 | GCA000159695_00048 | CDS | open | 58071-58733 | _na 220_aa | tVP38 | TVP38/TMEM64 family membrane protein |
| 100 | CM000955.1 | GCA000159695_00049 | CDS | open | 58834-60261 | _na 475_aa | purB | adenylosuccinate lyase |
| 101 | CM000955.1 | GCA000159695_00050 | CDS | open | 60261-65153 | _na 1630_aa | purD | phosphoribosylformylglycinamidine synthase |
| 102 | CM000955.1 | GCA000159695_00051 | CDS | open | 65169-66674 | _na 501_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 103 | CM000955.1 | GCA000159695_00052 | CDS | open | 66662-67216 | _na 184_aa | purN | phosphoribosylglycinamide formyltransferase |
| 104 | CM000955.1 | GCA000159695_00053 | CDS | open | 67225-68571 | _na 448_aa | purF | amidophosphoribosyltransferase |
| 105 | CM000955.1 | GCA000159695_00054 | CDS | open | 68573-69271 | _na 232_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 106 | CM000955.1 | GCA000159695_00055 | CDS | open | 69319-69471 | _na 50_aa | hypothetical protein | |
| 107 | CM000955.1 | GCA000159695_00056 | CDS | open | 69596-70402 | _na 268_aa | proC | pyrroline-5-carboxylate reductase |
| 108 | CM000955.1 | GCA000159695_00057 | CDS | open | 70529-71536 | _na 335_aa | trkA | Putative potassium channel protein |
| 109 | CM000955.1 | GCA000159695_00058 | CDS | open | 71741-72073 | _na 110_aa | fadH | NADH-dependent flavin oxidoreductase |
| 110 | CM000955.1 | GCA000159695_00059 | CDS | open | 72100-72543 | _na 147_aa | Oxidoreductase%2C FAD/FMN-binding protein | |
| 111 | CM000955.1 | GCA000159695_00060 | CDS | open | 72637-72732 | _na 31_aa | hypothetical protein | |
| 112 | CM000955.1 | GCA000159695_00061 | CDS | open | 72952-73791 | _na 279_aa | menH | AB hydrolase-1 domain-containing protein |
| 113 | CM000955.1 | GCA000159695_00062 | CDS | open | 73846-74325 | _na 159_aa | nuoE | NAD(P)H-dependent oxidoreductase subunit E |
| 114 | CM000955.1 | GCA000159695_00063 | CDS | open | 74330-75313 | _na 327_aa | ygaE | Putative aromatic acid exporter C-terminal domain-containing protein |
| 115 | CM000955.1 | GCA000159695_00064 | CDS | open | 75410-76312 | _na 300_aa | DUF422 domain-containing protein | |
| 116 | CM000955.1 | GCA000159695_00065 | CDS | open | 76328-76636 | _na 102_aa | Exosortase | |
| 117 | CM000955.1 | GCA000159695_00066 | CDS | open | 76851-77312 | _na 153_aa | sapB | Mg2+ transporter-C family protein |
| 118 | CM000955.1 | GCA000159695_00067 | CDS | open | 77568-79025 | _na 485_aa | Type I restriction modification DNA specificity domain protein | |
| 119 | CM000955.1 | GCA000159695_00068 | CDS | open | 79025-80494 | _na 489_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 120 | CM000955.1 | GCA000159695_00069 | CDS | open | 80496-82838 | _na 780_aa | hsdR | EcoAI/FtnUII family type I restriction enzme subunit R |
| 121 | CM000955.1 | GCA000159695_00070 | CDS | open | 83181-84185 | _na 334_aa | hypothetical protein | |
| 122 | CM000955.1 | GCA000159695_00071 | CDS | open | 84608-85099 | _na 163_aa | Isoprenylcysteine carboxyl methyltransferase family protein | |
| 123 | CM000955.1 | GCA000159695_00072 | CDS | open | 85113-86051 | _na 312_aa | Alpha/beta hydrolase fold-3 domain-containing protein | |
| 124 | CM000955.1 | GCA000159695_00073 | CDS | open | 86126-86752 | _na 208_aa | L-2-amino-thiazoline-4-carboxylic acid hydrolase | |
| 125 | CM000955.1 | GCA000159695_00074 | CDS | open | 86780-87388 | _na 202_aa | ubiE | Putative methyltransferase |
| 126 | CM000955.1 | GCA000159695_00075 | CDS | open | 87491-87775 | _na 94_aa | Integrase catalytic domain-containing protein | |
| 127 | CM000955.1 | GCA000159695_00076 | CDS | open | 87986-88477 | _na 163_aa | Transposase IS30-like HTH domain-containing protein | |
| 128 | CM000955.1 | GCA000159695_00077 | CDS | open | 88725-89474 | _na 249_aa | udp | Uridine phosphorylase |
| 129 | CM000955.1 | GCA000159695_00078 | CDS | open | 89734-91338 | _na 534_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 130 | CM000955.1 | GCA000159695_00079 | CDS | open | 92066-92680 | _na 204_aa | ParB/Sulfiredoxin domain-containing protein | |
| 131 | CM000955.1 | GCA000159695_00081 | CDS | open | 92889-94253 | _na 454_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 132 | CM000955.1 | GCA000159695_00082 | CDS | open | 94247-94936 | _na 229_aa | ecfT | Cobalt transport protein |
| 133 | CM000955.1 | GCA000159695_00083 | CDS | open | 94936-95520 | _na 194_aa | TIGR02185 family protein | |
| 134 | CM000955.1 | GCA000159695_00084 | CDS | open | 95580-96923 | _na 447_aa | norM | Multidrug export protein MepA |
| 135 | CM000955.1 | GCA000159695_00085 | CDS | open | 96935-98656 | _na 573_aa | mdlB | ABC transporter ATP-binding protein |
| 136 | CM000955.1 | GCA000159695_00086 | CDS | open | 98640-100394 | _na 584_aa | mdlB | ABC transporter ATP-binding protein/permease |
| 137 | CM000955.1 | GCA000159695_00087 | CDS | open | 100555-101547 | _na 330_aa | araC | HTH araC/xylS-type domain-containing protein |
| 138 | CM000955.1 | GCA000159695_00088 | CDS | open | 101809-102348 | _na 179_aa | Transposase | |
| 139 | CM000955.1 | GCA000159695_00089 | CDS | open | 102543-103247 | _na 234_aa | IS3 family transposase | |
| 140 | CM000955.1 | GCA000159695_00090 | CDS | open | 103477-104691 | _na 404_aa | IS256 family transposase | |
| 141 | CM000955.1 | GCA000159695_00091 | CDS | open | 105052-105648 | _na 198_aa | DUF4368 domain-containing protein | |
| 142 | CM000955.1 | GCA000159695_00092 | CDS | open | 105791-107527 | _na 578_aa | mdlB | Lipid A export ATP-binding/permease protein MsbA |
| 143 | CM000955.1 | GCA000159695_00093 | CDS | open | 107520-109241 | _na 573_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 144 | CM000955.1 | GCA000159695_00094 | CDS | open | 109241-110704 | _na 487_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 145 | CM000955.1 | GCA000159695_00095 | CDS | open | 110706-111377 | _na 223_aa | Cobalt transport protein | |
| 146 | CM000955.1 | GCA000159695_00096 | CDS | open | 111374-111964 | _na 196_aa | TIGR02185 family protein | |
| 147 | CM000955.1 | GCA000159695_00097 | CDS | open | 112031-113008 | _na 325_aa | DNA-binding helix-turn-helix protein | |
| 148 | CM000955.1 | GCA000159695_00098 | CDS | open | 113018-113602 | _na 194_aa | acrR | Transcriptional regulator%2C TetR family |
| 149 | CM000955.1 | GCA000159695_00099 | CDS | open | 114059-114322 | _na 87_aa | Bacterial mobilisation domain-containing protein | |
| 150 | CM000955.1 | GCA000159695_00100 | CDS | open | 115280-116257 | _na 325_aa | Peptidase C14 caspase domain-containing protein | |
| 151 | CM000955.1 | GCA000159695_00101 | CDS | open | 116277-116654 | _na 125_aa | thsB | Thoeris protein ThsB TIR-like domain-containing protein |
| 152 | CM000955.1 | GCA000159695_00102 | CDS | open | 117048-117515 | _na 155_aa | Abortive infection protein AbiGII | |
| 153 | CM000955.1 | GCA000159695_00103 | CDS | open | 117577-118368 | _na 263_aa | CAAX amino terminal protease family protein | |
| 154 | CM000955.1 | GCA000159695_00104 | CDS | open | 119209-119859 | _na 216_aa | DUF5050 domain-containing protein | |
| 155 | CM000955.1 | GCA000159695_00105 | CDS | open | 120166-120915 | _na 249_aa | udp | Uridine phosphorylase |
| 156 | CM000955.1 | GCA000159695_00106 | CDS | open | 121488-122921 | _na 477_aa | hypothetical protein | |
| 157 | CM000955.1 | GCA000159695_00107 | CDS | open | 122962-123264 | _na 100_aa | 23S rRNA methyltransferase | |
| 158 | CM000955.1 | GCA000159695_00108 | CDS | open | 123710-123877 | _na 55_aa | Sigma-70 family RNA polymerase sigma factor | |
| 159 | CM000955.1 | GCA000159695_00109 | CDS | open | 124020-125006 | _na 328_aa | IS30 family transposase | |
| 160 | CM000955.1 | GCA000159695_00110 | CDS | open | 125309-126661 | _na 450_aa | norM | Multidrug export protein MepA |
| 161 | CM000955.1 | GCA000159695_00111 | CDS | open | 126688-128433 | _na 581_aa | ABC transporter domain-containing protein | |
| 162 | CM000955.1 | GCA000159695_00112 | CDS | open | 128426-130216 | _na 596_aa | ABC transporter%2C ATP-binding protein | |
| 163 | CM000955.1 | GCA000159695_00113 | CDS | open | 130206-131666 | _na 486_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 164 | CM000955.1 | GCA000159695_00114 | CDS | open | 131660-132373 | _na 237_aa | Cobalt transport protein | |
| 165 | CM000955.1 | GCA000159695_00115 | CDS | open | 132363-132959 | _na 198_aa | TIGR02185 family protein | |
| 166 | CM000955.1 | GCA000159695_00116 | CDS | open | 133083-133802 | _na 239_aa | putative acrAB operon repressor | |
| 167 | CM000955.1 | GCA000159695_00117 | CDS | open | 133793-135355 | _na 520_aa | Transposon Tn3 resolvase | |
| 168 | CM000955.1 | GCA000159695_00118 | CDS | open | 135348-135764 | _na 138_aa | Recombinase domain-containing protein | |
| 169 | CM000955.1 | GCA000159695_00119 | CDS | open | 135757-137319 | _na 520_aa | Transposon Tn3 resolvase | |
| 170 | CM000955.1 | GCA000159695_00120 | CDS | open | 137379-137588 | _na 69_aa | SHOCT-like domain-containing protein | |
| 171 | CM000955.1 | GCA000159695_00121 | CDS | open | 137952-139688 | _na 578_aa | mdlB | ABC transporter domain-containing protein |
| 172 | CM000955.1 | GCA000159695_00122 | CDS | open | 139681-141399 | _na 572_aa | mdlB | ABC transporter ATP-binding protein |
| 173 | CM000955.1 | GCA000159695_00123 | CDS | open | 141404-142027 | _na 207_aa | acrR | HTH tetR-type domain-containing protein |
| 174 | CM000955.1 | GCA000159695_00124 | CDS | open | 142171-142980 | _na 269_aa | Cpl-7 lysozyme C-terminal domain protein | |
| 175 | CM000955.1 | GCA000159695_00125 | CDS | open | 142981-143382 | _na 133_aa | Toxin secretion/phage lysis holin | |
| 176 | CM000955.1 | GCA000159695_00126 | CDS | open | 143384-144763 | _na 459_aa | Phage tail component%2C N-terminal domain protein | |
| 177 | CM000955.1 | GCA000159695_00127 | CDS | open | 144750-146621 | _na 623_aa | Prophage tail endopeptidase domain-containing protein | |
| 178 | CM000955.1 | GCA000159695_00128 | CDS | open | 146621-146983 | _na 120_aa | Phage tail component domain protein | |
| 179 | CM000955.1 | GCA000159695_00129 | CDS | open | 146983-147441 | _na 152_aa | Phage tail tape measure protein | |
| 180 | CM000955.1 | GCA000159695_00130 | CDS | open | 147515-147745 | _na 76_aa | hypothetical protein | |
| 181 | CM000955.1 | GCA000159695_00131 | CDS | open | 148349-150049 | _na 566_aa | Phage tail tape measure protein%2C TP901 family | |
| 182 | CM000955.1 | GCA000159695_00132 | CDS | open | 150112-150438 | _na 108_aa | hypothetical protein | |
| 183 | CM000955.1 | GCA000159695_00133 | CDS | open | 150477-150641 | _na 54_aa | Phage protein | |
| 184 | CM000955.1 | GCA000159695_00134 | CDS | open | 150659-151015 | _na 118_aa | Phage protein | |
| 185 | CM000955.1 | GCA000159695_00135 | CDS | open | 151018-151614 | _na 198_aa | Phage major tail protein%2C phi13 family | |
| 186 | CM000955.1 | GCA000159695_00136 | CDS | open | 151604-151951 | _na 115_aa | Prophage pi2 protein 38 | |
| 187 | CM000955.1 | GCA000159695_00137 | CDS | open | 151944-152324 | _na 126_aa | Phage protein%2C HK97 gp10 family | |
| 188 | CM000955.1 | GCA000159695_00138 | CDS | open | 152321-152653 | _na 110_aa | phage head closure protein | |
| 189 | CM000955.1 | GCA000159695_00139 | CDS | open | 152653-152925 | _na 90_aa | head-tail connector protein | |
| 190 | CM000955.1 | GCA000159695_00140 | CDS | open | 152936-154126 | _na 396_aa | phage major capsid protein | |
| 191 | CM000955.1 | GCA000159695_00141 | CDS | open | 154129-154815 | _na 228_aa | ATP-dependent Clp protease proteolytic subunit | |
| 192 | CM000955.1 | GCA000159695_00142 | CDS | open | 154802-156079 | _na 425_aa | phage portal protein | |
| 193 | CM000955.1 | GCA000159695_00143 | CDS | open | 156124-156543 | _na 139_aa | SnoaL-like domain-containing protein | |
| 194 | CM000955.1 | GCA000159695_00144 | CDS | open | 156588-158177 | _na 529_aa | Putative phage terminase%2C large subunit | |
| 195 | CM000955.1 | GCA000159695_00145 | CDS | open | 158273-158560 | _na 95_aa | Transcriptional regulator | |
| 196 | CM000955.1 | GCA000159695_00146 | CDS | open | 158654-159022 | _na 122_aa | hypothetical protein | |
| 197 | CM000955.1 | GCA000159695_00147 | CDS | open | 159094-159309 | _na 71_aa | DUF4314 domain-containing protein | |
| 198 | CM000955.1 | GCA000159695_00148 | CDS | open | 159353-160603 | _na 416_aa | Methyltransferase | |
| 199 | CM000955.1 | GCA000159695_00149 | CDS | open | 160603-161385 | _na 260_aa | S-adenosylmethionine synthetase N-terminal domain-containing protein | |
| 200 | CM000955.1 | GCA000159695_00150 | CDS | open | 161389-161901 | _na 170_aa | HNH endonuclease domain protein | |
| 201 | CM000955.1 | GCA000159695_00151 | CDS | open | 161911-162558 | _na 215_aa | Phage terminase%2C small subunit%2C P27 family | |
| 202 | CM000955.1 | GCA000159695_00152 | CDS | open | 162612-162968 | _na 118_aa | yajD | Putative HNH nuclease YajD |
| 203 | CM000955.1 | GCA000159695_00153 | CDS | open | 163157-163414 | _na 85_aa | abrB | Transcriptional regulator%2C AbrB family |
| 204 | CM000955.1 | GCA000159695_00154 | CDS | open | 163414-163680 | _na 88_aa | relE | Addiction module toxin%2C RelE/StbE family |
| 205 | CM000955.1 | GCA000159695_00155 | CDS | open | 163757-164158 | _na 133_aa | DUF1492 domain-containing protein | |
| 206 | CM000955.1 | GCA000159695_00156 | CDS | open | 164206-165549 | _na 447_aa | DEAD/DEAH box helicase | |
| 207 | CM000955.1 | GCA000159695_00157 | CDS | open | 165550-165831 | _na 93_aa | VRR-NUC domain protein | |
| 208 | CM000955.1 | GCA000159695_00158 | CDS | open | 165789-166046 | _na 85_aa | yozE | YozE SAM-like domain-containing protein |
| 209 | CM000955.1 | GCA000159695_00159 | CDS | open | 166310-168511 | _na 733_aa | SF3 helicase domain-containing protein | |
| 210 | CM000955.1 | GCA000159695_00160 | CDS | open | 168512-168898 | _na 128_aa | DUF4406 domain-containing protein | |
| 211 | CM000955.1 | GCA000159695_00161 | CDS | open | 168891-169091 | _na 66_aa | C2H2-type domain-containing protein | |
| 212 | CM000955.1 | GCA000159695_00162 | CDS | open | 169105-171036 | _na 643_aa | DNA-directed DNA polymerase | |
| 213 | CM000955.1 | GCA000159695_00163 | CDS | open | 171011-171211 | _na 66_aa | ATP synthase F0 subunit B | |
| 214 | CM000955.1 | GCA000159695_00164 | CDS | open | 171221-171763 | _na 180_aa | Phage-associated protein | |
| 215 | CM000955.1 | GCA000159695_00165 | CDS | open | 171753-172877 | _na 374_aa | DUF2800 domain-containing protein | |
| 216 | CM000955.1 | GCA000159695_00166 | CDS | open | 172877-173173 | _na 98_aa | rRNA biogenesis protein rrp5 | |
| 217 | CM000955.1 | GCA000159695_00167 | CDS | open | 173115-173279 | _na 54_aa | hypothetical protein | |
| 218 | CM000955.1 | GCA000159695_00168 | CDS | open | 173474-173992 | _na 172_aa | RNA polymerase sigma factor%2C sigma-70 family | |
| 219 | CM000955.1 | GCA000159695_00169 | CDS | open | 174327-174491 | _na 54_aa | Mu-like prophage protein Com | |
| 220 | CM000955.1 | GCA000159695_00170 | CDS | open | 174564-175349 | _na 261_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 221 | CM000955.1 | GCA000159695_00171 | CDS | open | 175352-175723 | _na 123_aa | rodZ | DNA-binding helix-turn-helix protein |
| 222 | CM000955.1 | GCA000159695_00172 | CDS | open | 175974-177188 | _na 404_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 223 | CM000955.1 | GCA000159695_00173 | CDS | open | 177271-179067 | _na 598_aa | mdlB | Multidrug ABC transporter |
| 224 | CM000955.1 | GCA000159695_00174 | CDS | open | 179060-180820 | _na 586_aa | ABC transporter%2C ATP-binding protein | |
| 225 | CM000955.1 | GCA000159695_00175 | CDS | open | 180795-181271 | _na 158_aa | marR | Transcriptional repressor MprA |
| 226 | CM000955.1 | GCA000159695_00176 | CDS | open | 181428-182729 | _na 433_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 227 | CM000955.1 | GCA000159695_00177 | CDS | open | 182910-183824 | _na 304_aa | yiiM | cyclic pyranopterin monophosphate synthase MoaC/MOSC-domain-containing protein |
| 228 | CM000955.1 | GCA000159695_00178 | CDS | open | 183826-184773 | _na 315_aa | moaA | GTP 3'%2C8-cyclase MoaA |
| 229 | CM000955.1 | GCA000159695_00179 | CDS | open | 184860-186035 | _na 391_aa | Tetratricopeptide repeat protein | |
| 230 | CM000955.1 | GCA000159695_00180 | CDS | open | 186051-186332 | _na 93_aa | hypothetical protein | |
| 231 | CM000955.1 | GCA000159695_00181 | CDS | open | 186705-187466 | _na 253_aa | aIM24 | Transcriptional regulator |
| 232 | CM000955.1 | GCA000159695_00182 | CDS | open | 187602-188864 | _na 420_aa | ykvI | Membrane protein YkvI |
| 233 | CM000955.1 | GCA000159695_00183 | CDS | open | 189238-190599 | _na 453_aa | spoVV | Nucleoside transporter/FeoB GTPase Gate domain-containing protein |
| 234 | CM000955.1 | GCA000159695_00184 | CDS | open | 190635-191288 | _na 217_aa | AB hydrolase-1 domain-containing protein | |
| 235 | CM000955.1 | GCA000159695_00185 | CDS | open | 191291-191938 | _na 215_aa | SIMPL domain-containing protein | |
| 236 | CM000955.1 | GCA000159695_00186 | CDS | open | 191963-195067 | _na 1034_aa | Type I restriction enzyme endonuclease subunit | |
| 237 | CM000955.1 | GCA000159695_00187 | CDS | open | 195060-196379 | _na 439_aa | Type I restriction modification DNA specificity domain protein | |
| 238 | CM000955.1 | GCA000159695_00188 | CDS | open | 196369-197871 | _na 500_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 239 | CM000955.1 | GCA000159695_00189 | CDS | open | 198036-198497 | _na 153_aa | ASCH domain-containing protein | |
| 240 | CM000955.1 | GCA000159695_00190 | CDS | open | 198571-200037 | _na 488_aa | pepD | C69 family dipeptidase |
| 241 | CM000955.1 | GCA000159695_00191 | CDS | open | 200162-200371 | _na 69_aa | AbrB/MazE/SpoVT family DNA-binding domain-containing protein | |
| 242 | CM000955.1 | GCA000159695_00192 | CDS | open | 200402-201241 | _na 279_aa | znuB | Zinc ABC transporter permease protein |
| 243 | CM000955.1 | GCA000159695_00193 | CDS | open | 201235-201906 | _na 223_aa | znuC | ATP-binding cassette domain-containing protein |
| 244 | CM000955.1 | GCA000159695_00194 | CDS | open | 201907-203223 | _na 438_aa | znuA | High-affinity zinc uptake system binding-protein ZnuA |
| 245 | CM000955.1 | GCA000159695_00195 | CDS | open | 203291-203962 | _na 223_aa | zinT | ZinT/AdcA family metal-binding protein |
| 246 | CM000955.1 | GCA000159695_00196 | CDS | open | 204322-204447 | _na 41_aa | hypothetical protein | |
| 247 | CM000955.1 | GCA000159695_00197 | CDS | open | 204626-205030 | _na 134_aa | hipB | Transcriptional regulator |
| 248 | CM000955.1 | GCA000159695_00198 | CDS | open | 205034-205576 | _na 180_aa | immA | IrrE N-terminal-like domain-containing protein |
| 249 | CM000955.1 | GCA000159695_00199 | CDS | open | 205587-207005 | _na 472_aa | dinP | DNA polymerase IV |
| 250 | CM000955.1 | GCA000159695_00200 | CDS | open | 206977-207330 | _na 117_aa | YolD-like protein | |
| 251 | CM000955.1 | GCA000159695_00201 | CDS | open | 207333-207617 | _na 94_aa | DUF5960 domain-containing protein | |
| 252 | CM000955.1 | GCA000159695_00202 | CDS | open | 207762-209177 | _na 471_aa | pepD2 | Beta-Ala-His dipeptidase |
| 253 | CM000955.1 | GCA000159695_00203 | CDS | open | 209261-210472 | _na 403_aa | DUF819 domain-containing protein | |
| 254 | CM000955.1 | GCA000159695_00204 | CDS | open | 210702-211955 | _na 417_aa | cdsB | UPF0597 protein FMG_0209 |
| 255 | CM000955.1 | GCA000159695_00205 | CDS | open | 212052-212552 | _na 166_aa | mug | DNA-deoxyinosine glycosylase |
| 256 | CM000955.1 | GCA000159695_00206 | CDS | open | 212572-213882 | _na 436_aa | norM | Multidrug export protein MepA |
| 257 | CM000955.1 | GCA000159695_00207 | CDS | open | 215316-215888 | _na 190_aa | fMR2 | Nitroreductase family protein |
| 258 | CM000955.1 | GCA000159695_00208 | CDS | open | 215902-216747 | _na 281_aa | yhaK | Pirin family protein |
| 259 | CM000955.1 | GCA000159695_00209 | CDS | open | 216725-217165 | _na 146_aa | marR | HTH-type transcriptional regulator SarZ |
| 260 | CM000955.1 | GCA000159695_00210 | CDS | open | 217929-218567 | _na 212_aa | thiE | Thiamine-phosphate synthase |
| 261 | CM000955.1 | GCA000159695_00211 | CDS | open | 218560-219363 | _na 267_aa | thiD | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase |
| 262 | CM000955.1 | GCA000159695_00212 | CDS | open | 219423-220886 | _na 487_aa | malQ | 4-alpha-glucanotransferase |
| 263 | CM000955.1 | GCA000159695_00213 | CDS | open | 220888-222624 | _na 578_aa | mdlB | Putative multidrug resistance ABC transporter ATP-binding/permease protein YheH |
| 264 | CM000955.1 | GCA000159695_00214 | CDS | open | 222602-224350 | _na 582_aa | mdlB | Putative multidrug resistance ABC transporter ATP-binding/permease protein YheI |
| 265 | CM000955.1 | GCA000159695_00215 | CDS | open | 224409-224903 | _na 164_aa | hypothetical protein | |
| 266 | CM000955.1 | GCA000159695_00216 | CDS | open | 225017-225793 | _na 258_aa | Phospholipase%2C patatin family | |
| 267 | CM000955.1 | GCA000159695_00217 | CDS | open | 225873-226799 | _na 308_aa | DUF218 domain-containing protein | |
| 268 | CM000955.1 | GCA000159695_00218 | CDS | open | 226883-227488 | _na 201_aa | Lipoprotein | |
| 269 | CM000955.1 | GCA000159695_00219 | CDS | open | 227761-227892 | _na 43_aa | Transposase IS111A/IS1328/IS1533 N-terminal domain-containing protein | |
| 270 | CM000955.1 | GCA000159695_00220 | CDS | open | 227885-228985 | _na 366_aa | IS110 family transposase | |
| 271 | CM000955.1 | GCA000159695_00221 | CDS | open | 229241-229483 | _na 80_aa | Antitoxin | |
| 272 | CM000955.1 | GCA000159695_00222 | CDS | open | 229564-230778 | _na 404_aa | IS256 family transposase | |
| 273 | CM000955.1 | GCA000159695_00223 | CDS | open | 231621-232196 | _na 191_aa | fic | protein adenylyltransferase Fic |
| 274 | CM000955.1 | GCA000159695_00224 | CDS | open | 233374-234075 | _na 233_aa | nit1 | CN hydrolase domain-containing protein |
| 275 | CM000955.1 | GCA000159695_00225 | CDS | open | 234108-234611 | _na 167_aa | yhbS | Acetyltransferase%2C GNAT family |
| 276 | CM000955.1 | GCA000159695_00226 | CDS | open | 234764-235405 | _na 213_aa | Channel protein%2C hemolysin III family | |
| 277 | CM000955.1 | GCA000159695_00227 | CDS | open | 235511-236647 | _na 378_aa | CRISPR-associated protein | |
| 278 | CM000955.1 | GCA000159695_00228 | CDS | open | 236786-237637 | _na 283_aa | srtA | Sortase family protein |
| 279 | CM000955.1 | GCA000159695_00229 | CDS | open | 237624-238463 | _na 279_aa | srtA | Sortase family protein |
| 280 | CM000955.1 | GCA000159695_00230 | CDS | open | 238450-239316 | _na 288_aa | srtA | Sortase family protein |
| 281 | CM000955.1 | GCA000159695_00231 | CDS | open | 239494-240963 | _na 489_aa | Cell wall anchor protein | |
| 282 | CM000955.1 | GCA000159695_00232 | CDS | open | 241007-243337 | _na 776_aa | LPXTG-motif cell wall anchor domain protein | |
| 283 | CM000955.1 | GCA000159695_00233 | CDS | open | 243546-244295 | _na 249_aa | SMODS and SLOG-associating 2TM effector domain-containing protein | |
| 284 | CM000955.1 | GCA000159695_00234 | CDS | open | 244430-258193 | _na 4587_aa | LPXTG-motif cell wall anchor domain protein | |
| 285 | CM000955.1 | GCA000159695_00250 | CDS | open | 265777-266271 | _na 164_aa | yjjB | Threonine/Serine exporter ThrE domain-containing protein |
| 286 | CM000955.1 | GCA000159695_00251 | CDS | open | 266271-267065 | _na 264_aa | yjjP | Threonine/serine exporter-like N-terminal domain-containing protein |
| 287 | CM000955.1 | GCA000159695_00252 | CDS | open | 267110-267613 | _na 167_aa | Nitroreductase family protein | |
| 288 | CM000955.1 | GCA000159695_00253 | CDS | open | 267668-268783 | _na 371_aa | nqrF | Sodium-translocating NADH-quinone reductase subunit F |
| 289 | CM000955.1 | GCA000159695_00254 | CDS | open | 268793-269377 | _na 194_aa | nqrE | Putative NADH:ubiquinone oxidoreductase%2C E subunit |
| 290 | CM000955.1 | GCA000159695_00255 | CDS | open | 269377-269991 | _na 204_aa | nqrD | NADH:ubiquinone reductase (Na(+)-transporting) subunit D |
| 291 | CM000955.1 | GCA000159695_00256 | CDS | open | 269991-270596 | _na 201_aa | nqrC | Sodium-translocating NADH-quinone reductase subunit C |
| 292 | CM000955.1 | GCA000159695_00257 | CDS | open | 270589-271575 | _na 328_aa | nqrB | Na(+)-translocating NADH-quinone reductase subunit B |
| 293 | CM000955.1 | GCA000159695_00258 | CDS | open | 271859-272911 | _na 350_aa | aglD2 | Phosphatidylglycerol lysyltransferase |
| 294 | CM000955.1 | GCA000159695_00259 | CDS | open | 273040-276147 | _na 1035_aa | ileS | isoleucine--tRNA ligase |
| 295 | CM000955.1 | GCA000159695_00260 | CDS | open | 276557-278104 | _na 515_aa | Cell wall protein V | |
| 296 | CM000955.1 | GCA000159695_00261 | CDS | open | 278184-279161 | _na 325_aa | cAMP factor family pore-forming toxin | |
| 297 | CM000955.1 | GCA000159695_00262 | CDS | open | 279174-280889 | _na 571_aa | yjdB | BIG2 domain-containing protein |
| 298 | CM000955.1 | GCA000159695_00263 | CDS | open | 280946-283312 | _na 788_aa | Cysteine protease | |
| 299 | CM000955.1 | GCA000159695_00264 | CDS | open | 283695-286826 | _na 1043_aa | Kappa-carrageenase | |
| 300 | CM000955.1 | GCA000159695_00265 | CDS | open | 286865-287605 | _na 246_aa | glnQ | ABC transporter%2C ATP-binding protein |
| 301 | CM000955.1 | GCA000159695_00266 | CDS | open | 287595-289175 | _na 526_aa | hisJ | Amino acid ABC transporter permease protein |
| 302 | CM000955.1 | GCA000159695_00267 | CDS | open | 289188-289922 | _na 244_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 303 | CM000955.1 | GCA000159695_00268 | CDS | open | 289919-290716 | _na 265_aa | ecfT | Energy-coupling factor transporter transmembrane protein EcfT |
| 304 | CM000955.1 | GCA000159695_00269 | CDS | open | 290713-291564 | _na 283_aa | ecfA2 | energy-coupling factor transporter ATPase |
| 305 | CM000955.1 | GCA000159695_00270 | CDS | open | 291574-292407 | _na 277_aa | ecfA2 | energy-coupling factor transporter ATPase |
| 306 | CM000955.1 | GCA000159695_00271 | CDS | open | 292468-296130 | _na 1220_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 307 | CM000955.1 | GCA000159695_00272 | CDS | open | 296093-299647 | _na 1184_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 308 | CM000955.1 | GCA000159695_00273 | CDS | open | 299843-300529 | _na 228_aa | Acyl-ACP thioesterase | |
| 309 | CM000955.1 | GCA000159695_00274 | CDS | open | 300531-302351 | _na 606_aa | cedB | Helicase HerA central domain-containing protein |
| 310 | CM000955.1 | GCA000159695_00275 | CDS | open | 302351-303304 | _na 317_aa | nurA | NurA domain protein |
| 311 | CM000955.1 | GCA000159695_00276 | CDS | open | 303301-304128 | _na 275_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 312 | CM000955.1 | GCA000159695_00277 | CDS | open | 304109-304822 | _na 237_aa | trmN6 | Methyltransferase small domain-containing protein |
| 313 | CM000955.1 | GCA000159695_00278 | CDS | open | 304873-305043 | _na 56_aa | nuoI | Ferredoxin |
| 314 | CM000955.1 | GCA000159695_00279 | CDS | open | 305133-305975 | _na 280_aa | yaaT | PSP1 C-terminal domain-containing protein |
| 315 | CM000955.1 | GCA000159695_00280 | CDS | open | 305968-306786 | _na 272_aa | dnaX | DNA polymerase III subunit tau |
| 316 | CM000955.1 | GCA000159695_00281 | CDS | open | 306786-307058 | _na 90_aa | darA | Transcriptional regulator |
| 317 | CM000955.1 | GCA000159695_00282 | CDS | open | 307067-307393 | _na 108_aa | darA | Transcriptional regulator |
| 318 | CM000955.1 | GCA000159695_00283 | CDS | open | 307390-308001 | _na 203_aa | tmk | dTMP kinase |
| 319 | CM000955.1 | GCA000159695_00284 | CDS | open | 308053-308688 | _na 211_aa | 50S ribosomal protein L25 | |
| 320 | CM000955.1 | GCA000159695_00285 | CDS | open | 308775-309014 | _na 79_aa | bofA | Pro-sigmaK processing inhibitor BofA |
| 321 | CM000955.1 | GCA000159695_00286 | CDS | open | 309100-309606 | _na 168_aa | tpx | thiol peroxidase |
| 322 | CM000955.1 | GCA000159695_00287 | CDS | open | 309771-311846 | _na 691_aa | zntA | Cd(2+)-exporting ATPase |
| 323 | CM000955.1 | GCA000159695_00288 | CDS | open | 311846-312172 | _na 108_aa | DUF1490 domain-containing protein | |
| 324 | CM000955.1 | GCA000159695_00289 | CDS | open | 312374-312682 | _na 102_aa | trxA | thioredoxin |
| 325 | CM000955.1 | GCA000159695_00290 | CDS | open | 312692-314062 | _na 456_aa | D-alanyl-D-alanine carboxypeptidase | |
| 326 | CM000955.1 | GCA000159695_00291 | CDS | open | 314075-315910 | _na 611_aa | flaA1 | UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase |
| 327 | CM000955.1 | GCA000159695_00292 | CDS | open | 315996-317057 | _na 353_aa | ilvE | branched-chain amino acid aminotransferase |
| 328 | CM000955.1 | GCA000159695_00293 | CDS | open | 317111-317335 | _na 74_aa | rpsR | 30S ribosomal protein S18 |
| 329 | CM000955.1 | GCA000159695_00294 | CDS | open | 317356-317868 | _na 170_aa | ssb | Single-stranded DNA-binding protein |
| 330 | CM000955.1 | GCA000159695_00295 | CDS | open | 317889-318176 | _na 95_aa | rpsF | 30S ribosomal protein S6 |
| 331 | CM000955.1 | GCA000159695_00296 | CDS | open | 318356-319045 | _na 229_aa | Hydrolase | |
| 332 | CM000955.1 | GCA000159695_00297 | CDS | open | 319038-319571 | _na 177_aa | bioY | Biotin transporter |
| 333 | CM000955.1 | GCA000159695_00298 | CDS | open | 319620-320630 | _na 336_aa | fni | type 2 isopentenyl-diphosphate Delta-isomerase |
| 334 | CM000955.1 | GCA000159695_00299 | CDS | open | 320657-321610 | _na 317_aa | cps2a | Transcriptional regulator YvhJ |
| 335 | CM000955.1 | GCA000159695_00300 | CDS | open | 321734-325939 | _na 1401_aa | R-phenyllactate dehydratase activator | |
| 336 | CM000955.1 | GCA000159695_00301 | CDS | open | 326011-326892 | _na 293_aa | yhcC | TIGR01212 family radical SAM protein |
| 337 | CM000955.1 | GCA000159695_00302 | CDS | open | 326870-327337 | _na 155_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 338 | CM000955.1 | GCA000159695_00303 | CDS | open | 327560-328735 | _na 391_aa | IS110 family transposase | |
| 339 | CM000955.1 | GCA000159695_00304 | CDS | open | 329008-330114 | _na 368_aa | prsA | ribose-phosphate diphosphokinase |
| 340 | CM000955.1 | GCA000159695_00305 | CDS | open | 330125-331201 | _na 358_aa | hisC | Aminotransferase |
| 341 | CM000955.1 | GCA000159695_00306 | CDS | open | 331254-332924 | _na 556_aa | fdhF | formate dehydrogenase subunit alpha |
| 342 | CM000955.1 | GCA000159695_00307 | CDS | open | 332973-334040 | _na 355_aa | fdhF | formate dehydrogenase subunit alpha |
| 343 | CM000955.1 | GCA000159695_00308 | CDS | open | 334048-334503 | _na 151_aa | yhjR | Rubrerythrin diiron-binding domain-containing protein |
| 344 | CM000955.1 | GCA000159695_00309 | CDS | open | 334536-335459 | _na 307_aa | nuoG | Formate dehydrogenase alpha subunit |
| 345 | CM000955.1 | GCA000159695_00310 | CDS | open | 335465-337345 | _na 626_aa | 2Fe2S | Protein HymB |
| 346 | CM000955.1 | GCA000159695_00311 | CDS | open | 337363-337848 | _na 161_aa | nuoE | NADP-reducing hydrogenase |
| 347 | CM000955.1 | GCA000159695_00312 | CDS | open | 338215-340092 | _na 625_aa | selB | selenocysteine-specific translation elongation factor |
| 348 | CM000955.1 | GCA000159695_00314 | CDS | open | 340418-341596 | _na 392_aa | metK | methionine adenosyltransferase |
| 349 | CM000955.1 | GCA000159695_00315 | CDS | open | 341796-343004 | _na 402_aa | natB | ABC-2 type transporter transmembrane domain-containing protein |
| 350 | CM000955.1 | GCA000159695_00316 | CDS | open | 343004-343918 | _na 304_aa | yhaQ | Antibiotic ABC transporter ATP-binding protein |
| 351 | CM000955.1 | GCA000159695_00317 | CDS | open | 343920-344291 | _na 123_aa | gloA | Aldoketomutase |
| 352 | CM000955.1 | GCA000159695_00318 | CDS | open | 344303-346039 | _na 578_aa | pepF | oligoendopeptidase F |
| 353 | CM000955.1 | GCA000159695_00319 | CDS | open | 346121-346474 | _na 117_aa | DUF805 domain-containing protein | |
| 354 | CM000955.1 | GCA000159695_00320 | CDS | open | 346561-347178 | _na 205_aa | ntpD | V-type ATP synthase subunit D |
| 355 | CM000955.1 | GCA000159695_00321 | CDS | open | 347183-348559 | _na 458_aa | ntpB | V-type ATP synthase beta chain |
| 356 | CM000955.1 | GCA000159695_00322 | CDS | open | 348568-350334 | _na 588_aa | ntpA | V-type ATP synthase alpha chain |
| 357 | CM000955.1 | GCA000159695_00323 | CDS | open | 350327-350935 | _na 202_aa | ntpE | V-type ATP synthase subunit E |
| 358 | CM000955.1 | GCA000159695_00324 | CDS | open | 350944-351252 | _na 102_aa | ntpF | V-type sodium ATP synthase subunit F |
| 359 | CM000955.1 | GCA000159695_00325 | CDS | open | 351255-351674 | _na 139_aa | atpE | V-type sodium ATP synthase subunit K |
| 360 | CM000955.1 | GCA000159695_00326 | CDS | open | 351688-353604 | _na 638_aa | ntpI | V-type ATP synthase subunit I |
| 361 | CM000955.1 | GCA000159695_00327 | CDS | open | 353632-354648 | _na 338_aa | ntpC | ATP synthase%2C subunit C |
| 362 | CM000955.1 | GCA000159695_00328 | CDS | open | 354651-354959 | _na 102_aa | ATPase | |
| 363 | CM000955.1 | GCA000159695_00329 | CDS | open | 355234-356220 | _na 328_aa | IS30 family transposase | |
| 364 | CM000955.1 | GCA000159695_00330 | CDS | open | 356369-357079 | _na 236_aa | DUF4367 domain-containing protein | |
| 365 | CM000955.1 | GCA000159695_00331 | CDS | open | 357275-358087 | _na 270_aa | dnaJ | Putative heat shock protein |
| 366 | CM000955.1 | GCA000159695_00332 | CDS | open | 358168-359076 | _na 302_aa | mMP0363 | Nitric-oxide reductase |
| 367 | CM000955.1 | GCA000159695_00333 | CDS | open | 359076-360761 | _na 561_aa | norD | VWFA domain-containing protein |
| 368 | CM000955.1 | GCA000159695_00334 | CDS | open | 360810-361310 | _na 166_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 369 | CM000955.1 | GCA000159695_00335 | CDS | open | 361310-363433 | _na 707_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 370 | CM000955.1 | GCA000159695_00336 | CDS | open | 363671-364630 | _na 319_aa | pgaB | Bifunctional xylanase/deacetylase |
| 371 | CM000955.1 | GCA000159695_00337 | CDS | open | 364639-365814 | _na 391_aa | ctpA | Peptidase%2C S41 family |
| 372 | CM000955.1 | GCA000159695_00338 | CDS | open | 365958-367409 | _na 483_aa | Peptidase%2C S41 family | |
| 373 | CM000955.1 | GCA000159695_00339 | CDS | open | 367428-368882 | _na 484_aa | Peptidase S41 | |
| 374 | CM000955.1 | GCA000159695_00340 | CDS | open | 369038-370261 | _na 407_aa | cwlO1 | Cell wall-binding protein |
| 375 | CM000955.1 | GCA000159695_00341 | CDS | open | 370272-371165 | _na 297_aa | ftsX | permease-like cell division protein FtsX |
| 376 | CM000955.1 | GCA000159695_00342 | CDS | open | 371152-371835 | _na 227_aa | ftsE | cell division ATP-binding protein FtsE |
| 377 | CM000955.1 | GCA000159695_00343 | CDS | open | 371935-372468 | _na 177_aa | fAU1 | 5-formyltetrahydrofolate cyclo-ligase |
| 378 | CM000955.1 | GCA000159695_00344 | CDS | open | 372796-374010 | _na 404_aa | IS256 family transposase | |
| 379 | CM000955.1 | GCA000159695_00345 | CDS | open | 374127-375668 | _na 513_aa | Peptidase%2C S41 family | |
| 380 | CM000955.1 | GCA000159695_00346 | CDS | open | 375607-375768 | _na 53_aa | hypothetical protein | |
| 381 | CM000955.1 | GCA000159695_00347 | CDS | open | 375797-377290 | _na 497_aa | Peptidase%2C S41 family | |
| 382 | CM000955.1 | GCA000159695_00348 | CDS | open | 377377-378834 | _na 485_aa | Peptidase%2C S41 family | |
| 383 | CM000955.1 | GCA000159695_00349 | CDS | open | 378884-380386 | _na 500_aa | Peptidase family S41 | |
| 384 | CM000955.1 | GCA000159695_00350 | CDS | open | 380391-381875 | _na 494_aa | Peptidase%2C S41 family | |
| 385 | CM000955.1 | GCA000159695_00351 | CDS | open | 382452-383537 | _na 361_aa | Phage tail protein | |
| 386 | CM000955.1 | GCA000159695_00352 | CDS | open | 383609-383950 | _na 113_aa | mazF | mRNA interferase |
| 387 | CM000955.1 | GCA000159695_00353 | CDS | open | 384060-385235 | _na 391_aa | alr | alanine racemase |
| 388 | CM000955.1 | GCA000159695_00354 | CDS | open | 385235-386074 | _na 279_aa | nnr2 | ADP-dependent (S)-NAD(P)H-hydrate dehydratase |
| 389 | CM000955.1 | GCA000159695_00355 | CDS | open | 386076-386429 | _na 117_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 390 | CM000955.1 | GCA000159695_00356 | CDS | open | 386419-387786 | _na 455_aa | yjbM | RelA/SpoT domain-containing protein |
| 391 | CM000955.1 | GCA000159695_00357 | CDS | open | 387885-388148 | _na 87_aa | Putative Se/S carrier protein-like domain-containing protein | |
| 392 | CM000955.1 | GCA000159695_00358 | CDS | open | 388138-389421 | _na 427_aa | hgdB | double-cubane-cluster-containing anaerobic reductase |
| 393 | CM000955.1 | GCA000159695_00359 | CDS | open | 389433-390227 | _na 264_aa | hgdB | 2-hydroxyacyl-CoA dehydratase |
| 394 | CM000955.1 | GCA000159695_00360 | CDS | open | 390227-391000 | _na 257_aa | yjiL | Activator of (R)-2-hydroxyglutaryl-CoA dehydratase |
| 395 | CM000955.1 | GCA000159695_00361 | CDS | open | 391132-391776 | _na 214_aa | Peptidase C39-like domain-containing protein | |
| 396 | CM000955.1 | GCA000159695_00362 | CDS | open | 392032-393339 | _na 435_aa | nCS2 | Putative xanthine/uracil permease family protein |
| 397 | CM000955.1 | GCA000159695_00363 | CDS | open | 393351-395264 | _na 637_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 398 | CM000955.1 | GCA000159695_00364 | CDS | open | 395318-395860 | _na 180_aa | yfcE | phosphodiesterase |
| 399 | CM000955.1 | GCA000159695_00365 | CDS | open | 395860-398190 | _na 776_aa | lon | endopeptidase La |
| 400 | CM000955.1 | GCA000159695_00366 | CDS | open | 398254-399489 | _na 411_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 401 | CM000955.1 | GCA000159695_00367 | CDS | open | 399500-400087 | _na 195_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 402 | CM000955.1 | GCA000159695_00368 | CDS | open | 400128-401453 | _na 441_aa | tig | trigger factor |
| 403 | CM000955.1 | GCA000159695_00369 | CDS | open | 401577-402563 | _na 328_aa | lytC | N-acetylmuramoyl-L-alanine amidase LytC |
| 404 | CM000955.1 | GCA000159695_00370 | CDS | open | 402690-403352 | _na 220_aa | Xylose operon regulatory protein | |
| 405 | CM000955.1 | GCA000159695_00371 | CDS | open | 403535-405664 | _na 709_aa | feoB | ferrous iron transport protein B |
| 406 | CM000955.1 | GCA000159695_00372 | CDS | open | 405677-405919 | _na 80_aa | feoA | Ferrous iron transport protein A |
| 407 | CM000955.1 | GCA000159695_00373 | CDS | open | 405937-406161 | _na 74_aa | feoA | Ferrous iron transporter FeoA-like domain-containing protein |
| 408 | CM000955.1 | GCA000159695_00374 | CDS | open | 406496-408316 | _na 606_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 409 | CM000955.1 | GCA000159695_00375 | CDS | open | 408388-409839 | _na 483_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 410 | CM000955.1 | GCA000159695_00376 | CDS | open | 409829-410515 | _na 228_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 411 | CM000955.1 | GCA000159695_00377 | CDS | open | 410496-411002 | _na 168_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 412 | CM000955.1 | GCA000159695_00378 | CDS | open | 411071-411661 | _na 196_aa | fmnP | Riboflavin transporter |
| 413 | CM000955.1 | GCA000159695_00379 | CDS | open | 411930-413192 | _na 420_aa | lAP4 | M18 family aminopeptidase |
| 414 | CM000955.1 | GCA000159695_00381 | CDS | open | 413594-414271 | _na 225_aa | mtnN | 5'-methylthioadenosine/adenosylhomocysteine nucleosidase |
| 415 | CM000955.1 | GCA000159695_00382 | CDS | open | 414268-415617 | _na 449_aa | glmM | phosphoglucosamine mutase |
| 416 | CM000955.1 | GCA000159695_00383 | CDS | open | 415720-416010 | _na 96_aa | hypothetical protein | |
| 417 | CM000955.1 | GCA000159695_00384 | CDS | open | 415973-416950 | _na 325_aa | YbbR-like protein | |
| 418 | CM000955.1 | GCA000159695_00385 | CDS | open | 416940-417776 | _na 278_aa | cdaA | diadenylate cyclase CdaA |
| 419 | CM000955.1 | GCA000159695_00386 | CDS | open | 417886-418149 | _na 87_aa | Phosphocarrier protein HPr | |
| 420 | CM000955.1 | GCA000159695_00387 | CDS | open | 418206-418748 | _na 180_aa | yotD | Rubrerythrin |
| 421 | CM000955.1 | GCA000159695_00388 | CDS | open | 418833-419876 | _na 347_aa | mreB | Cell shape-determining protein MreB |
| 422 | CM000955.1 | GCA000159695_00389 | CDS | open | 419885-420364 | _na 159_aa | ispF | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase |
| 423 | CM000955.1 | GCA000159695_00390 | CDS | open | 420361-421056 | _na 231_aa | ispD | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 424 | CM000955.1 | GCA000159695_00391 | CDS | open | 421179-422285 | _na 368_aa | TRAM domain-containing protein | |
| 425 | CM000955.1 | GCA000159695_00392 | CDS | open | 422310-422792 | _na 160_aa | cdnL | RNA polymerase-binding transcription factor CarD |
| 426 | CM000955.1 | GCA000159695_00393 | CDS | open | 422936-423892 | _na 318_aa | 3D domain-containing protein | |
| 427 | CM000955.1 | GCA000159695_00394 | CDS | open | 424301-424681 | _na 126_aa | DUF3284 domain-containing protein | |
| 428 | CM000955.1 | GCA000159695_00395 | CDS | open | 424674-425981 | _na 435_aa | hemN | coproporphyrinogen III oxidase |
| 429 | CM000955.1 | GCA000159695_00396 | CDS | open | 426036-427079 | _na 347_aa | nrdB | ribonucleotide-diphosphate reductase subunit beta |
| 430 | CM000955.1 | GCA000159695_00397 | CDS | open | 427108-427536 | _na 142_aa | aroQ | type II 3-dehydroquinate dehydratase |
| 431 | CM000955.1 | GCA000159695_00398 | CDS | open | 427517-428728 | _na 403_aa | aroK | Shikimate kinase |
| 432 | CM000955.1 | GCA000159695_00399 | CDS | open | 428725-428976 | _na 83_aa | Chorismate mutase | |
| 433 | CM000955.1 | GCA000159695_00400 | CDS | open | 428952-430043 | _na 363_aa | aroC | chorismate synthase |
| 434 | CM000955.1 | GCA000159695_00401 | CDS | open | 430027-431223 | _na 398_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 435 | CM000955.1 | GCA000159695_00402 | CDS | open | 431213-432244 | _na 343_aa | aroB | 3-dehydroquinate synthase |
| 436 | CM000955.1 | GCA000159695_00403 | CDS | open | 432232-433233 | _na 333_aa | aroGA | bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase |
| 437 | CM000955.1 | GCA000159695_00404 | CDS | open | 433326-433697 | _na 123_aa | DUF6483 domain-containing protein | |
| 438 | CM000955.1 | GCA000159695_00405 | CDS | open | 433727-434575 | _na 282_aa | Aminoglycoside 6-adenylyltransferase | |
| 439 | CM000955.1 | GCA000159695_00406 | CDS | open | 434581-435225 | _na 214_aa | 5'-nucleotidase | |
| 440 | CM000955.1 | GCA000159695_00407 | CDS | open | 435375-436550 | _na 391_aa | dppD | Oligopeptide transport ATP-binding protein OppF |
| 441 | CM000955.1 | GCA000159695_00408 | CDS | open | 436560-437795 | _na 411_aa | dppD | Oligopeptide transport ATP-binding protein OppD |
| 442 | CM000955.1 | GCA000159695_00409 | CDS | open | 437807-438724 | _na 305_aa | dppC | Dipeptide transport system permease protein DppC |
| 443 | CM000955.1 | GCA000159695_00410 | CDS | open | 438734-439660 | _na 308_aa | dppB | Oligopeptide ABC transporter permease protein |
| 444 | CM000955.1 | GCA000159695_00411 | CDS | open | 439764-441416 | _na 550_aa | dppE | Dipeptide-binding protein DppE |
| 445 | CM000955.1 | GCA000159695_00412 | CDS | open | 441954-442970 | _na 338_aa | gLY1 | Low specificity L-threonine aldolase |
| 446 | CM000955.1 | GCA000159695_00413 | CDS | open | 443060-444820 | _na 586_aa | DUF4153 domain-containing protein | |
| 447 | CM000955.1 | GCA000159695_00414 | CDS | open | 444966-445382 | _na 138_aa | 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein | |
| 448 | CM000955.1 | GCA000159695_00415 | CDS | open | 445416-446114 | _na 232_aa | ABC transporter permease | |
| 449 | CM000955.1 | GCA000159695_00416 | CDS | open | 446080-446967 | _na 295_aa | rbbA | ABC transporter domain-containing protein |
| 450 | CM000955.1 | GCA000159695_00417 | CDS | open | 446976-447488 | _na 170_aa | pgpA | Phosphatidylglycerophosphatase A |
| 451 | CM000955.1 | GCA000159695_00418 | CDS | open | 447546-448478 | _na 310_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 452 | CM000955.1 | GCA000159695_00419 | CDS | open | 448475-450070 | _na 531_aa | phnV | 2-aminoethylphosphonate transport system permease protein PhnV |
| 453 | CM000955.1 | GCA000159695_00420 | CDS | open | 450149-451222 | _na 357_aa | ABC transporter substrate-binding protein | |
| 454 | CM000955.1 | GCA000159695_00421 | CDS | open | 451328-452050 | _na 240_aa | DUF5104 domain-containing protein | |
| 455 | CM000955.1 | GCA000159695_00422 | CDS | open | 452162-454501 | _na 779_aa | lytC | N-acetylmuramoyl-L-alanine amidase LytC |
| 456 | CM000955.1 | GCA000159695_00423 | CDS | open | 454501-455562 | _na 353_aa | YibE/F family protein | |
| 457 | CM000955.1 | GCA000159695_00424 | CDS | open | 455719-456858 | _na 379_aa | YibE/F family protein | |
| 458 | CM000955.1 | GCA000159695_00425 | CDS | open | 456971-457474 | _na 167_aa | nar1 | Iron hydrogenase small subunit |
| 459 | CM000955.1 | GCA000159695_00426 | CDS | open | 457511-459085 | _na 524_aa | mdlB | Beta-(1-->2)glucan export ATP-binding/permease protein NdvA |
| 460 | CM000955.1 | GCA000159695_00427 | CDS | open | 459309-460751 | _na 480_aa | thrC | Threonine synthase |
| 461 | CM000955.1 | GCA000159695_00428 | CDS | open | 460843-461994 | _na 383_aa | yqdH | NADH-dependent butanol dehydrogenase A |
| 462 | CM000955.1 | GCA000159695_00429 | CDS | open | 462027-462326 | _na 99_aa | ABC transporter domain-containing protein | |
| 463 | CM000955.1 | GCA000159695_00430 | CDS | open | 462855-463169 | _na 104_aa | DUF961 domain-containing protein | |
| 464 | CM000955.1 | GCA000159695_00431 | CDS | open | 463188-463571 | _na 127_aa | DUF961 domain-containing protein | |
| 465 | CM000955.1 | GCA000159695_00432 | CDS | open | 463600-464985 | _na 461_aa | ftsK | FtsK domain-containing protein |
| 466 | CM000955.1 | GCA000159695_00433 | CDS | open | 465163-466368 | _na 401_aa | mobT | MobT family relaxase |
| 467 | CM000955.1 | GCA000159695_00434 | CDS | open | 466411-466632 | _na 73_aa | Conjugal transfer protein | |
| 468 | CM000955.1 | GCA000159695_00435 | CDS | open | 466749-467246 | _na 165_aa | Conjugative transposon protein | |
| 469 | CM000955.1 | GCA000159695_00436 | CDS | open | 467711-470158 | _na 815_aa | virB4 | ATP/GTP-binding protein |
| 470 | CM000955.1 | GCA000159695_00437 | CDS | open | 470227-472338 | _na 703_aa | ytxH | YtxH domain-containing protein |
| 471 | CM000955.1 | GCA000159695_00438 | CDS | open | 472335-473336 | _na 333_aa | nlpC | NlpC/P60 domain-containing protein |
| 472 | CM000955.1 | GCA000159695_00439 | CDS | open | 473333-474268 | _na 311_aa | Conjugal transfer protein | |
| 473 | CM000955.1 | GCA000159695_00442 | CDS | open | 474645-476564 | _na 639_aa | tet(M) | tetracycline resistance ribosomal protection protein Tet(M) |
| 474 | CM000955.1 | GCA000159695_00443 | CDS | open | 476910-477263 | _na 117_aa | hipB | HTH cro/C1-type domain-containing protein |
| 475 | CM000955.1 | GCA000159695_00444 | CDS | open | 477768-478190 | _na 140_aa | rpoE | RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein |
| 476 | CM000955.1 | GCA000159695_00445 | CDS | open | 478187-478417 | _na 76_aa | Helix-turn-helix conjugative transposon-like domain-containing protein | |
| 477 | CM000955.1 | GCA000159695_00446 | CDS | open | 478874-479077 | _na 67_aa | xis | Excisionase from transposon Tn1545 |
| 478 | CM000955.1 | GCA000159695_00447 | CDS | open | 479159-480376 | _na 405_aa | int-Tn | Transposase from transposon Tn916 |
| 479 | CM000955.1 | GCA000159695_00448 | CDS | open | 480538-481593 | _na 351_aa | ABC transmembrane type-1 domain-containing protein | |
| 480 | CM000955.1 | GCA000159695_00449 | CDS | open | 481586-483127 | _na 513_aa | mdlB | Fe(3+) ions import ATP-binding protein FbpC |
| 481 | CM000955.1 | GCA000159695_00450 | CDS | open | 483240-484148 | _na 302_aa | rhaT | Putative mambrane protein |
| 482 | CM000955.1 | GCA000159695_00451 | CDS | open | 484151-485620 | _na 489_aa | mdlB | Multidrug ABC transporter |
| 483 | CM000955.1 | GCA000159695_00452 | CDS | open | 485909-486679 | _na 256_aa | ABC-2 type transporter | |
| 484 | CM000955.1 | GCA000159695_00453 | CDS | open | 486681-487448 | _na 255_aa | ABC-2 type transporter | |
| 485 | CM000955.1 | GCA000159695_00454 | CDS | open | 487448-488365 | _na 305_aa | metN | Methionine import ATP-binding protein MetN 2 |
| 486 | CM000955.1 | GCA000159695_00455 | CDS | open | 488515-489327 | _na 270_aa | DUF2812 domain-containing protein | |
| 487 | CM000955.1 | GCA000159695_00456 | CDS | open | 489347-490966 | _na 539_aa | mdlB | Multidrug ABC transporter |
| 488 | CM000955.1 | GCA000159695_00457 | CDS | open | 491098-491247 | _na 49_aa | scfA | six-cysteine ranthipeptide SCIFF |
| 489 | CM000955.1 | GCA000159695_00458 | CDS | open | 491396-492754 | _na 452_aa | scfB | thioether cross-link-forming SCIFF peptide maturase |
| 490 | CM000955.1 | GCA000159695_00459 | CDS | open | 492747-493991 | _na 414_aa | ldcC | Arginine decarboxylase |
| 491 | CM000955.1 | GCA000159695_00460 | CDS | open | 494052-494408 | _na 118_aa | yhcF | HTH-type transcriptional repressor YtrA |
| 492 | CM000955.1 | GCA000159695_00461 | CDS | open | 494405-494932 | _na 175_aa | ABC transporter%2C ATP-binding protein | |
| 493 | CM000955.1 | GCA000159695_00462 | CDS | open | 494932-495099 | _na 55_aa | ABC transporter%2C ATP-binding protein | |
| 494 | CM000955.1 | GCA000159695_00463 | CDS | open | 495092-495928 | _na 278_aa | Antibiotic ABC transporter permease | |
| 495 | CM000955.1 | GCA000159695_00464 | CDS | open | 495959-496510 | _na 183_aa | chrA | Chromate transport protein |
| 496 | CM000955.1 | GCA000159695_00465 | CDS | open | 496497-497051 | _na 184_aa | chrA | Chromate transport protein |
| 497 | CM000955.1 | GCA000159695_00466 | CDS | open | 497154-498020 | _na 288_aa | fba | class II fructose-1%2C6-bisphosphate aldolase |
| 498 | CM000955.1 | GCA000159695_00467 | CDS | open | 498073-499944 | _na 623_aa | ptsN | PTS system fructose-specific EIIABC component |
| 499 | CM000955.1 | GCA000159695_00468 | CDS | open | 499934-500857 | _na 307_aa | pfkB | 1-phosphofructokinase |
| 500 | CM000955.1 | GCA000159695_00469 | CDS | open | 500928-501566 | _na 212_aa | maf | dTTP/UTP pyrophosphatase |

