BAKTAGenome Explorer: Gemella haemolysans clade-434 (GCA_000204355.1)
Select a Genome:
|
BAKTA Annotations for GCA_000204355.1
|
Search & Sort all 3933 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | GL883582.1 | GCA000204355_00479 | gene | open | 513575-513928 | ssrA | ||
| 2 | GL883582.1 | GCA000204355_00479 | tmRNA | open | 513575-513928 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | GL883582.1 | GCA000204355_00001 | gene | open | 422-536 | rrf | ||
| 4 | GL883582.1 | GCA000204355_00390 | gene | open | 417987-418170 | 6S | ||
| 5 | GL883582.1 | GCA000204355_00544 | gene | open | 592236-592410 | S414 | ||
| 6 | GL883582.1 | GCA000204355_00549 | gene | open | 596261-596574 | rliD | ||
| 7 | GL883582.1 | GCA000204355_00642 | gene | open | 667146-667409 | Bacteria_large_SRP | ||
| 8 | GL883582.1 | GCA000204355_00643 | gene | open | 667197-667297 | Bacteria_small_SRP | ||
| 9 | GL883582.1 | GCA000204355_00799 | gene | open | 840881-840995 | rrf | ||
| 10 | GL883582.1 | GCA000204355_00390 | ncRNA | open | 417987-418170 | 6S / SsrS RNA | ||
| 11 | GL883582.1 | GCA000204355_00544 | ncRNA | open | 592236-592410 | Staphylococcus sRNA 414 | ||
| 12 | GL883582.1 | GCA000204355_00549 | ncRNA | open | 596261-596574 | rliD | Listeria sRNA rliD | |
| 13 | GL883582.1 | GCA000204355_00642 | ncRNA | open | 667146-667409 | Bacterial large signal recognition particle RNA | ||
| 14 | GL883582.1 | GCA000204355_00643 | ncRNA | open | 667197-667297 | Bacterial small signal recognition particle RNA | ||
| 15 | GL883582.1 | regulatory_region | open | 28251-28446 | T-box leader | |||
| 16 | GL883582.1 | regulatory_region | open | 458136-458249 | Ribosomal protein L20 leader | |||
| 17 | GL883582.1 | regulatory_region | open | 467761-467892 | Ribosomal protein L10 leader | |||
| 18 | GL883582.1 | regulatory_region | open | 560755-560933 | Lysine riboswitch aptamer | |||
| 19 | GL883582.1 | regulatory_region | open | 582172-582385 | T-box leader | |||
| 20 | GL883582.1 | regulatory_region | open | 599479-599550 | Ribosomal protein L21 leader | |||
| 21 | GL883582.1 | regulatory_region | open | 721155-721373 | T-box leader | |||
| 22 | GL883582.1 | regulatory_region | open | 750851-750948 | TPP riboswitch aptamer (THI element) | |||
| 23 | GL883582.1 | regulatory_region | open | 775072-775289 | T-box leader | |||
| 24 | GL883582.1 | regulatory_region | open | 775348-775590 | T-box leader | |||
| 25 | GL883582.1 | GCA000204355_00001 | rRNA | open | 422-536 | rrf | 5S ribosomal RNA | |
| 26 | GL883582.1 | GCA000204355_00799 | rRNA | open | 840881-840995 | rrf | 5S ribosomal RNA | |
| 27 | GL883582.1 | repeat_region | open | 126788-127552 | CRISPR array with 12 repeats of length 36%2C consensus sequence GTTTGAGAGATATGTAAATTTTGAATTCTACTAAAC and spacer length 29 | |||
| 28 | GL883582.1 | GCA000204355_00002 | CDS | open | 652-1647 | _na 331_aa | hypothetical protein | |
| 29 | GL883582.1 | GCA000204355_00003 | CDS | open | 1640-3016 | _na 458_aa | dnaD | DnaD domain-containing protein |
| 30 | GL883582.1 | GCA000204355_00004 | CDS | open | 3016-3900 | _na 294_aa | dnaI | primosomal protein DnaI |
| 31 | GL883582.1 | GCA000204355_00005 | CDS | open | 4049-4480 | _na 143_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 32 | GL883582.1 | GCA000204355_00006 | CDS | open | 4492-5427 | _na 311_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 33 | GL883582.1 | GCA000204355_00007 | CDS | open | 5444-5770 | _na 108_aa | ftsL | Cell division protein FtsL |
| 34 | GL883582.1 | GCA000204355_00008 | CDS | open | 5771-7969 | _na 732_aa | pASTA | PASTA domain-containing protein |
| 35 | GL883582.1 | GCA000204355_00009 | CDS | open | 7979-8962 | _na 327_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 36 | GL883582.1 | GCA000204355_00010 | CDS | open | 8964-10304 | _na 446_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 37 | GL883582.1 | GCA000204355_00011 | CDS | open | 10311-11276 | _na 321_aa | POTRA domain-containing protein | |
| 38 | GL883582.1 | GCA000204355_00012 | CDS | open | 11516-12880 | _na 454_aa | ftsA | cell division protein FtsA |
| 39 | GL883582.1 | GCA000204355_00013 | CDS | open | 12901-13992 | _na 363_aa | ftsZ | cell division protein FtsZ |
| 40 | GL883582.1 | GCA000204355_00014 | CDS | open | 14122-14586 | _na 154_aa | OsmC-like protein | |
| 41 | GL883582.1 | GCA000204355_00015 | CDS | open | 14579-15754 | _na 391_aa | metE | Cobalamin-independent methionine synthase MetE C-terminal/archaeal domain-containing protein |
| 42 | GL883582.1 | GCA000204355_00016 | CDS | open | 15757-16581 | _na 274_aa | Phosphonate ABC transporter substrate-binding protein | |
| 43 | GL883582.1 | GCA000204355_00017 | CDS | open | 16823-17950 | _na 375_aa | caiA | Acyl-CoA dehydrogenase%2C C-terminal domain protein |
| 44 | GL883582.1 | GCA000204355_00018 | CDS | open | 18325-19767 | _na 480_aa | lysP | Amino acid permease/ SLC12A domain-containing protein |
| 45 | GL883582.1 | GCA000204355_00019 | CDS | open | 19863-20528 | _na 221_aa | coaE | dephospho-CoA kinase |
| 46 | GL883582.1 | GCA000204355_00020 | CDS | open | 20506-21249 | _na 247_aa | rbbA | ABC transporter domain-containing protein |
| 47 | GL883582.1 | GCA000204355_00021 | CDS | open | 21242-22480 | _na 412_aa | ecsB | Bacterial ABC transporter protein EcsB |
| 48 | GL883582.1 | GCA000204355_00022 | CDS | open | 22492-23889 | _na 465_aa | Protoporphyrinogen oxidase | |
| 49 | GL883582.1 | GCA000204355_00023 | CDS | open | 23923-25347 | _na 474_aa | leucyl aminopeptidase | |
| 50 | GL883582.1 | GCA000204355_00024 | CDS | open | 25538-26218 | _na 226_aa | Cobalt transport protein | |
| 51 | GL883582.1 | GCA000204355_00025 | CDS | open | 26218-27618 | _na 466_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 52 | GL883582.1 | GCA000204355_00026 | CDS | open | 27622-28197 | _na 191_aa | TIGR02185 family protein | |
| 53 | GL883582.1 | GCA000204355_00027 | CDS | open | 28663-29484 | _na 273_aa | hisJ | Solute-binding protein family 3/N-terminal domain-containing protein |
| 54 | GL883582.1 | GCA000204355_00028 | CDS | open | 29504-30145 | _na 213_aa | hisM | ABC transmembrane type-1 domain-containing protein |
| 55 | GL883582.1 | GCA000204355_00029 | CDS | open | 30155-30874 | _na 239_aa | glnQ | ABC transporter domain-containing protein |
| 56 | GL883582.1 | GCA000204355_00030 | CDS | open | 31055-31165 | _na 36_aa | hypothetical protein | |
| 57 | GL883582.1 | GCA000204355_00031 | CDS | open | 31630-32931 | _na 433_aa | nCS2 | Permease |
| 58 | GL883582.1 | GCA000204355_00032 | CDS | open | 33092-34423 | _na 443_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 59 | GL883582.1 | GCA000204355_00033 | CDS | open | 34476-35639 | _na 387_aa | Methyltransferase domain-containing protein | |
| 60 | GL883582.1 | GCA000204355_00034 | CDS | open | 35875-37371 | _na 498_aa | murE | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase |
| 61 | GL883582.1 | GCA000204355_00035 | CDS | open | 37392-38957 | _na 521_aa | prfC | peptide chain release factor 3 |
| 62 | GL883582.1 | GCA000204355_00036 | CDS | open | 39293-39727 | _na 144_aa | gtrA | GtrA/DPMS transmembrane domain-containing protein |
| 63 | GL883582.1 | GCA000204355_00037 | CDS | open | 39727-40560 | _na 277_aa | cof | Cof-like hydrolase |
| 64 | GL883582.1 | GCA000204355_00038 | CDS | open | 40698-42992 | _na 764_aa | secD | Multifunctional fusion protein |
| 65 | GL883582.1 | GCA000204355_00039 | CDS | open | 43744-44463 | _na 239_aa | Thioester domain-containing protein | |
| 66 | GL883582.1 | GCA000204355_00040 | CDS | open | 44601-45395 | _na 264_aa | LPXTG-motif cell wall anchor domain protein | |
| 67 | GL883582.1 | GCA000204355_00041 | CDS | open | 45625-46275 | _na 216_aa | Response regulator receiver domain protein | |
| 68 | GL883582.1 | GCA000204355_00042 | CDS | open | 46272-47630 | _na 452_aa | histidine kinase | |
| 69 | GL883582.1 | GCA000204355_00043 | CDS | open | 47856-48464 | _na 202_aa | YSIRK Gram-positive signal peptide domain-containing protein | |
| 70 | GL883582.1 | GCA000204355_00044 | CDS | open | 48499-50757 | _na 752_aa | Repeat protein | |
| 71 | GL883582.1 | GCA000204355_00045 | CDS | open | 50699-51775 | _na 358_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 72 | GL883582.1 | GCA000204355_00046 | CDS | open | 52457-52747 | _na 96_aa | tnpA | IS200/IS605 family transposase |
| 73 | GL883582.1 | GCA000204355_00047 | CDS | open | 53441-59146 | _na 1901_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 74 | GL883582.1 | GCA000204355_00048 | CDS | open | 60349-60900 | _na 183_aa | LPXTG cell wall anchor domain-containing protein | |
| 75 | GL883582.1 | GCA000204355_00049 | CDS | open | 61132-61449 | _na 105_aa | DUF937 domain-containing protein | |
| 76 | GL883582.1 | GCA000204355_00050 | CDS | open | 61531-62475 | _na 314_aa | arsS | arsenosugar biosynthesis radical SAM (seleno)protein ArsS |
| 77 | GL883582.1 | GCA000204355_00051 | CDS | open | 62483-62821 | _na 112_aa | yurZ | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 78 | GL883582.1 | GCA000204355_00052 | CDS | open | 63124-63807 | _na 227_aa | bcsA | TIGR04283 family arsenosugar biosynthesis glycosyltransferase |
| 79 | GL883582.1 | GCA000204355_00053 | CDS | open | 64045-64434 | _na 129_aa | HTH gntR-type domain-containing protein | |
| 80 | GL883582.1 | GCA000204355_00054 | CDS | open | 64421-65134 | _na 237_aa | ABC transporter domain-containing protein | |
| 81 | GL883582.1 | GCA000204355_00055 | CDS | open | 65127-65942 | _na 271_aa | hypothetical protein | |
| 82 | GL883582.1 | GCA000204355_00056 | CDS | open | 66088-66780 | _na 230_aa | rplA | 50S ribosomal protein L1 |
| 83 | GL883582.1 | GCA000204355_00057 | CDS | open | 66794-67219 | _na 141_aa | rplK | 50S ribosomal protein L11 |
| 84 | GL883582.1 | GCA000204355_00058 | CDS | open | 67701-69254 | _na 517_aa | rny | ribonuclease Y |
| 85 | GL883582.1 | GCA000204355_00059 | CDS | open | 69694-70485 | _na 263_aa | Formate/nitrite transporter | |
| 86 | GL883582.1 | GCA000204355_00060 | CDS | open | 70747-71532 | _na 261_aa | focA | Formate/nitrite transporter |
| 87 | GL883582.1 | GCA000204355_00061 | CDS | open | 71717-72802 | _na 361_aa | ilvE | branched-chain amino acid aminotransferase |
| 88 | GL883582.1 | GCA000204355_00062 | CDS | open | 73097-74275 | _na 392_aa | aspB | Aminotransferase |
| 89 | GL883582.1 | GCA000204355_00063 | CDS | open | 74297-74923 | _na 208_aa | tmk | dTMP kinase |
| 90 | GL883582.1 | GCA000204355_00064 | CDS | open | 74913-75749 | _na 278_aa | DNA polymerase III%2C delta' subunit | |
| 91 | GL883582.1 | GCA000204355_00065 | CDS | open | 75751-76485 | _na 244_aa | trmN6 | Methyltransferase domain-containing protein |
| 92 | GL883582.1 | GCA000204355_00066 | CDS | open | 76490-76780 | _na 96_aa | GIY-YIG domain-containing protein | |
| 93 | GL883582.1 | GCA000204355_00067 | CDS | open | 76781-77611 | _na 276_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 94 | GL883582.1 | GCA000204355_00068 | CDS | open | 77595-77921 | _na 108_aa | Histidine kinase | |
| 95 | GL883582.1 | GCA000204355_00069 | CDS | open | 77943-79436 | _na 497_aa | Cation transport protein | |
| 96 | GL883582.1 | GCA000204355_00070 | CDS | open | 79440-80813 | _na 457_aa | trkA | Trk system potassium transporter TrkA |
| 97 | GL883582.1 | GCA000204355_00071 | CDS | open | 81248-83038 | _na 596_aa | DNA primase | |
| 98 | GL883582.1 | GCA000204355_00072 | CDS | open | 83051-84136 | _na 361_aa | rpoD | RNA polymerase sigma factor RpoD |
| 99 | GL883582.1 | GCA000204355_00073 | CDS | open | 84336-84605 | _na 89_aa | ISL3 family transposase | |
| 100 | GL883582.1 | GCA000204355_00074 | CDS | open | 85042-85389 | _na 115_aa | Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein | |
| 101 | GL883582.1 | GCA000204355_00075 | CDS | open | 85807-87231 | _na 474_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 102 | GL883582.1 | GCA000204355_00076 | CDS | open | 87336-87596 | _na 86_aa | TM2 domain-containing protein | |
| 103 | GL883582.1 | GCA000204355_00077 | CDS | open | 87760-88146 | _na 128_aa | pspE | Rhodanese domain-containing protein |
| 104 | GL883582.1 | GCA000204355_00078 | CDS | open | 88268-89023 | _na 251_aa | RNA 2-O ribose methyltransferase substrate binding domain-containing protein | |
| 105 | GL883582.1 | GCA000204355_00079 | CDS | open | 89092-90045 | _na 317_aa | corA | magnesium/cobalt transporter CorA |
| 106 | GL883582.1 | GCA000204355_00080 | CDS | open | 90070-90276 | _na 68_aa | DUF1146 domain-containing protein | |
| 107 | GL883582.1 | GCA000204355_00081 | CDS | open | 90297-91445 | _na 382_aa | AI-2E family transporter | |
| 108 | GL883582.1 | GCA000204355_00082 | CDS | open | 91708-92130 | _na 140_aa | sepF | Cell division protein SepF |
| 109 | GL883582.1 | GCA000204355_00083 | CDS | open | 92133-92414 | _na 93_aa | YGGT family protein | |
| 110 | GL883582.1 | GCA000204355_00084 | CDS | open | 92419-93189 | _na 256_aa | RNA-binding S4 domain-containing protein | |
| 111 | GL883582.1 | GCA000204355_00085 | CDS | open | 93347-94231 | _na 294_aa | phnD | Solute-binding protein family 3/N-terminal domain-containing protein |
| 112 | GL883582.1 | GCA000204355_00092 | CDS | open | 95114-95461 | _na 115_aa | Bacteriocin transport accessory protein | |
| 113 | GL883582.1 | GCA000204355_00093 | CDS | open | 95676-96413 | _na 245_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 114 | GL883582.1 | GCA000204355_00094 | CDS | open | 96388-97947 | _na 519_aa | phnE | phosphonate ABC transporter%2C permease protein PhnE |
| 115 | GL883582.1 | GCA000204355_00095 | CDS | open | 97972-98481 | _na 169_aa | rimM | ribosome maturation factor RimM |
| 116 | GL883582.1 | GCA000204355_00096 | CDS | open | 98481-99212 | _na 243_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 117 | GL883582.1 | GCA000204355_00097 | CDS | open | 99243-100502 | _na 419_aa | rpsA | 30S ribosomal protein S1 |
| 118 | GL883582.1 | GCA000204355_00098 | CDS | open | 100605-101912 | _na 435_aa | der | ribosome biogenesis GTPase Der |
| 119 | GL883582.1 | GCA000204355_00099 | CDS | open | 102185-102910 | _na 241_aa | yugP | Neutral zinc metallopeptidase |
| 120 | GL883582.1 | GCA000204355_00100 | CDS | open | 103262-103615 | _na 117_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 121 | GL883582.1 | GCA000204355_00101 | CDS | open | 103620-104747 | _na 375_aa | alr | alanine racemase |
| 122 | GL883582.1 | GCA000204355_00102 | CDS | open | 104749-106917 | _na 722_aa | tex | S1 motif domain-containing protein |
| 123 | GL883582.1 | GCA000204355_00103 | CDS | open | 106929-108800 | _na 623_aa | Acyltransferase 3 domain-containing protein | |
| 124 | GL883582.1 | GCA000204355_00104 | CDS | open | 109225-110688 | _na 487_aa | gltX | glutamate--tRNA ligase |
| 125 | GL883582.1 | GCA000204355_00105 | CDS | open | 110942-111379 | _na 145_aa | rplM | 50S ribosomal protein L13 |
| 126 | GL883582.1 | GCA000204355_00106 | CDS | open | 111399-111791 | _na 130_aa | rpsI | 30S ribosomal protein S9 |
| 127 | GL883582.1 | GCA000204355_00107 | CDS | open | 111961-112581 | _na 206_aa | hypothetical protein | |
| 128 | GL883582.1 | GCA000204355_00108 | CDS | open | 112941-113603 | _na 220_aa | Peptidase C26 | |
| 129 | GL883582.1 | GCA000204355_00109 | CDS | open | 113872-114474 | _na 200_aa | rpsD | 30S ribosomal protein S4 |
| 130 | GL883582.1 | GCA000204355_00110 | CDS | open | 115162-116277 | _na 371_aa | ald | alanine dehydrogenase |
| 131 | GL883582.1 | GCA000204355_00111 | CDS | open | 116531-117901 | _na 456_aa | potE | Amino acid permease |
| 132 | GL883582.1 | GCA000204355_00112 | CDS | open | 117997-118542 | _na 181_aa | TNase-like domain-containing protein | |
| 133 | GL883582.1 | GCA000204355_00113 | CDS | open | 118885-120363 | _na 492_aa | Aldehyde dehydrogenase domain-containing protein | |
| 134 | GL883582.1 | GCA000204355_00114 | CDS | open | 120622-120804 | _na 60_aa | CRISPR-associated protein%2C Csn1 family | |
| 135 | GL883582.1 | GCA000204355_00115 | CDS | open | 121020-124796 | _na 1258_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 136 | GL883582.1 | GCA000204355_00116 | CDS | open | 124771-125646 | _na 291_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 137 | GL883582.1 | GCA000204355_00117 | CDS | open | 125651-125956 | _na 101_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 138 | GL883582.1 | GCA000204355_00118 | CDS | open | 125953-126627 | _na 224_aa | csn2 | type II-A CRISPR-associated protein Csn2 |
| 139 | GL883582.1 | GCA000204355_00119 | CDS | open | 127750-129111 | _na 453_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 140 | GL883582.1 | GCA000204355_00120 | CDS | open | 129120-130187 | _na 355_aa | ddlA | D-alanine--D-alanine ligase |
| 141 | GL883582.1 | GCA000204355_00121 | CDS | open | 130468-131277 | _na 269_aa | hypothetical protein | |
| 142 | GL883582.1 | GCA000204355_00122 | CDS | open | 131303-133303 | _na 666_aa | uvrB | excinuclease ABC subunit UvrB |
| 143 | GL883582.1 | GCA000204355_00123 | CDS | open | 133575-134474 | _na 299_aa | rluA | Pseudouridine synthase |
| 144 | GL883582.1 | GCA000204355_00124 | CDS | open | 134843-135709 | _na 288_aa | fba | class II fructose-1%2C6-bisphosphate aldolase |
| 145 | GL883582.1 | GCA000204355_00125 | CDS | open | 135778-136812 | _na 344_aa | frvX | M42 glutamyl aminopeptidase |
| 146 | GL883582.1 | GCA000204355_00126 | CDS | open | 137099-137713 | _na 204_aa | abpA | amylase-binding adhesin AbpA |
| 147 | GL883582.1 | GCA000204355_00127 | CDS | open | 137894-139051 | _na 385_aa | Major facilitator superfamily associated domain-containing protein | |
| 148 | GL883582.1 | GCA000204355_00128 | CDS | open | 139061-139753 | _na 230_aa | CAAX amino terminal protease family protein | |
| 149 | GL883582.1 | GCA000204355_00129 | CDS | open | 140140-141513 | _na 457_aa | gRS1 | glycine--tRNA ligase |
| 150 | GL883582.1 | GCA000204355_00130 | CDS | open | 141828-142304 | _na 158_aa | purE | N5-carboxyaminoimidazole ribonucleotide mutase |
| 151 | GL883582.1 | GCA000204355_00131 | CDS | open | 142301-143344 | _na 347_aa | purK | N5-carboxyaminoimidazole ribonucleotide synthase |
| 152 | GL883582.1 | GCA000204355_00132 | CDS | open | 143337-147014 | _na 1225_aa | purL2 | phosphoribosylformylglycinamidine synthase |
| 153 | GL883582.1 | GCA000204355_00133 | CDS | open | 147014-147715 | _na 233_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 154 | GL883582.1 | GCA000204355_00134 | CDS | open | 147708-149159 | _na 483_aa | purF | amidophosphoribosyltransferase |
| 155 | GL883582.1 | GCA000204355_00135 | CDS | open | 149159-150163 | _na 334_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 156 | GL883582.1 | GCA000204355_00136 | CDS | open | 150160-150723 | _na 187_aa | purN | phosphoribosylglycinamide formyltransferase |
| 157 | GL883582.1 | GCA000204355_00137 | CDS | open | 150720-152240 | _na 506_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 158 | GL883582.1 | GCA000204355_00138 | CDS | open | 152179-153477 | _na 432_aa | purD | Phosphoribosylamine--glycine ligase |
| 159 | GL883582.1 | GCA000204355_00139 | CDS | open | 153528-154832 | _na 434_aa | purB | adenylosuccinate lyase |
| 160 | GL883582.1 | GCA000204355_00140 | CDS | open | 154872-156527 | _na 551_aa | mIS1 | formate--tetrahydrofolate ligase |
| 161 | GL883582.1 | GCA000204355_00141 | CDS | open | 156777-161090 | _na 1437_aa | Serine protease | |
| 162 | GL883582.1 | GCA000204355_00142 | CDS | open | 161443-162729 | _na 428_aa | purA | adenylosuccinate synthase |
| 163 | GL883582.1 | GCA000204355_00143 | CDS | open | 163051-163299 | _na 82_aa | HTH cro/C1-type domain-containing protein | |
| 164 | GL883582.1 | GCA000204355_00144 | CDS | open | 163381-163959 | _na 192_aa | hypothetical protein | |
| 165 | GL883582.1 | GCA000204355_00145 | CDS | open | 164101-164862 | _na 253_aa | SEC10/PgrA surface exclusion domain-containing protein | |
| 166 | GL883582.1 | GCA000204355_00146 | CDS | open | 165033-166037 | _na 334_aa | hypothetical protein | |
| 167 | GL883582.1 | GCA000204355_00147 | CDS | open | 167154-168086 | _na 310_aa | HTH cro/C1-type domain-containing protein | |
| 168 | GL883582.1 | GCA000204355_00148 | CDS | open | 168311-169696 | _na 461_aa | lolE | Efflux ABC transporter%2C permease protein |
| 169 | GL883582.1 | GCA000204355_00149 | CDS | open | 169712-170971 | _na 419_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 170 | GL883582.1 | GCA000204355_00150 | CDS | open | 170985-171617 | _na 210_aa | lolD | ABC transporter domain-containing protein |
| 171 | GL883582.1 | GCA000204355_00151 | CDS | open | 171712-172743 | _na 343_aa | Aromatic amino acid beta-eliminating lyase/threonine aldolase domain-containing protein | |
| 172 | GL883582.1 | GCA000204355_00152 | CDS | open | 172799-173257 | _na 152_aa | rCL | Nucleoside 2-deoxyribosyltransferase |
| 173 | GL883582.1 | GCA000204355_00153 | CDS | open | 173422-175530 | _na 702_aa | yrdD | DNA topoisomerase |
| 174 | GL883582.1 | GCA000204355_00154 | CDS | open | 175673-176347 | _na 224_aa | cmk | (d)CMP kinase |
| 175 | GL883582.1 | GCA000204355_00155 | CDS | open | 176367-176954 | _na 195_aa | plsC | 1-acyl-sn-glycerol-3-phosphate acyltransferase |
| 176 | GL883582.1 | GCA000204355_00156 | CDS | open | 176956-177387 | _na 143_aa | fadM | Acyl-CoA thioester hydrolase%2C YbgC/YbaW family |
| 177 | GL883582.1 | GCA000204355_00157 | CDS | open | 177612-178763 | _na 383_aa | Aminotransferase class V domain-containing protein | |
| 178 | GL883582.1 | GCA000204355_00158 | CDS | open | 178753-180003 | _na 416_aa | thiI | putative tRNA sulfurtransferase |
| 179 | GL883582.1 | GCA000204355_00159 | CDS | open | 180024-181328 | _na 434_aa | trmFO | FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO |
| 180 | GL883582.1 | GCA000204355_00160 | CDS | open | 181408-182190 | _na 260_aa | codY | GTP-sensing pleiotropic transcriptional regulator CodY |
| 181 | GL883582.1 | GCA000204355_00161 | CDS | open | 182266-182649 | _na 127_aa | Fluoroacetyl-CoA-specific thioesterase-like domain-containing protein | |
| 182 | GL883582.1 | GCA000204355_00162 | CDS | open | 182668-183141 | _na 157_aa | yjhB | Nudix hydrolase domain-containing protein |
| 183 | GL883582.1 | GCA000204355_00163 | CDS | open | 183248-183430 | _na 60_aa | DUF2929 domain-containing protein | |
| 184 | GL883582.1 | GCA000204355_00164 | CDS | open | 183667-184551 | _na 294_aa | Nudix hydrolase domain-containing protein | |
| 185 | GL883582.1 | GCA000204355_00165 | CDS | open | 184579-185286 | _na 235_aa | DUF1275 domain-containing protein | |
| 186 | GL883582.1 | GCA000204355_00166 | CDS | open | 185462-186367 | _na 301_aa | xerD | Phage integrase SAM-like domain protein |
| 187 | GL883582.1 | GCA000204355_00167 | CDS | open | 186373-187074 | _na 233_aa | Segregation and condensation protein A | |
| 188 | GL883582.1 | GCA000204355_00168 | CDS | open | 187076-187624 | _na 182_aa | scpB | SMC-Scp complex subunit ScpB |
| 189 | GL883582.1 | GCA000204355_00169 | CDS | open | 187634-188365 | _na 243_aa | rsuA | Pseudouridine synthase |
| 190 | GL883582.1 | GCA000204355_00170 | CDS | open | 188385-189101 | _na 238_aa | ompR | Response regulator receiver domain protein |
| 191 | GL883582.1 | GCA000204355_00171 | CDS | open | 189113-190414 | _na 433_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 192 | GL883582.1 | GCA000204355_00172 | CDS | open | 190419-191147 | _na 242_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 193 | GL883582.1 | GCA000204355_00173 | CDS | open | 191227-192468 | _na 413_aa | Aminotransferase class I/classII large domain-containing protein | |
| 194 | GL883582.1 | GCA000204355_00174 | CDS | open | 192789-193997 | _na 402_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 195 | GL883582.1 | GCA000204355_00175 | CDS | open | 194020-196317 | _na 765_aa | lon | endopeptidase La |
| 196 | GL883582.1 | GCA000204355_00176 | CDS | open | 196320-196916 | _na 198_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 197 | GL883582.1 | GCA000204355_00177 | CDS | open | 197383-197655 | _na 90_aa | rpsP | 30S ribosomal protein S16 |
| 198 | GL883582.1 | GCA000204355_00178 | CDS | open | 197788-198432 | _na 214_aa | hisM | ABC transmembrane type-1 domain-containing protein |
| 199 | GL883582.1 | GCA000204355_00179 | CDS | open | 198436-199065 | _na 209_aa | glnQ | ABC transporter domain-containing protein |
| 200 | GL883582.1 | GCA000204355_00180 | CDS | open | 199078-199911 | _na 277_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 201 | GL883582.1 | GCA000204355_00181 | CDS | open | 200165-200410 | _na 81_aa | rpmE | type B 50S ribosomal protein L31 |
| 202 | GL883582.1 | GCA000204355_00182 | CDS | open | 200496-201074 | _na 192_aa | tdk | thymidine kinase |
| 203 | GL883582.1 | GCA000204355_00183 | CDS | open | 201089-202177 | _na 362_aa | prfA | peptide chain release factor 1 |
| 204 | GL883582.1 | GCA000204355_00184 | CDS | open | 202177-203019 | _na 280_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 205 | GL883582.1 | GCA000204355_00185 | CDS | open | 203604-205376 | _na 590_aa | oleate hydratase | |
| 206 | GL883582.1 | GCA000204355_00186 | CDS | open | 205516-206055 | _na 179_aa | tetR | Transcriptional regulator TetR C-terminal Firmicutes type domain-containing protein |
| 207 | GL883582.1 | GCA000204355_00187 | CDS | open | 206118-206861 | _na 247_aa | DUF4336 domain-containing protein | |
| 208 | GL883582.1 | GCA000204355_00188 | CDS | open | 206893-207435 | _na 180_aa | Phosphopentomutase | |
| 209 | GL883582.1 | GCA000204355_00189 | CDS | open | 207825-208586 | _na 253_aa | Cof-like hydrolase | |
| 210 | GL883582.1 | GCA000204355_00190 | CDS | open | 208706-209650 | _na 314_aa | HTH lacI-type domain-containing protein | |
| 211 | GL883582.1 | GCA000204355_00191 | CDS | open | 209806-210075 | _na 89_aa | insH | Transposase InsH N-terminal domain-containing protein |
| 212 | GL883582.1 | GCA000204355_00192 | CDS | open | 210191-211093 | _na 300_aa | IS1182 family transposase | |
| 213 | GL883582.1 | GCA000204355_00193 | CDS | open | 211244-211876 | _na 210_aa | lexA | HTH cro/C1-type domain-containing protein |
| 214 | GL883582.1 | GCA000204355_00194 | CDS | open | 212428-213114 | _na 228_aa | gpmA | 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase |
| 215 | GL883582.1 | GCA000204355_00195 | CDS | open | 213187-213879 | _na 230_aa | Lipoprotein | |
| 216 | GL883582.1 | GCA000204355_00196 | CDS | open | 213942-216278 | _na 778_aa | recD | ATP-dependent RecD2 DNA helicase |
| 217 | GL883582.1 | GCA000204355_00197 | CDS | open | 216552-217328 | _na 258_aa | Nif3-like dinuclear metal center hexameric protein | |
| 218 | GL883582.1 | GCA000204355_00198 | CDS | open | 217344-217733 | _na 129_aa | mntR | transcriptional regulator MntR |
| 219 | GL883582.1 | GCA000204355_00199 | CDS | open | 217746-218678 | _na 310_aa | thyA | thymidylate synthase |
| 220 | GL883582.1 | GCA000204355_00200 | CDS | open | 218689-219180 | _na 163_aa | Dihydrofolate reductase | |
| 221 | GL883582.1 | GCA000204355_00201 | CDS | open | 219184-220023 | _na 279_aa | degV | EDD domain protein%2C DegV family |
| 222 | GL883582.1 | GCA000204355_00202 | CDS | open | 220039-220293 | _na 84_aa | ireB | IreB family regulatory phosphoprotein |
| 223 | GL883582.1 | GCA000204355_00203 | CDS | open | 220294-220722 | _na 142_aa | ruvX | Holliday junction resolvase RuvX |
| 224 | GL883582.1 | GCA000204355_00204 | CDS | open | 220747-221052 | _na 101_aa | UPF0473 protein HMPREF3186_01678 | |
| 225 | GL883582.1 | GCA000204355_00205 | CDS | open | 221056-222186 | _na 376_aa | Endolytic murein transglycosylase | |
| 226 | GL883582.1 | GCA000204355_00206 | CDS | open | 222354-223103 | _na 249_aa | Ribosomal RNA small subunit methyltransferase E | |
| 227 | GL883582.1 | GCA000204355_00207 | CDS | open | 223116-223439 | _na 107_aa | divIVA | Cell cycle protein GpsB |
| 228 | GL883582.1 | GCA000204355_00208 | CDS | open | 223475-224035 | _na 186_aa | Flavoprotein domain-containing protein | |
| 229 | GL883582.1 | GCA000204355_00209 | CDS | open | 224104-224649 | _na 181_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 230 | GL883582.1 | GCA000204355_00210 | CDS | open | 224682-227045 | _na 787_aa | priA | primosomal protein N' |
| 231 | GL883582.1 | GCA000204355_00211 | CDS | open | 227209-227532 | _na 107_aa | ylxM | YlxM family DNA-binding protein |
| 232 | GL883582.1 | GCA000204355_00212 | CDS | open | 227544-228896 | _na 450_aa | ffh | signal recognition particle protein |
| 233 | GL883582.1 | GCA000204355_00213 | CDS | open | 228903-229376 | _na 157_aa | trmL | tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL |
| 234 | GL883582.1 | GCA000204355_00214 | CDS | open | 229568-230041 | _na 157_aa | ybeY | rRNA maturation RNase YbeY |
| 235 | GL883582.1 | GCA000204355_00215 | CDS | open | 230044-230952 | _na 302_aa | era | GTPase Era |
| 236 | GL883582.1 | GCA000204355_00216 | CDS | open | 231109-231666 | _na 185_aa | Recombination protein O C terminal | |
| 237 | GL883582.1 | GCA000204355_00217 | CDS | open | 231680-232474 | _na 264_aa | racE | glutamate racemase |
| 238 | GL883582.1 | GCA000204355_00218 | CDS | open | 232484-233068 | _na 194_aa | XTP/dITP diphosphatase | |
| 239 | GL883582.1 | GCA000204355_00219 | CDS | open | 233058-233270 | _na 70_aa | Ferredoxin | |
| 240 | GL883582.1 | GCA000204355_00220 | CDS | open | 233472-235589 | _na 705_aa | ftsK | FtsK domain-containing protein |
| 241 | GL883582.1 | GCA000204355_00221 | CDS | open | 235654-236418 | _na 254_aa | hypothetical protein | |
| 242 | GL883582.1 | GCA000204355_00222 | CDS | open | 236542-237111 | _na 189_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 243 | GL883582.1 | GCA000204355_00223 | CDS | open | 237178-237717 | _na 179_aa | grpB | GrpB family protein |
| 244 | GL883582.1 | GCA000204355_00224 | CDS | open | 237738-237980 | _na 80_aa | Permease | |
| 245 | GL883582.1 | GCA000204355_00225 | CDS | open | 238066-239112 | _na 348_aa | xerS | tyrosine recombinase XerS |
| 246 | GL883582.1 | GCA000204355_00226 | CDS | open | 239592-239780 | _na 62_aa | rpmB | 50S ribosomal protein L28 |
| 247 | GL883582.1 | GCA000204355_00227 | CDS | open | 239898-241298 | _na 466_aa | Gluconate permease | |
| 248 | GL883582.1 | GCA000204355_00228 | CDS | open | 241378-241920 | _na 180_aa | Phosphopentomutase | |
| 249 | GL883582.1 | GCA000204355_00229 | CDS | open | 241987-242544 | _na 185_aa | efp | elongation factor P |
| 250 | GL883582.1 | GCA000204355_00230 | CDS | open | 242701-243342 | _na 213_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 251 | GL883582.1 | GCA000204355_00231 | CDS | open | 243355-246222 | _na 955_aa | Peptidase M16C associated domain-containing protein | |
| 252 | GL883582.1 | GCA000204355_00232 | CDS | open | 246247-246759 | _na 170_aa | apt | adenine phosphoribosyltransferase |
| 253 | GL883582.1 | GCA000204355_00233 | CDS | open | 247039-247416 | _na 125_aa | FeS cluster biogenesis domain-containing protein | |
| 254 | GL883582.1 | GCA000204355_00234 | CDS | open | 247483-248016 | _na 177_aa | VanZ-like domain-containing protein | |
| 255 | GL883582.1 | GCA000204355_00235 | CDS | open | 248101-252321 | _na 1406_aa | nEAT | LPXTG-motif cell wall anchor domain protein |
| 256 | GL883582.1 | GCA000204355_00236 | CDS | open | 252538-253164 | _na 208_aa | Thioredoxin | |
| 257 | GL883582.1 | GCA000204355_00237 | CDS | open | 253185-255446 | _na 753_aa | recJ | single-stranded-DNA-specific exonuclease RecJ |
| 258 | GL883582.1 | GCA000204355_00238 | CDS | open | 255480-255758 | _na 92_aa | Lipopolysaccharide assembly protein A domain-containing protein | |
| 259 | GL883582.1 | GCA000204355_00239 | CDS | open | 255758-257749 | _na 663_aa | ligA | NAD-dependent DNA ligase LigA |
| 260 | GL883582.1 | GCA000204355_00240 | CDS | open | 257756-259942 | _na 728_aa | uvrD | DNA 3'-5' helicase |
| 261 | GL883582.1 | GCA000204355_00241 | CDS | open | 260178-261317 | _na 379_aa | recA | recombinase RecA |
| 262 | GL883582.1 | GCA000204355_00242 | CDS | open | 261334-262248 | _na 304_aa | ycgM | Fumarylacetoacetase-like C-terminal domain-containing protein |
| 263 | GL883582.1 | GCA000204355_00243 | CDS | open | 262380-264128 | _na 582_aa | uvrC | excinuclease ABC subunit UvrC |
| 264 | GL883582.1 | GCA000204355_00244 | CDS | open | 264358-266280 | _na 640_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 265 | GL883582.1 | GCA000204355_00245 | CDS | open | 266270-267016 | _na 248_aa | PPM-type phosphatase domain-containing protein | |
| 266 | GL883582.1 | GCA000204355_00246 | CDS | open | 266994-268127 | _na 377_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 267 | GL883582.1 | GCA000204355_00247 | CDS | open | 268121-269446 | _na 441_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 268 | GL883582.1 | GCA000204355_00248 | CDS | open | 269439-270401 | _na 320_aa | fmt | methionyl-tRNA formyltransferase |
| 269 | GL883582.1 | GCA000204355_00249 | CDS | open | 270490-270996 | _na 168_aa | Methylated-DNA--[protein]-cysteine S-methyltransferase | |
| 270 | GL883582.1 | GCA000204355_00250 | CDS | open | 271079-271534 | _na 151_aa | lspA | signal peptidase II |
| 271 | GL883582.1 | GCA000204355_00251 | CDS | open | 271548-272192 | _na 214_aa | nth | endonuclease III |
| 272 | GL883582.1 | GCA000204355_00252 | CDS | open | 272173-272694 | _na 173_aa | dnaD | DnaD N-terminal domain-containing protein |
| 273 | GL883582.1 | GCA000204355_00253 | CDS | open | 272704-273990 | _na 428_aa | asnS | asparagine--tRNA ligase |
| 274 | GL883582.1 | GCA000204355_00254 | CDS | open | 274121-275971 | _na 616_aa | Exonuclease domain-containing protein | |
| 275 | GL883582.1 | GCA000204355_00255 | CDS | open | 276000-277160 | _na 386_aa | CCA tRNA nucleotidyltransferase | |
| 276 | GL883582.1 | GCA000204355_00256 | CDS | open | 277219-278403 | _na 394_aa | ackA | Acetate kinase |
| 277 | GL883582.1 | GCA000204355_00257 | CDS | open | 278608-279723 | _na 371_aa | PASTA domain-containing protein | |
| 278 | GL883582.1 | GCA000204355_00258 | CDS | open | 280065-281462 | _na 465_aa | sufB | Fe-S cluster assembly protein SufB |
| 279 | GL883582.1 | GCA000204355_00259 | CDS | open | 281480-281908 | _na 142_aa | sufU | Fe-S cluster assembly sulfur transfer protein SufU |
| 280 | GL883582.1 | GCA000204355_00260 | CDS | open | 281898-283127 | _na 409_aa | csdA | Cysteine desulfurase |
| 281 | GL883582.1 | GCA000204355_00261 | CDS | open | 283130-284416 | _na 428_aa | sufD | Fe-S cluster assembly protein SufD |
| 282 | GL883582.1 | GCA000204355_00262 | CDS | open | 284418-285158 | _na 246_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 283 | GL883582.1 | GCA000204355_00263 | CDS | open | 285457-286356 | _na 299_aa | Peptidase C39-like domain-containing protein | |
| 284 | GL883582.1 | GCA000204355_00264 | CDS | open | 286368-287207 | _na 279_aa | eamA | EamA domain-containing protein |
| 285 | GL883582.1 | GCA000204355_00265 | CDS | open | 287223-287615 | _na 130_aa | Glycerate kinase | |
| 286 | GL883582.1 | GCA000204355_00266 | CDS | open | 287557-288369 | _na 270_aa | Glycerate kinase | |
| 287 | GL883582.1 | GCA000204355_00267 | CDS | open | 288884-289225 | _na 113_aa | Polyprenyl synthetase | |
| 288 | GL883582.1 | GCA000204355_00268 | CDS | open | 289231-289743 | _na 170_aa | Geranyltranstransferase | |
| 289 | GL883582.1 | GCA000204355_00269 | CDS | open | 289736-289936 | _na 66_aa | xseB | exodeoxyribonuclease VII small subunit |
| 290 | GL883582.1 | GCA000204355_00270 | CDS | open | 289936-291195 | _na 419_aa | xseA | exodeoxyribonuclease VII large subunit |
| 291 | GL883582.1 | GCA000204355_00271 | CDS | open | 291209-291604 | _na 131_aa | nusB | transcription antitermination factor NusB |
| 292 | GL883582.1 | GCA000204355_00272 | CDS | open | 291619-291924 | _na 101_aa | yloU | Asp23/Gls24 family envelope stress response protein |
| 293 | GL883582.1 | GCA000204355_00273 | CDS | open | 292108-294729 | _na 873_aa | alaS | alanine--tRNA ligase |
| 294 | GL883582.1 | GCA000204355_00274 | CDS | open | 295028-295396 | _na 122_aa | yabR | S1 motif domain-containing protein |
| 295 | GL883582.1 | GCA000204355_00275 | CDS | open | 295386-297362 | _na 658_aa | tkt | transketolase |
| 296 | GL883582.1 | GCA000204355_00276 | CDS | open | 297379-297975 | _na 198_aa | recR | recombination mediator RecR |
| 297 | GL883582.1 | GCA000204355_00277 | CDS | open | 297977-298294 | _na 105_aa | ybaB | YbaB/EbfC family nucleoid-associated protein |
| 298 | GL883582.1 | GCA000204355_00278 | CDS | open | 298411-300126 | _na 571_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 299 | GL883582.1 | GCA000204355_00279 | CDS | open | 300225-301202 | _na 325_aa | DUF4878 domain-containing protein | |
| 300 | GL883582.1 | GCA000204355_00280 | CDS | open | 301499-301942 | _na 147_aa | DUF4878 domain-containing protein | |
| 301 | GL883582.1 | GCA000204355_00281 | CDS | open | 302011-302331 | _na 106_aa | DUF3899 domain-containing protein | |
| 302 | GL883582.1 | GCA000204355_00282 | CDS | open | 302491-303570 | _na 359_aa | potD | ABC transporter%2C solute-binding protein |
| 303 | GL883582.1 | GCA000204355_00283 | CDS | open | 303572-304372 | _na 266_aa | potC | ABC transmembrane type-1 domain-containing protein |
| 304 | GL883582.1 | GCA000204355_00284 | CDS | open | 304372-305190 | _na 272_aa | potB | ABC transmembrane type-1 domain-containing protein |
| 305 | GL883582.1 | GCA000204355_00285 | CDS | open | 305193-306281 | _na 362_aa | potA | Putrescine/spermidine ABC transporter ATPase protein |
| 306 | GL883582.1 | GCA000204355_00286 | CDS | open | 306292-306837 | _na 181_aa | HTH cro/C1-type domain-containing protein | |
| 307 | GL883582.1 | GCA000204355_00287 | CDS | open | 307176-308027 | _na 283_aa | Pseudouridine synthase RsuA/RluA-like domain-containing protein | |
| 308 | GL883582.1 | GCA000204355_00288 | CDS | open | 308089-308334 | _na 81_aa | UPF0154 protein HMPREF0428_00281 | |
| 309 | GL883582.1 | GCA000204355_00289 | CDS | open | 308337-308546 | _na 69_aa | ynzC | UPF0291 protein HMPREF3186_01156 |
| 310 | GL883582.1 | GCA000204355_00290 | CDS | open | 308551-309108 | _na 185_aa | frr | ribosome recycling factor |
| 311 | GL883582.1 | GCA000204355_00291 | CDS | open | 309133-309846 | _na 237_aa | pyrH | UMP kinase |
| 312 | GL883582.1 | GCA000204355_00292 | CDS | open | 309966-310853 | _na 295_aa | tsf | translation elongation factor Ts |
| 313 | GL883582.1 | GCA000204355_00293 | CDS | open | 310910-311647 | _na 245_aa | rpsB | 30S ribosomal protein S2 |
| 314 | GL883582.1 | GCA000204355_00294 | CDS | open | 312012-313055 | _na 347_aa | znuA | ABC transporter%2C substrate-binding protein |
| 315 | GL883582.1 | GCA000204355_00295 | CDS | open | 313189-313899 | _na 236_aa | znuC | ABC transporter domain-containing protein |
| 316 | GL883582.1 | GCA000204355_00296 | CDS | open | 313892-314686 | _na 264_aa | znuB | ABC 3 transport family protein |
| 317 | GL883582.1 | GCA000204355_00297 | CDS | open | 314846-316540 | _na 564_aa | ezrA | Septation ring formation regulator EzrA |
| 318 | GL883582.1 | GCA000204355_00298 | CDS | open | 316846-317313 | _na 155_aa | msrC | GAF domain-containing protein |
| 319 | GL883582.1 | GCA000204355_00299 | CDS | open | 317364-318962 | _na 532_aa | uup | ABC transporter domain-containing protein |
| 320 | GL883582.1 | GCA000204355_00300 | CDS | open | 319143-319511 | _na 122_aa | rbfA | 30S ribosome-binding factor RbfA |
| 321 | GL883582.1 | GCA000204355_00301 | CDS | open | 319524-321578 | _na 684_aa | infB | translation initiation factor IF-2 |
| 322 | GL883582.1 | GCA000204355_00302 | CDS | open | 321578-321889 | _na 103_aa | rpl7Ae | Ribosomal protein eL8/eL30/eS12/Gadd45 domain-containing protein |
| 323 | GL883582.1 | GCA000204355_00303 | CDS | open | 321889-322176 | _na 95_aa | rnpM | RNase P modulator RnpM |
| 324 | GL883582.1 | GCA000204355_00304 | CDS | open | 322190-323221 | _na 343_aa | nusA | Transcription termination/antitermination protein NusA |
| 325 | GL883582.1 | GCA000204355_00305 | CDS | open | 323242-323706 | _na 154_aa | rimP | ribosome maturation factor RimP |
| 326 | GL883582.1 | GCA000204355_00306 | CDS | open | 323840-324223 | _na 127_aa | gloA | Aldoketomutase |
| 327 | GL883582.1 | GCA000204355_00307 | CDS | open | 324249-325106 | _na 285_aa | degV | EDD domain protein%2C DegV family |
| 328 | GL883582.1 | GCA000204355_00308 | CDS | open | 325144-325689 | _na 181_aa | nusG | transcription termination/antitermination protein NusG |
| 329 | GL883582.1 | GCA000204355_00309 | CDS | open | 325701-325874 | _na 57_aa | secE | preprotein translocase subunit SecE |
| 330 | GL883582.1 | GCA000204355_00310 | CDS | open | 326060-326911 | _na 283_aa | folD | Bifunctional protein FolD |
| 331 | GL883582.1 | GCA000204355_00311 | CDS | open | 326895-327518 | _na 207_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 332 | GL883582.1 | GCA000204355_00312 | CDS | open | 327526-329919 | _na 797_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 333 | GL883582.1 | GCA000204355_00313 | CDS | open | 329932-330954 | _na 340_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 334 | GL883582.1 | GCA000204355_00314 | CDS | open | 331450-333162 | _na 570_aa | ptsA | Phosphoenolpyruvate-protein phosphotransferase |
| 335 | GL883582.1 | GCA000204355_00315 | CDS | open | 333164-333427 | _na 87_aa | ptsH | phosphocarrier protein HPr |
| 336 | GL883582.1 | GCA000204355_00316 | CDS | open | 333766-334530 | _na 254_aa | queH | Epoxyqueuosine reductase QueH |
| 337 | GL883582.1 | GCA000204355_00317 | CDS | open | 334719-335720 | _na 333_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 338 | GL883582.1 | GCA000204355_00318 | CDS | open | 335740-336321 | _na 193_aa | ruvA | Holliday junction branch migration protein RuvA |
| 339 | GL883582.1 | GCA000204355_00319 | CDS | open | 336457-337344 | _na 295_aa | phnD | Solute-binding protein family 3/N-terminal domain-containing protein |
| 340 | GL883582.1 | GCA000204355_00322 | CDS | open | 337879-342999 | _na 1706_aa | aprE | C5a peptidase |
| 341 | GL883582.1 | GCA000204355_00323 | CDS | open | 343138-343521 | _na 127_aa | VOC domain-containing protein | |
| 342 | GL883582.1 | GCA000204355_00324 | CDS | open | 343514-344275 | _na 253_aa | cutC | PF03932 family protein CutC |
| 343 | GL883582.1 | GCA000204355_00325 | CDS | open | 344413-350586 | _na 2057_aa | Serine protease | |
| 344 | GL883582.1 | GCA000204355_00326 | CDS | open | 350905-352644 | _na 579_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 345 | GL883582.1 | GCA000204355_00327 | CDS | open | 352631-354391 | _na 586_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 346 | GL883582.1 | GCA000204355_00328 | CDS | open | 354392-355138 | _na 248_aa | sIR2 | NAD-dependent protein deacylase |
| 347 | GL883582.1 | GCA000204355_00329 | CDS | open | 355219-357783 | _na 854_aa | secA | preprotein translocase subunit SecA |
| 348 | GL883582.1 | GCA000204355_00330 | CDS | open | 358019-359005 | _na 328_aa | yobV | WYL domain-containing protein |
| 349 | GL883582.1 | GCA000204355_00331 | CDS | open | 359046-359381 | _na 111_aa | DNA-binding protein | |
| 350 | GL883582.1 | GCA000204355_00332 | CDS | open | 359631-362363 | _na 910_aa | ileS | isoleucine--tRNA ligase |
| 351 | GL883582.1 | GCA000204355_00333 | CDS | open | 362752-363396 | _na 214_aa | yunB | Sporulation protein YunB |
| 352 | GL883582.1 | GCA000204355_00334 | CDS | open | 363581-364630 | _na 349_aa | pfoR | Phosphotransferase system EIIC domain-containing protein |
| 353 | GL883582.1 | GCA000204355_00335 | CDS | open | 364786-365607 | _na 273_aa | BPL/LPL catalytic domain-containing protein | |
| 354 | GL883582.1 | GCA000204355_00336 | CDS | open | 365707-366435 | _na 242_aa | DUF554 domain-containing protein | |
| 355 | GL883582.1 | GCA000204355_00337 | CDS | open | 366437-367090 | _na 217_aa | murI | Glutamate racemase |
| 356 | GL883582.1 | GCA000204355_00338 | CDS | open | 367341-369923 | _na 860_aa | clpB | ATP-dependent chaperone ClpB |
| 357 | GL883582.1 | GCA000204355_00339 | CDS | open | 370611-370793 | _na 60_aa | hypothetical protein | |
| 358 | GL883582.1 | GCA000204355_00340 | CDS | open | 370991-371752 | _na 253_aa | nfnB | Nitroreductase domain-containing protein |
| 359 | GL883582.1 | GCA000204355_00341 | CDS | open | 371847-372314 | _na 155_aa | N-acetyltransferase domain-containing protein | |
| 360 | GL883582.1 | GCA000204355_00342 | CDS | open | 372356-373048 | _na 230_aa | ybbA | Esterase |
| 361 | GL883582.1 | GCA000204355_00343 | CDS | open | 373469-374617 | _na 382_aa | mannitol-1-phosphate 5-dehydrogenase | |
| 362 | GL883582.1 | GCA000204355_00344 | CDS | open | 374649-375092 | _na 147_aa | Mannitol-specific phosphotransferase enzyme IIA component | |
| 363 | GL883582.1 | GCA000204355_00345 | CDS | open | 375321-377303 | _na 660_aa | PTS system EIIA component | |
| 364 | GL883582.1 | GCA000204355_00346 | CDS | open | 377444-378877 | _na 477_aa | PTS system mannitol-specific EIICB component | |
| 365 | GL883582.1 | GCA000204355_00347 | CDS | open | 379141-379707 | _na 188_aa | DUF5067 domain-containing protein | |
| 366 | GL883582.1 | GCA000204355_00348 | CDS | open | 379779-380945 | _na 388_aa | hypothetical protein | |
| 367 | GL883582.1 | GCA000204355_00349 | CDS | open | 381055-381444 | _na 129_aa | hypothetical protein | |
| 368 | GL883582.1 | GCA000204355_00350 | CDS | open | 381463-382653 | _na 396_aa | Cytosine-specific methyltransferase | |
| 369 | GL883582.1 | GCA000204355_00351 | CDS | open | 383034-384491 | _na 485_aa | Rad50/SbcC-type AAA domain-containing protein | |
| 370 | GL883582.1 | GCA000204355_00352 | CDS | open | 384488-385483 | _na 331_aa | CD-NTase associated protein 4-like DNA endonuclease domain-containing protein | |
| 371 | GL883582.1 | GCA000204355_00353 | CDS | open | 385689-386075 | _na 128_aa | DUF4391 domain-containing protein | |
| 372 | GL883582.1 | GCA000204355_00354 | CDS | open | 386784-387338 | _na 184_aa | Cthe-2314-like HEPN domain-containing protein | |
| 373 | GL883582.1 | GCA000204355_00355 | CDS | open | 387480-388019 | _na 179_aa | hypothetical protein | |
| 374 | GL883582.1 | GCA000204355_00356 | CDS | open | 388356-388838 | _na 160_aa | N-acetyltransferase domain-containing protein | |
| 375 | GL883582.1 | GCA000204355_00357 | CDS | open | 388942-389436 | _na 164_aa | hypothetical protein | |
| 376 | GL883582.1 | GCA000204355_00358 | CDS | open | 389624-390118 | _na 164_aa | Addiction module antitoxin%2C RelB/DinJ family | |
| 377 | GL883582.1 | GCA000204355_00359 | CDS | open | 390409-391395 | _na 328_aa | Alpha/beta hydrolase fold-3 domain-containing protein | |
| 378 | GL883582.1 | GCA000204355_00360 | CDS | open | 391631-391762 | _na 43_aa | hypothetical protein | |
| 379 | GL883582.1 | GCA000204355_00361 | CDS | open | 392272-393699 | _na 475_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 380 | GL883582.1 | GCA000204355_00362 | CDS | open | 393713-395170 | _na 485_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 381 | GL883582.1 | GCA000204355_00363 | CDS | open | 395188-395478 | _na 96_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 382 | GL883582.1 | GCA000204355_00364 | CDS | open | 396048-396263 | _na 71_aa | Isochorismatase-like domain-containing protein | |
| 383 | GL883582.1 | GCA000204355_00365 | CDS | open | 396354-396572 | _na 72_aa | Isochorismatase-like domain-containing protein | |
| 384 | GL883582.1 | GCA000204355_00366 | CDS | open | 397197-398132 | _na 311_aa | prmA | 50S ribosomal protein L11 methyltransferase |
| 385 | GL883582.1 | GCA000204355_00367 | CDS | open | 398257-398523 | _na 88_aa | hypothetical protein | |
| 386 | GL883582.1 | GCA000204355_00368 | CDS | open | 398798-399241 | _na 147_aa | FG-GAP repeat protein | |
| 387 | GL883582.1 | GCA000204355_00369 | CDS | open | 399461-399730 | _na 89_aa | hypothetical protein | |
| 388 | GL883582.1 | GCA000204355_00370 | CDS | open | 399794-400474 | _na 226_aa | Transcriptional regulatory protein | |
| 389 | GL883582.1 | GCA000204355_00371 | CDS | open | 400475-402073 | _na 532_aa | histidine kinase | |
| 390 | GL883582.1 | GCA000204355_00372 | CDS | open | 402450-403643 | _na 397_aa | potE | Amino acid permease |
| 391 | GL883582.1 | GCA000204355_00373 | CDS | open | 404041-406284 | _na 747_aa | FG-GAP repeat protein | |
| 392 | GL883582.1 | GCA000204355_00374 | CDS | open | 406412-407335 | _na 307_aa | trxB | thioredoxin-disulfide reductase |
| 393 | GL883582.1 | GCA000204355_00375 | CDS | open | 407353-408156 | _na 267_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 394 | GL883582.1 | GCA000204355_00376 | CDS | open | 408158-409102 | _na 314_aa | hprK | HPr(Ser) kinase/phosphatase |
| 395 | GL883582.1 | GCA000204355_00377 | CDS | open | 409116-409508 | _na 130_aa | Phage holin family protein | |
| 396 | GL883582.1 | GCA000204355_00378 | CDS | open | 409591-410517 | _na 308_aa | pPX1 | manganese-dependent inorganic pyrophosphatase |
| 397 | GL883582.1 | GCA000204355_00379 | CDS | open | 410599-411087 | _na 162_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 398 | GL883582.1 | GCA000204355_00380 | CDS | open | 411308-412210 | _na 300_aa | yihY | YihY family protein |
| 399 | GL883582.1 | GCA000204355_00381 | CDS | open | 412215-412463 | _na 82_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 400 | GL883582.1 | GCA000204355_00382 | CDS | open | 412862-413440 | _na 192_aa | Prepilin-type cleavage/methylation N-terminal domain protein | |
| 401 | GL883582.1 | GCA000204355_00383 | CDS | open | 413418-413702 | _na 94_aa | Prepilin-type cleavage/methylation N-terminal domain protein | |
| 402 | GL883582.1 | GCA000204355_00384 | CDS | open | 413692-414132 | _na 146_aa | Prepilin-type cleavage/methylation N-terminal domain protein | |
| 403 | GL883582.1 | GCA000204355_00385 | CDS | open | 414107-414439 | _na 110_aa | comGC | competence type IV pilus major pilin ComGC |
| 404 | GL883582.1 | GCA000204355_00386 | CDS | open | 414450-415496 | _na 348_aa | comGB | competence type IV pilus assembly protein ComGB |
| 405 | GL883582.1 | GCA000204355_00387 | CDS | open | 415471-416466 | _na 331_aa | comGA | competence type IV pilus ATPase ComGA |
| 406 | GL883582.1 | GCA000204355_00388 | CDS | open | 416582-416944 | _na 120_aa | HTH cro/C1-type domain-containing protein | |
| 407 | GL883582.1 | GCA000204355_00389 | CDS | open | 417155-417922 | _na 255_aa | tcdA | THIF-type NAD/FAD binding fold domain-containing protein |
| 408 | GL883582.1 | GCA000204355_00391 | CDS | open | 418350-421178 | _na 942_aa | uvrA | excinuclease ABC subunit UvrA |
| 409 | GL883582.1 | GCA000204355_00392 | CDS | open | 421455-422237 | _na 260_aa | DUF4037 domain-containing protein | |
| 410 | GL883582.1 | GCA000204355_00393 | CDS | open | 422408-424141 | _na 577_aa | cydC | thiol reductant ABC exporter subunit CydC |
| 411 | GL883582.1 | GCA000204355_00394 | CDS | open | 424131-425795 | _na 554_aa | cydD | thiol reductant ABC exporter subunit CydD |
| 412 | GL883582.1 | GCA000204355_00395 | CDS | open | 425849-426877 | _na 342_aa | cydB | cytochrome d ubiquinol oxidase subunit II |
| 413 | GL883582.1 | GCA000204355_00396 | CDS | open | 426879-428261 | _na 460_aa | appC | Bacterial cytochrome ubiquinol oxidase |
| 414 | GL883582.1 | GCA000204355_00397 | CDS | open | 428476-428829 | _na 117_aa | DUF1634 domain-containing protein | |
| 415 | GL883582.1 | GCA000204355_00398 | CDS | open | 428831-429679 | _na 282_aa | tauE | putative membrane transporter protein |
| 416 | GL883582.1 | GCA000204355_00399 | CDS | open | 429691-430323 | _na 210_aa | thiamine diphosphokinase | |
| 417 | GL883582.1 | GCA000204355_00400 | CDS | open | 430323-430967 | _na 214_aa | rpe | ribulose-phosphate 3-epimerase |
| 418 | GL883582.1 | GCA000204355_00401 | CDS | open | 430969-431850 | _na 293_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 419 | GL883582.1 | GCA000204355_00402 | CDS | open | 431884-433584 | _na 566_aa | recN | DNA repair protein RecN |
| 420 | GL883582.1 | GCA000204355_00403 | CDS | open | 433596-434405 | _na 269_aa | yqxC | Ribosomal RNA large subunit methyltransferase J |
| 421 | GL883582.1 | GCA000204355_00404 | CDS | open | 434655-437048 | _na 797_aa | glgP | Alpha-1%2C4 glucan phosphorylase |
| 422 | GL883582.1 | GCA000204355_00405 | CDS | open | 437073-438491 | _na 472_aa | glgA | glycogen synthase GlgA |
| 423 | GL883582.1 | GCA000204355_00406 | CDS | open | 438636-439748 | _na 370_aa | glgD | glucose-1-phosphate adenylyltransferase subunit GlgD |
| 424 | GL883582.1 | GCA000204355_00407 | CDS | open | 439750-440922 | _na 390_aa | glgC | glucose-1-phosphate adenylyltransferase |
| 425 | GL883582.1 | GCA000204355_00408 | CDS | open | 440950-442803 | _na 617_aa | glgB | 1%2C4-alpha-glucan branching protein GlgB |
| 426 | GL883582.1 | GCA000204355_00409 | CDS | open | 443136-444986 | _na 616_aa | Glycosyl hydrolase family 13 catalytic domain-containing protein | |
| 427 | GL883582.1 | GCA000204355_00410 | CDS | open | 445175-445783 | _na 202_aa | IS3 family transposase | |
| 428 | GL883582.1 | GCA000204355_00411 | CDS | open | 446794-449484 | _na 896_aa | ppc | phosphoenolpyruvate carboxylase |
| 429 | GL883582.1 | GCA000204355_00412 | CDS | open | 449846-452293 | _na 815_aa | gyrA | DNA gyrase subunit A |
| 430 | GL883582.1 | GCA000204355_00413 | CDS | open | 452310-454226 | _na 638_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 431 | GL883582.1 | GCA000204355_00414 | CDS | open | 454268-455404 | _na 378_aa | recF | DNA replication/repair protein RecF |
| 432 | GL883582.1 | GCA000204355_00415 | CDS | open | 455394-455609 | _na 71_aa | yaaA | S4 domain-containing protein YaaA |
| 433 | GL883582.1 | GCA000204355_00416 | CDS | open | 455987-456805 | _na 272_aa | Phosphotransferase enzyme family | |
| 434 | GL883582.1 | GCA000204355_00417 | CDS | open | 456934-457293 | _na 119_aa | rplT | 50S ribosomal protein L20 |
| 435 | GL883582.1 | GCA000204355_00418 | CDS | open | 457357-457551 | _na 64_aa | rpmI | 50S ribosomal protein L35 |
| 436 | GL883582.1 | GCA000204355_00419 | CDS | open | 457578-458105 | _na 175_aa | infC | translation initiation factor IF-3 |
| 437 | GL883582.1 | GCA000204355_00420 | CDS | open | 458341-462021 | _na 1226_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 438 | GL883582.1 | GCA000204355_00421 | CDS | open | 462092-465913 | _na 1273_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 439 | GL883582.1 | GCA000204355_00422 | CDS | open | 466064-466660 | _na 198_aa | rsmC | Methyltransferase small domain-containing protein |
| 440 | GL883582.1 | GCA000204355_00423 | CDS | open | 466814-467176 | _na 120_aa | rplL | 50S ribosomal protein L7/L12 |
| 441 | GL883582.1 | GCA000204355_00424 | CDS | open | 467227-467727 | _na 166_aa | rplJ | 50S ribosomal protein L10 |
| 442 | GL883582.1 | GCA000204355_00425 | CDS | open | 467976-468713 | _na 245_aa | HTH merR-type domain-containing protein | |
| 443 | GL883582.1 | GCA000204355_00426 | CDS | open | 468842-469369 | _na 175_aa | queT | QueT transporter family protein |
| 444 | GL883582.1 | GCA000204355_00427 | CDS | open | 469741-469983 | _na 80_aa | rpsT | 30S ribosomal protein S20 |
| 445 | GL883582.1 | GCA000204355_00428 | CDS | open | 470079-471263 | _na 394_aa | cysteine-S-conjugate beta-lyase | |
| 446 | GL883582.1 | GCA000204355_00429 | CDS | open | 471275-472360 | _na 361_aa | Cystathionine gamma-synthase | |
| 447 | GL883582.1 | GCA000204355_00430 | CDS | open | 472618-473598 | _na 326_aa | holA | DNA polymerase III subunit delta |
| 448 | GL883582.1 | GCA000204355_00431 | CDS | open | 473598-475523 | _na 641_aa | ComEC/Rec2-related protein domain-containing protein | |
| 449 | GL883582.1 | GCA000204355_00432 | CDS | open | 475526-475987 | _na 153_aa | comEB | ComE operon protein 2 |
| 450 | GL883582.1 | GCA000204355_00433 | CDS | open | 475990-476619 | _na 209_aa | Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein | |
| 451 | GL883582.1 | GCA000204355_00434 | CDS | open | 476759-477127 | _na 122_aa | Bacterial Pleckstrin-like y domain-containing protein | |
| 452 | GL883582.1 | GCA000204355_00435 | CDS | open | 477204-478316 | _na 370_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 453 | GL883582.1 | GCA000204355_00436 | CDS | open | 478319-479440 | _na 373_aa | nifS | Aminotransferase%2C class V |
| 454 | GL883582.1 | GCA000204355_00437 | CDS | open | 479586-480647 | _na 353_aa | hypothetical protein | |
| 455 | GL883582.1 | GCA000204355_00438 | CDS | open | 480674-481531 | _na 285_aa | cotS | Aminoglycoside phosphotransferase domain-containing protein |
| 456 | GL883582.1 | GCA000204355_00439 | CDS | open | 481577-482617 | _na 346_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 457 | GL883582.1 | GCA000204355_00440 | CDS | open | 482604-483056 | _na 150_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 458 | GL883582.1 | GCA000204355_00441 | CDS | open | 483040-483708 | _na 222_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 459 | GL883582.1 | GCA000204355_00442 | CDS | open | 483702-484154 | _na 150_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 460 | GL883582.1 | GCA000204355_00443 | CDS | open | 484470-485060 | _na 196_aa | fMR2 | Nitroreductase domain-containing protein |
| 461 | GL883582.1 | GCA000204355_00444 | CDS | open | 485233-485577 | _na 114_aa | hxlR | HTH hxlR-type domain-containing protein |
| 462 | GL883582.1 | GCA000204355_00445 | CDS | open | 485582-486136 | _na 184_aa | hypothetical protein | |
| 463 | GL883582.1 | GCA000204355_00446 | CDS | open | 486251-487333 | _na 360_aa | M50 family metallopeptidase | |
| 464 | GL883582.1 | GCA000204355_00447 | CDS | open | 487345-488511 | _na 388_aa | ATP-grasp domain-containing protein | |
| 465 | GL883582.1 | GCA000204355_00448 | CDS | open | 488635-489945 | _na 436_aa | Isochorismatase family protein | |
| 466 | GL883582.1 | GCA000204355_00449 | CDS | open | 490172-490402 | _na 76_aa | acpP | Acyl carrier protein |
| 467 | GL883582.1 | GCA000204355_00450 | CDS | open | 490408-491394 | _na 328_aa | plsX | phosphate acyltransferase PlsX |
| 468 | GL883582.1 | GCA000204355_00451 | CDS | open | 491387-492022 | _na 211_aa | srtA | Sortase family protein |
| 469 | GL883582.1 | GCA000204355_00452 | CDS | open | 492032-494041 | _na 669_aa | recG | ATP-dependent DNA helicase RecG |
| 470 | GL883582.1 | GCA000204355_00453 | CDS | open | 494034-494906 | _na 290_aa | sdaAA | L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha |
| 471 | GL883582.1 | GCA000204355_00454 | CDS | open | 494918-495586 | _na 222_aa | sdaAB | L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta |
| 472 | GL883582.1 | GCA000204355_00455 | CDS | open | 495589-495816 | _na 75_aa | rnjA | ribonuclease J1 |
| 473 | GL883582.1 | GCA000204355_00456 | CDS | open | 495816-497258 | _na 480_aa | rnjA | ribonuclease J1 |
| 474 | GL883582.1 | GCA000204355_00457 | CDS | open | 497251-497469 | _na 72_aa | rpoEps | DNA-directed RNA polymerase subunit epsilon |
| 475 | GL883582.1 | GCA000204355_00458 | CDS | open | 497469-499043 | _na 524_aa | pucG | N-acetyltransferase domain-containing protein |
| 476 | GL883582.1 | GCA000204355_00459 | CDS | open | 499250-500440 | _na 396_aa | ndh | FAD/NAD(P)-binding domain-containing protein |
| 477 | GL883582.1 | GCA000204355_00460 | CDS | open | 500477-500839 | _na 120_aa | iscA | FeS cluster biogenesis domain-containing protein |
| 478 | GL883582.1 | GCA000204355_00461 | CDS | open | 501334-501588 | _na 84_aa | nifU | NIF system FeS cluster assembly NifU C-terminal domain-containing protein |
| 479 | GL883582.1 | GCA000204355_00463 | CDS | open | 501979-502251 | _na 90_aa | rpsO | 30S ribosomal protein S15 |
| 480 | GL883582.1 | GCA000204355_00464 | CDS | open | 502407-502994 | _na 195_aa | riboflavin kinase | |
| 481 | GL883582.1 | GCA000204355_00465 | CDS | open | 503081-503323 | _na 80_aa | FAD synthase | |
| 482 | GL883582.1 | GCA000204355_00466 | CDS | open | 503334-504257 | _na 307_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 483 | GL883582.1 | GCA000204355_00467 | CDS | open | 504257-504706 | _na 149_aa | fur | Transcriptional regulator%2C Fur family |
| 484 | GL883582.1 | GCA000204355_00468 | CDS | open | 504725-505600 | _na 291_aa | nfo | deoxyribonuclease IV |
| 485 | GL883582.1 | GCA000204355_00469 | CDS | open | 505600-506931 | _na 443_aa | srmB | DEAD/DEAH box helicase |
| 486 | GL883582.1 | GCA000204355_00470 | CDS | open | 507191-507829 | _na 212_aa | deoC | deoxyribose-phosphate aldolase |
| 487 | GL883582.1 | GCA000204355_00471 | CDS | open | 507839-509143 | _na 434_aa | deoA | thymidine phosphorylase |
| 488 | GL883582.1 | GCA000204355_00472 | CDS | open | 509200-509748 | _na 182_aa | ABC transporter permease | |
| 489 | GL883582.1 | GCA000204355_00473 | CDS | open | 509766-510098 | _na 110_aa | hypothetical protein | |
| 490 | GL883582.1 | GCA000204355_00474 | CDS | open | 510095-510574 | _na 159_aa | Phage shock protein B | |
| 491 | GL883582.1 | GCA000204355_00475 | CDS | open | 510598-511587 | _na 329_aa | floA | flotillin-like protein FloA |
| 492 | GL883582.1 | GCA000204355_00476 | CDS | open | 511609-512232 | _na 207_aa | NfeD-like C-terminal domain-containing protein | |
| 493 | GL883582.1 | GCA000204355_00477 | CDS | open | 512239-512958 | _na 239_aa | gloB | Metallo-beta-lactamase domain-containing protein |
| 494 | GL883582.1 | GCA000204355_00478 | CDS | open | 513097-513342 | _na 81_aa | TM2 domain protein | |
| 495 | GL883582.1 | GCA000204355_00480 | CDS | open | 514080-515327 | _na 415_aa | rarA | AAA+ ATPase domain-containing protein |
| 496 | GL883582.1 | GCA000204355_00481 | CDS | open | 515506-516408 | _na 300_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 497 | GL883582.1 | GCA000204355_00482 | CDS | open | 516401-516922 | _na 173_aa | grpB | GrpB family protein |
| 498 | GL883582.1 | GCA000204355_00483 | CDS | open | 517057-517620 | _na 187_aa | DNA-3-methyladenine glycosylase I | |
| 499 | GL883582.1 | GCA000204355_00484 | CDS | open | 517613-521164 | _na 1183_aa | mfd | transcription-repair coupling factor |
| 500 | GL883582.1 | GCA000204355_00485 | CDS | open | 521386-521943 | _na 185_aa | pth | aminoacyl-tRNA hydrolase |

