BAKTAGenome Explorer: Centipeda periodontii (GCA_000213975.1)
Select a Genome:
|
BAKTA Annotations for GCA_000213975.1
|
Search & Sort all 5136 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | GL892076.1 | GCA000213975_01743 | gene | open | 1910587-1910980 | ssrA | ||
| 2 | GL892076.1 | GCA000213975_02369 | gene | open | 2552522-2552873 | ssrA | ||
| 3 | GL892076.1 | GCA000213975_01743 | tmRNA | open | 1910587-1910980 | ssrA | transfer-messenger RNA%2C SsrA | |
| 4 | GL892076.1 | GCA000213975_02369 | tmRNA | open | 2552522-2552873 | ssrA | transfer-messenger RNA%2C SsrA | |
| 5 | GL892076.1 | rep_origin | open | 584807-585051 | ||||
| 6 | GL892076.1 | GCA000213975_00400 | gene | open | 460768-460864 | skipping-rope | ||
| 7 | GL892076.1 | GCA000213975_00754 | gene | open | 845570-845745 | 6S | ||
| 8 | GL892076.1 | GCA000213975_01194 | gene | open | 1343103-1343457 | RNaseP_bact_a | ||
| 9 | GL892076.1 | GCA000213975_01252 | gene | open | 1399059-1399155 | skipping-rope | ||
| 10 | GL892076.1 | GCA000213975_01853 | gene | open | 2024706-2024822 | rrf | ||
| 11 | GL892076.1 | GCA000213975_02478 | gene | open | 2682843-2683068 | Bacteria_large_SRP | ||
| 12 | GL892076.1 | GCA000213975_02479 | gene | open | 2682877-2682976 | Bacteria_small_SRP | ||
| 13 | GL892076.1 | GCA000213975_00400 | ncRNA | open | 460768-460864 | skipping-rope RNA | ||
| 14 | GL892076.1 | GCA000213975_00754 | ncRNA | open | 845570-845745 | 6S / SsrS RNA | ||
| 15 | GL892076.1 | GCA000213975_01194 | ncRNA | open | 1343103-1343457 | Bacterial RNase P class A | ||
| 16 | GL892076.1 | GCA000213975_01252 | ncRNA | open | 1399059-1399155 | skipping-rope RNA | ||
| 17 | GL892076.1 | GCA000213975_02478 | ncRNA | open | 2682843-2683068 | Bacterial large signal recognition particle RNA | ||
| 18 | GL892076.1 | GCA000213975_02479 | ncRNA | open | 2682877-2682976 | Bacterial small signal recognition particle RNA | ||
| 19 | GL892076.1 | regulatory_region | open | 206399-206629 | Cobalamin riboswitch aptamer | |||
| 20 | GL892076.1 | regulatory_region | open | 235698-235854 | Molybdenum/Tungsten riboswitch aptamer (Moco RNA motif) | |||
| 21 | GL892076.1 | regulatory_region | open | 297684-297790 | TPP riboswitch aptamer (THI element) | |||
| 22 | GL892076.1 | regulatory_region | open | 449183-449379 | Cobalamin riboswitch aptamer | |||
| 23 | GL892076.1 | regulatory_region | open | 619952-620099 | Molybdenum/Tungsten riboswitch aptamer (Moco RNA motif) | |||
| 24 | GL892076.1 | regulatory_region | open | 1068518-1068692 | Cobalamin riboswitch aptamer | |||
| 25 | GL892076.1 | regulatory_region | open | 1118174-1118345 | Cobalamin riboswitch aptamer | |||
| 26 | GL892076.1 | regulatory_region | open | 1124863-1125034 | Cobalamin riboswitch aptamer | |||
| 27 | GL892076.1 | regulatory_region | open | 1187163-1187350 | Cobalamin riboswitch aptamer | |||
| 28 | GL892076.1 | regulatory_region | open | 1520928-1521127 | Cobalamin riboswitch aptamer | |||
| 29 | GL892076.1 | regulatory_region | open | 1638549-1638700 | Molybdenum/Tungsten riboswitch aptamer (Moco RNA motif) | |||
| 30 | GL892076.1 | regulatory_region | open | 1733823-1733980 | glmS glucosamine-6-phosphate activated ribozyme aptamer | |||
| 31 | GL892076.1 | regulatory_region | open | 2097397-2097613 | Cobalamin riboswitch aptamer | |||
| 32 | GL892076.1 | regulatory_region | open | 2483939-2484042 | SAM riboswitch aptamer (S box leader) | |||
| 33 | GL892076.1 | regulatory_region | open | 2655814-2655945 | Molybdenum/Tungsten riboswitch aptamer (Moco RNA motif) | |||
| 34 | GL892076.1 | GCA000213975_01853 | rRNA | open | 2024706-2024822 | rrf | 5S ribosomal RNA | |
| 35 | GL892076.1 | repeat_region | open | 273670-274143 | CRISPR array with 7 repeats of length 35%2C consensus sequence GTTTCCGTCCCCTTGCGGGGATGTGGTTTTAAAAT and spacer length 36 | |||
| 36 | GL892076.1 | repeat_region | open | 292884-293360 | CRISPR array with 7 repeats of length 35%2C consensus sequence GTTTCCGTCCCCTTGCGGGGGGCTGTTGCTTAAAT and spacer length 36 | |||
| 37 | GL892076.1 | repeat_region | open | 520518-520852 | CRISPR array with 5 repeats of length 35%2C consensus sequence GTTTCCGTCCCCTTGCGGGGATGTGGTTTTGAAAT and spacer length 37 | |||
| 38 | GL892076.1 | repeat_region | open | 573543-573807 | CRISPR array with 4 repeats of length 38%2C consensus sequence TGTCCCGACACACACAATGCTGCGTGCGGCATTGAAAC and spacer length 35 | |||
| 39 | GL892076.1 | repeat_region | open | 577493-577855 | CRISPR array with 5 repeats of length 37%2C consensus sequence GTCCCGACACACACAATGCCGCGTGCGGCATTGAAAC and spacer length 35 | |||
| 40 | GL892076.1 | repeat_region | open | 1995154-1995330 | CRISPR array with 3 repeats of length 35%2C consensus sequence GTTTCAATCCACGCGCCCCGTGCGGGGCGCGACCT and spacer length 32 | |||
| 41 | GL892076.1 | repeat_region | open | 1995420-1996390 | CRISPR array with 15 repeats of length 33%2C consensus sequence GTTTCAATCCACGCGCCCCGTGCGGGGCGCGAC and spacer length 33 | |||
| 42 | GL892076.1 | repeat_region | open | 1997329-2002165 | CRISPR array with 73 repeats of length 33%2C consensus sequence GTTTCAATCCACGCGCCCCGTGCGGGGCGCGAC and spacer length 33 | |||
| 43 | GL892076.1 | GCA000213975_00001 | CDS | open | 71-1351 | _na 426_aa | Mce/MlaD domain-containing protein | |
| 44 | GL892076.1 | GCA000213975_00002 | CDS | open | 1348-2094 | _na 248_aa | ABC transporter domain-containing protein | |
| 45 | GL892076.1 | GCA000213975_00003 | CDS | open | 2275-3042 | _na 255_aa | ABC transporter permease | |
| 46 | GL892076.1 | GCA000213975_00004 | CDS | open | 3150-3824 | _na 224_aa | rnhA | ribonuclease HI |
| 47 | GL892076.1 | GCA000213975_00005 | CDS | open | 3835-4458 | _na 207_aa | Lipid A 3-O-deacylase | |
| 48 | GL892076.1 | GCA000213975_00006 | CDS | open | 4464-5018 | _na 184_aa | ubiX | Flavin prenyltransferase UbiX |
| 49 | GL892076.1 | GCA000213975_00007 | CDS | open | 5015-6286 | _na 423_aa | serS | serine--tRNA ligase |
| 50 | GL892076.1 | GCA000213975_00008 | CDS | open | 6420-7526 | _na 368_aa | Adenine DNA glycosylase | |
| 51 | GL892076.1 | GCA000213975_00009 | CDS | open | 7591-9249 | _na 552_aa | hutW | heme anaerobic degradation radical SAM methyltransferase ChuW/HutW |
| 52 | GL892076.1 | GCA000213975_00010 | CDS | open | 9246-9746 | _na 166_aa | Flavodoxin-like domain-containing protein | |
| 53 | GL892076.1 | GCA000213975_00011 | CDS | open | 10106-10876 | _na 256_aa | UPF0251 protein HMPREF9081_0012 | |
| 54 | GL892076.1 | GCA000213975_00012 | CDS | open | 11011-11241 | _na 76_aa | Lipoprotein | |
| 55 | GL892076.1 | GCA000213975_00013 | CDS | open | 11371-11742 | _na 123_aa | Cupin type-2 domain-containing protein | |
| 56 | GL892076.1 | GCA000213975_00014 | CDS | open | 11808-12074 | _na 88_aa | Addiction module toxin%2C RelE/StbE family | |
| 57 | GL892076.1 | GCA000213975_00015 | CDS | open | 12037-12291 | _na 84_aa | relB | type II toxin-antitoxin system RelB family antitoxin |
| 58 | GL892076.1 | GCA000213975_00016 | CDS | open | 12421-13155 | _na 244_aa | hypothetical protein | |
| 59 | GL892076.1 | GCA000213975_00017 | CDS | open | 13234-13998 | _na 254_aa | Amino acid ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 60 | GL892076.1 | GCA000213975_00018 | CDS | open | 14009-14713 | _na 234_aa | Polar amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 61 | GL892076.1 | GCA000213975_00019 | CDS | open | 14697-15458 | _na 253_aa | Amino-acid ABC superfamily ATP binding cassette transporter permease protein | |
| 62 | GL892076.1 | GCA000213975_00020 | CDS | open | 15649-16509 | _na 286_aa | Amino acid ABC superfamily ATP binding cassette transporter%2C amino acid-binding protein | |
| 63 | GL892076.1 | GCA000213975_00021 | CDS | open | 16522-17529 | _na 335_aa | Uroporphyrinogen decarboxylase (URO-D) domain-containing protein | |
| 64 | GL892076.1 | GCA000213975_00022 | CDS | open | 18081-19235 | _na 384_aa | Cystathionine beta-lyase | |
| 65 | GL892076.1 | GCA000213975_00023 | CDS | open | 19241-20410 | _na 389_aa | cysteine-S-conjugate beta-lyase | |
| 66 | GL892076.1 | GCA000213975_00024 | CDS | open | 20479-20928 | _na 149_aa | XRE family transcriptional regulator | |
| 67 | GL892076.1 | GCA000213975_00025 | CDS | open | 21140-22075 | _na 311_aa | cysK | cysteine synthase A |
| 68 | GL892076.1 | GCA000213975_00026 | CDS | open | 22423-22935 | _na 170_aa | Glutathione reductase | |
| 69 | GL892076.1 | GCA000213975_00027 | CDS | open | 23222-23941 | _na 239_aa | 4-hydroxy-2-oxoglutarate aldolase | |
| 70 | GL892076.1 | GCA000213975_00028 | CDS | open | 23943-25058 | _na 371_aa | L-seryl-tRNA(Sec) selenium transferase | |
| 71 | GL892076.1 | GCA000213975_00029 | CDS | open | 25074-25742 | _na 222_aa | Membrane protein | |
| 72 | GL892076.1 | GCA000213975_00030 | CDS | open | 25748-26530 | _na 260_aa | Permease | |
| 73 | GL892076.1 | GCA000213975_00031 | CDS | open | 26546-26884 | _na 112_aa | Putative cytosolic protein | |
| 74 | GL892076.1 | GCA000213975_00032 | CDS | open | 26898-27260 | _na 120_aa | Transcriptional regulator | |
| 75 | GL892076.1 | GCA000213975_00033 | CDS | open | 27283-27636 | _na 117_aa | PRD domain-containing protein | |
| 76 | GL892076.1 | GCA000213975_00034 | CDS | open | 27633-28757 | _na 374_aa | amidohydrolase/deacetylase family metallohydrolase | |
| 77 | GL892076.1 | GCA000213975_00035 | CDS | open | 28758-30626 | _na 622_aa | bglG | BglG family transcriptional antiterminator |
| 78 | GL892076.1 | GCA000213975_00036 | CDS | open | 30785-31024 | _na 79_aa | F0F1-ATPase subunit | |
| 79 | GL892076.1 | GCA000213975_00037 | CDS | open | 31054-32211 | _na 385_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 80 | GL892076.1 | GCA000213975_00038 | CDS | open | 32309-33358 | _na 349_aa | UDP-N-acetylglucosamine:undecaprenyl-P N-acetylglucosaminyl 1-P transferase | |
| 81 | GL892076.1 | GCA000213975_00039 | CDS | open | 33436-33828 | _na 130_aa | Resolvase%2C RNase H domain protein | |
| 82 | GL892076.1 | GCA000213975_00040 | CDS | open | 33825-35000 | _na 391_aa | DUF3084 domain-containing protein | |
| 83 | GL892076.1 | GCA000213975_00041 | CDS | open | 35047-36147 | _na 366_aa | YjgP/YjgQ family permease | |
| 84 | GL892076.1 | GCA000213975_00042 | CDS | open | 36287-37321 | _na 344_aa | Autotransporter domain-containing protein | |
| 85 | GL892076.1 | GCA000213975_00043 | CDS | open | 41318-43243 | _na 641_aa | hypothetical protein | |
| 86 | GL892076.1 | GCA000213975_00044 | CDS | open | 44952-45395 | _na 147_aa | hypothetical protein | |
| 87 | GL892076.1 | GCA000213975_00045 | CDS | open | 45656-46297 | _na 213_aa | hypothetical protein | |
| 88 | GL892076.1 | GCA000213975_00046 | CDS | open | 49024-49422 | _na 132_aa | Glutaconyl-CoA decarboxylase subunit gamma | |
| 89 | GL892076.1 | GCA000213975_00047 | CDS | open | 49484-49621 | _na 45_aa | Methylmalonyl-CoA carboxyltransferase 12S subunit | |
| 90 | GL892076.1 | GCA000213975_00048 | CDS | open | 49637-51166 | _na 509_aa | Methylmalonyl-CoA decarboxylase alpha subunit | |
| 91 | GL892076.1 | GCA000213975_00049 | CDS | open | 51242-51658 | _na 138_aa | mce | methylmalonyl-CoA epimerase |
| 92 | GL892076.1 | GCA000213975_00050 | CDS | open | 51699-52637 | _na 312_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 93 | GL892076.1 | GCA000213975_00051 | CDS | open | 52736-53128 | _na 130_aa | Methylmalonyl-CoA mutase | |
| 94 | GL892076.1 | GCA000213975_00052 | CDS | open | 53222-54868 | _na 548_aa | sbm | Methylmalonyl-CoA mutase domain-containing protein |
| 95 | GL892076.1 | GCA000213975_00053 | CDS | open | 54953-56449 | _na 498_aa | Succinate CoA transferase | |
| 96 | GL892076.1 | GCA000213975_00054 | CDS | open | 56715-57386 | _na 223_aa | redox-sensing transcriptional repressor Rex | |
| 97 | GL892076.1 | GCA000213975_00055 | CDS | open | 57389-58735 | _na 448_aa | O-antigen polymerase | |
| 98 | GL892076.1 | GCA000213975_00056 | CDS | open | 58740-60041 | _na 433_aa | tetrahydrofolate synthase | |
| 99 | GL892076.1 | GCA000213975_00057 | CDS | open | 60051-62714 | _na 887_aa | valine--tRNA ligase | |
| 100 | GL892076.1 | GCA000213975_00058 | CDS | open | 62843-63946 | _na 367_aa | DegT/DnrJ/EryC1/StrS family aminotransferase | |
| 101 | GL892076.1 | GCA000213975_00059 | CDS | open | 63967-64974 | _na 335_aa | SAM-dependent methyltransferase | |
| 102 | GL892076.1 | GCA000213975_00060 | CDS | open | 64989-66611 | _na 540_aa | Glycosyltransferase | |
| 103 | GL892076.1 | GCA000213975_00061 | CDS | open | 66654-67862 | _na 402_aa | Acyl-CoA reductase superfamily protein | |
| 104 | GL892076.1 | GCA000213975_00062 | CDS | open | 67837-68916 | _na 359_aa | rfbN | Acyl protein synthase/acyl-CoA reductase RfbN |
| 105 | GL892076.1 | GCA000213975_00063 | CDS | open | 68906-70327 | _na 473_aa | AMP-dependent synthetase and ligase | |
| 106 | GL892076.1 | GCA000213975_00064 | CDS | open | 70345-71316 | _na 323_aa | 1-deoxy-D-xylulose-5-phosphate synthase | |
| 107 | GL892076.1 | GCA000213975_00065 | CDS | open | 71316-72134 | _na 272_aa | Transketolase | |
| 108 | GL892076.1 | GCA000213975_00066 | CDS | open | 72131-72886 | _na 251_aa | 3-oxoacyl-[acyl-carrier-protein] reductase | |
| 109 | GL892076.1 | GCA000213975_00067 | CDS | open | 72891-73142 | _na 83_aa | Acyl carrier protein | |
| 110 | GL892076.1 | GCA000213975_00068 | CDS | open | 73139-73591 | _na 150_aa | (3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase | |
| 111 | GL892076.1 | GCA000213975_00069 | CDS | open | 73617-74672 | _na 351_aa | Beta-ketoacyl-acyl-carrier-protein synthase III | |
| 112 | GL892076.1 | GCA000213975_00070 | CDS | open | 74685-75449 | _na 254_aa | Gluconate 5-dehydrogenase | |
| 113 | GL892076.1 | GCA000213975_00071 | CDS | open | 75453-75671 | _na 72_aa | Acyl carrier protein | |
| 114 | GL892076.1 | GCA000213975_00072 | CDS | open | 75699-76724 | _na 341_aa | 3-oxoacyl-[acyl-carrier-protein] synthase III | |
| 115 | GL892076.1 | GCA000213975_00073 | CDS | open | 76790-77425 | _na 211_aa | Bacterial transferase hexapeptide repeat protein | |
| 116 | GL892076.1 | GCA000213975_00074 | CDS | open | 77520-78311 | _na 263_aa | Glucose-1-phosphate thymidylyltransferase | |
| 117 | GL892076.1 | GCA000213975_00075 | CDS | open | 78428-80092 | _na 554_aa | formate--tetrahydrofolate ligase | |
| 118 | GL892076.1 | GCA000213975_00076 | CDS | open | 80097-80963 | _na 288_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 119 | GL892076.1 | GCA000213975_00077 | CDS | open | 80976-81836 | _na 286_aa | 4-hydroxybenzoate octaprenyltransferase | |
| 120 | GL892076.1 | GCA000213975_00078 | CDS | open | 81833-83293 | _na 486_aa | menaquinone biosynthesis decarboxylase | |
| 121 | GL892076.1 | GCA000213975_00079 | CDS | open | 83305-84129 | _na 274_aa | tatC | twin-arginine translocase subunit TatC |
| 122 | GL892076.1 | GCA000213975_00080 | CDS | open | 84133-84351 | _na 72_aa | tatA | Sec-independent protein translocase protein TatA |
| 123 | GL892076.1 | GCA000213975_00081 | CDS | open | 84374-84697 | _na 107_aa | tatA | Sec-independent protein translocase protein TatA |
| 124 | GL892076.1 | GCA000213975_00082 | CDS | open | 84747-85808 | _na 353_aa | Heptaprenyl diphosphate synthase component II | |
| 125 | GL892076.1 | GCA000213975_00083 | CDS | open | 86025-87605 | _na 526_aa | Exopolysaccharide biosynthesis protein | |
| 126 | GL892076.1 | GCA000213975_00084 | CDS | open | 87602-88024 | _na 140_aa | flgJ | Flagellar protein FlgJ |
| 127 | GL892076.1 | GCA000213975_00085 | CDS | open | 88036-89151 | _na 371_aa | Flagellar P-ring protein | |
| 128 | GL892076.1 | GCA000213975_00086 | CDS | open | 89166-89765 | _na 199_aa | Flagellar L-ring protein | |
| 129 | GL892076.1 | GCA000213975_00087 | CDS | open | 89802-90566 | _na 254_aa | SAF domain protein | |
| 130 | GL892076.1 | GCA000213975_00088 | CDS | open | 90563-91357 | _na 264_aa | flgG | flagellar basal-body rod protein FlgG |
| 131 | GL892076.1 | GCA000213975_00089 | CDS | open | 91439-92242 | _na 267_aa | flgF | flagellar basal-body rod protein FlgF |
| 132 | GL892076.1 | GCA000213975_00090 | CDS | open | 92314-93342 | _na 342_aa | mreB | Cell shape-determining protein MreB |
| 133 | GL892076.1 | GCA000213975_00091 | CDS | open | 93373-93849 | _na 158_aa | hypothetical protein | |
| 134 | GL892076.1 | GCA000213975_00092 | CDS | open | 94014-94547 | _na 177_aa | Diamine N-acetyltransferase | |
| 135 | GL892076.1 | GCA000213975_00093 | CDS | open | 94560-94982 | _na 140_aa | cytidine deaminase | |
| 136 | GL892076.1 | GCA000213975_00094 | CDS | open | 94963-95331 | _na 122_aa | ntrX | Nitrogen regulation protein NtrX |
| 137 | GL892076.1 | GCA000213975_00095 | CDS | open | 95328-95783 | _na 151_aa | Chemotaxis phosphatase CheX-like domain-containing protein | |
| 138 | GL892076.1 | GCA000213975_00096 | CDS | open | 95806-96894 | _na 362_aa | mscS | Small-conductance mechanosensitive ion channel MscS |
| 139 | GL892076.1 | GCA000213975_00097 | CDS | open | 97173-97457 | _na 94_aa | Anaerobic ribonucleoside-triphosphate reductase | |
| 140 | GL892076.1 | GCA000213975_00098 | CDS | open | 97429-97956 | _na 175_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 141 | GL892076.1 | GCA000213975_00099 | CDS | open | 98085-98378 | _na 97_aa | Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein | |
| 142 | GL892076.1 | GCA000213975_00100 | CDS | open | 98682-99170 | _na 162_aa | N-acetyltransferase domain-containing protein | |
| 143 | GL892076.1 | GCA000213975_00101 | CDS | open | 99204-99872 | _na 222_aa | 4Fe4S-binding SPASM domain-containing protein | |
| 144 | GL892076.1 | GCA000213975_00102 | CDS | open | 99869-100495 | _na 208_aa | Hydroxyacylglutathione hydrolase | |
| 145 | GL892076.1 | GCA000213975_00103 | CDS | open | 100492-101538 | _na 348_aa | holA | DNA polymerase III subunit delta |
| 146 | GL892076.1 | GCA000213975_00104 | CDS | open | 101897-102643 | _na 248_aa | pflA | pyruvate formate-lyase-activating protein |
| 147 | GL892076.1 | GCA000213975_00105 | CDS | open | 102650-104899 | _na 749_aa | pflB | formate C-acetyltransferase |
| 148 | GL892076.1 | GCA000213975_00106 | CDS | open | 105087-106244 | _na 385_aa | Major facilitator superfamily MFS_1 transporter | |
| 149 | GL892076.1 | GCA000213975_00107 | CDS | open | 106411-106968 | _na 185_aa | Flavodoxin | |
| 150 | GL892076.1 | GCA000213975_00108 | CDS | open | 107062-108492 | _na 476_aa | Protein kinase domain-containing protein | |
| 151 | GL892076.1 | GCA000213975_00109 | CDS | open | 108483-109331 | _na 282_aa | Protein kinase domain-containing protein | |
| 152 | GL892076.1 | GCA000213975_00110 | CDS | open | 109328-112465 | _na 1045_aa | DNA helicase | |
| 153 | GL892076.1 | GCA000213975_00111 | CDS | open | 112452-113879 | _na 475_aa | hypothetical protein | |
| 154 | GL892076.1 | GCA000213975_00112 | CDS | open | 113957-114319 | _na 120_aa | PTS family glucitol/sorbitol porter%2C IIA component | |
| 155 | GL892076.1 | GCA000213975_00113 | CDS | open | 114460-114861 | _na 133_aa | nitrous oxide-stimulated promoter family protein | |
| 156 | GL892076.1 | GCA000213975_00114 | CDS | open | 114858-115790 | _na 310_aa | L-asparaginase | |
| 157 | GL892076.1 | GCA000213975_00115 | CDS | open | 115804-116205 | _na 133_aa | tsaA | tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO |
| 158 | GL892076.1 | GCA000213975_00116 | CDS | open | 116483-121426 | _na 1647_aa | OMR family outer membrane cobalamin receptor | |
| 159 | GL892076.1 | GCA000213975_00117 | CDS | open | 121688-122620 | _na 310_aa | Putative thioredoxin-disulfide reductase | |
| 160 | GL892076.1 | GCA000213975_00118 | CDS | open | 122803-123033 | _na 76_aa | Glutaredoxin 3 | |
| 161 | GL892076.1 | GCA000213975_00119 | CDS | open | 123046-123282 | _na 78_aa | Glutaredoxin domain-containing protein | |
| 162 | GL892076.1 | GCA000213975_00120 | CDS | open | 123442-124833 | _na 463_aa | Gluconate transporter | |
| 163 | GL892076.1 | GCA000213975_00121 | CDS | open | 124987-125556 | _na 189_aa | Ysc84 actin-binding domain-containing protein | |
| 164 | GL892076.1 | GCA000213975_00122 | CDS | open | 125614-125871 | _na 85_aa | DUF6718 domain-containing protein | |
| 165 | GL892076.1 | GCA000213975_00123 | CDS | open | 125843-126475 | _na 210_aa | RelA/SpoT domain-containing protein | |
| 166 | GL892076.1 | GCA000213975_00124 | CDS | open | 126531-127790 | _na 419_aa | Diaminopimelate decarboxylase | |
| 167 | GL892076.1 | GCA000213975_00125 | CDS | open | 128147-129319 | _na 390_aa | Leucine-binding protein domain-containing protein | |
| 168 | GL892076.1 | GCA000213975_00126 | CDS | open | 129387-130271 | _na 294_aa | Branched-chain amino acid ABC transporter permease | |
| 169 | GL892076.1 | GCA000213975_00127 | CDS | open | 130284-131234 | _na 316_aa | Branched-chain amino acid ABC transporter | |
| 170 | GL892076.1 | GCA000213975_00128 | CDS | open | 131234-132004 | _na 256_aa | ABC transporter domain-containing protein | |
| 171 | GL892076.1 | GCA000213975_00129 | CDS | open | 132006-132740 | _na 244_aa | ABC transporter domain-containing protein | |
| 172 | GL892076.1 | GCA000213975_00130 | CDS | open | 132818-133462 | _na 214_aa | CBS domain-containing protein | |
| 173 | GL892076.1 | GCA000213975_00131 | CDS | open | 133512-134549 | _na 345_aa | FAD:protein FMN transferase | |
| 174 | GL892076.1 | GCA000213975_00132 | CDS | open | 134664-135050 | _na 128_aa | GtrA/DPMS transmembrane domain-containing protein | |
| 175 | GL892076.1 | GCA000213975_00133 | CDS | open | 135236-137083 | _na 615_aa | Fumarate reductase subunit A | |
| 176 | GL892076.1 | GCA000213975_00134 | CDS | open | 137085-138047 | _na 320_aa | Fumarate reductase iron-sulfur subunit | |
| 177 | GL892076.1 | GCA000213975_00135 | CDS | open | 138044-138913 | _na 289_aa | Succinate dehydrogenase cytochrome b558 subunit | |
| 178 | GL892076.1 | GCA000213975_00136 | CDS | open | 139247-140014 | _na 255_aa | Lactose phosphotransferase system repressor | |
| 179 | GL892076.1 | GCA000213975_00137 | CDS | open | 140106-140993 | _na 295_aa | Pyruvate formate-lyase activating enzyme | |
| 180 | GL892076.1 | GCA000213975_00138 | CDS | open | 141246-143915 | _na 889_aa | calcium-translocating P-type ATPase%2C PMCA-type | |
| 181 | GL892076.1 | GCA000213975_00139 | CDS | open | 144175-145467 | _na 430_aa | PepSY-associated TM helix superfamily protein | |
| 182 | GL892076.1 | GCA000213975_00140 | CDS | open | 145591-146136 | _na 181_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 183 | GL892076.1 | GCA000213975_00141 | CDS | open | 146334-146534 | _na 66_aa | Cold-shock DNA-binding domain protein | |
| 184 | GL892076.1 | GCA000213975_00142 | CDS | open | 146703-149438 | _na 911_aa | Group 2 glycosyl transferase | |
| 185 | GL892076.1 | GCA000213975_00143 | CDS | open | 149435-150337 | _na 300_aa | Tetratricopeptide repeat protein | |
| 186 | GL892076.1 | GCA000213975_00144 | CDS | open | 150499-153219 | _na 906_aa | TPR domain/SEC-C domain protein | |
| 187 | GL892076.1 | GCA000213975_00145 | CDS | open | 153274-154920 | _na 548_aa | protein O-GlcNAc transferase | |
| 188 | GL892076.1 | GCA000213975_00146 | CDS | open | 154917-156395 | _na 492_aa | Family 2 glycosyl transferase | |
| 189 | GL892076.1 | GCA000213975_00147 | CDS | open | 156392-160327 | _na 1311_aa | Glycosyltransferase 2-like domain-containing protein | |
| 190 | GL892076.1 | GCA000213975_00148 | CDS | open | 160449-161780 | _na 443_aa | Flagellin | |
| 191 | GL892076.1 | GCA000213975_00149 | CDS | open | 162048-162392 | _na 114_aa | fliT | Flagellar protein FliT |
| 192 | GL892076.1 | GCA000213975_00150 | CDS | open | 162382-162798 | _na 138_aa | fliS | flagellar export chaperone FliS |
| 193 | GL892076.1 | GCA000213975_00151 | CDS | open | 162819-164462 | _na 547_aa | Flagellar hook-associated protein 2 | |
| 194 | GL892076.1 | GCA000213975_00152 | CDS | open | 164484-164906 | _na 140_aa | flaG | Flagellar protein FlaG |
| 195 | GL892076.1 | GCA000213975_00153 | CDS | open | 164975-165196 | _na 73_aa | csrA | carbon storage regulator CsrA |
| 196 | GL892076.1 | GCA000213975_00154 | CDS | open | 165196-165642 | _na 148_aa | fliW | flagellar assembly protein FliW |
| 197 | GL892076.1 | GCA000213975_00155 | CDS | open | 165655-166239 | _na 194_aa | DUF6470 domain-containing protein | |
| 198 | GL892076.1 | GCA000213975_00156 | CDS | open | 166271-167608 | _na 445_aa | Flagellin N-terminal domain-containing protein | |
| 199 | GL892076.1 | GCA000213975_00157 | CDS | open | 167620-169350 | _na 576_aa | flgK | flagellar hook-associated protein FlgK |
| 200 | GL892076.1 | GCA000213975_00158 | CDS | open | 169385-169876 | _na 163_aa | flgN | FlgN protein |
| 201 | GL892076.1 | GCA000213975_00159 | CDS | open | 169883-170371 | _na 162_aa | flgN | FlgN family protein |
| 202 | GL892076.1 | GCA000213975_00160 | CDS | open | 170385-170654 | _na 89_aa | flgM | Flagellar protein FlgM |
| 203 | GL892076.1 | GCA000213975_00161 | CDS | open | 170771-171199 | _na 142_aa | Flagellar protein | |
| 204 | GL892076.1 | GCA000213975_00162 | CDS | open | 171303-173414 | _na 703_aa | Cd(2+)-exporting ATPase | |
| 205 | GL892076.1 | GCA000213975_00163 | CDS | open | 173411-174166 | _na 251_aa | hypothetical protein | |
| 206 | GL892076.1 | GCA000213975_00164 | CDS | open | 174163-174474 | _na 103_aa | hypothetical protein | |
| 207 | GL892076.1 | GCA000213975_00165 | CDS | open | 174546-174746 | _na 66_aa | 50S ribosomal protein L9 domain protein | |
| 208 | GL892076.1 | GCA000213975_00166 | CDS | open | 175273-176409 | _na 378_aa | YibE/F family protein | |
| 209 | GL892076.1 | GCA000213975_00167 | CDS | open | 176429-177490 | _na 353_aa | rfbG | CDP-glucose 4%2C6-dehydratase |
| 210 | GL892076.1 | GCA000213975_00168 | CDS | open | 177595-179673 | _na 692_aa | Choline sulfatase | |
| 211 | GL892076.1 | GCA000213975_00169 | CDS | open | 179712-180560 | _na 282_aa | rpiR | RpiR family transcriptional regulator |
| 212 | GL892076.1 | GCA000213975_00170 | CDS | open | 180845-181732 | _na 295_aa | Dihydrodipicolinate synthase | |
| 213 | GL892076.1 | GCA000213975_00171 | CDS | open | 181749-183131 | _na 460_aa | Dihydroxy-acid dehydratase | |
| 214 | GL892076.1 | GCA000213975_00172 | CDS | open | 183148-183732 | _na 194_aa | Dihydroxy-acid dehydratase | |
| 215 | GL892076.1 | GCA000213975_00173 | CDS | open | 183810-184907 | _na 365_aa | GroES-like protein | |
| 216 | GL892076.1 | GCA000213975_00174 | CDS | open | 184921-185985 | _na 354_aa | 4-phosphoerythronate dehydrogenase | |
| 217 | GL892076.1 | GCA000213975_00175 | CDS | open | 185996-186352 | _na 118_aa | Protein-N(Pi)-phosphohistidine--sugar phosphotransferase | |
| 218 | GL892076.1 | GCA000213975_00176 | CDS | open | 186364-187878 | _na 504_aa | Carbohydrate kinase FGGY | |
| 219 | GL892076.1 | GCA000213975_00177 | CDS | open | 187921-189240 | _na 439_aa | gntP | GntP family gluconate:proton (H+) symporter |
| 220 | GL892076.1 | GCA000213975_00178 | CDS | open | 189469-190893 | _na 474_aa | gndA | NADP-dependent phosphogluconate dehydrogenase |
| 221 | GL892076.1 | GCA000213975_00179 | CDS | open | 190909-192513 | _na 534_aa | Gluconokinase | |
| 222 | GL892076.1 | GCA000213975_00180 | CDS | open | 192640-193560 | _na 306_aa | DUF2179 domain-containing protein | |
| 223 | GL892076.1 | GCA000213975_00181 | CDS | open | 193731-194639 | _na 302_aa | pfkB | 1-phosphofructokinase |
| 224 | GL892076.1 | GCA000213975_00182 | CDS | open | 194898-196799 | _na 633_aa | PTS family fructose/mannitol porter component IIBC | |
| 225 | GL892076.1 | GCA000213975_00183 | CDS | open | 197069-197995 | _na 308_aa | Transposase (putative) YhgA-like domain-containing protein | |
| 226 | GL892076.1 | GCA000213975_00184 | CDS | open | 198101-199303 | _na 400_aa | mcpA | Methyl-accepting chemotaxis protein McpA |
| 227 | GL892076.1 | GCA000213975_00185 | CDS | open | 199445-200002 | _na 185_aa | peptide-methionine (S)-S-oxide reductase | |
| 228 | GL892076.1 | GCA000213975_00186 | CDS | open | 200089-201267 | _na 392_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 229 | GL892076.1 | GCA000213975_00187 | CDS | open | 201594-203792 | _na 732_aa | scpA | methylmalonyl-CoA mutase |
| 230 | GL892076.1 | GCA000213975_00188 | CDS | open | 203792-205975 | _na 727_aa | methylmalonyl-CoA mutase | |
| 231 | GL892076.1 | GCA000213975_00189 | CDS | open | 206750-207559 | _na 269_aa | 3D/G5 domain protein | |
| 232 | GL892076.1 | GCA000213975_00190 | CDS | open | 207785-208567 | _na 260_aa | Hydrolase | |
| 233 | GL892076.1 | GCA000213975_00191 | CDS | open | 208564-210108 | _na 514_aa | metG | methionine--tRNA ligase |
| 234 | GL892076.1 | GCA000213975_00192 | CDS | open | 210173-211597 | _na 474_aa | ATP-binding protein | |
| 235 | GL892076.1 | GCA000213975_00193 | CDS | open | 211677-212522 | _na 281_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 236 | GL892076.1 | GCA000213975_00194 | CDS | open | 212703-213389 | _na 228_aa | arlR | Response regulator ArlR |
| 237 | GL892076.1 | GCA000213975_00195 | CDS | open | 213373-214803 | _na 476_aa | histidine kinase | |
| 238 | GL892076.1 | GCA000213975_00196 | CDS | open | 214895-215749 | _na 284_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 239 | GL892076.1 | GCA000213975_00197 | CDS | open | 215862-217109 | _na 415_aa | sstT | serine/threonine transporter SstT |
| 240 | GL892076.1 | GCA000213975_00198 | CDS | open | 217176-217730 | _na 184_aa | Biotin transporter | |
| 241 | GL892076.1 | GCA000213975_00199 | CDS | open | 218143-222171 | _na 1342_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 242 | GL892076.1 | GCA000213975_00200 | CDS | open | 222190-225933 | _na 1247_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 243 | GL892076.1 | GCA000213975_00201 | CDS | open | 226231-227631 | _na 466_aa | hypothetical protein | |
| 244 | GL892076.1 | GCA000213975_00202 | CDS | open | 228034-228804 | _na 256_aa | ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 245 | GL892076.1 | GCA000213975_00203 | CDS | open | 228801-229820 | _na 339_aa | Iron(III) ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 246 | GL892076.1 | GCA000213975_00204 | CDS | open | 229817-230947 | _na 376_aa | Iron chelate ABC superfamily ATP binding cassette transporter | |
| 247 | GL892076.1 | GCA000213975_00205 | CDS | open | 231021-232268 | _na 415_aa | Outer membrane protein M1 | |
| 248 | GL892076.1 | GCA000213975_00206 | CDS | open | 232536-233591 | _na 351_aa | Iron(III) ABC superfamily ATP binding cassette transporter%2C binding protein | |
| 249 | GL892076.1 | GCA000213975_00207 | CDS | open | 233808-234593 | _na 261_aa | Iron(III) ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 250 | GL892076.1 | GCA000213975_00208 | CDS | open | 234593-235597 | _na 334_aa | Heme ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 251 | GL892076.1 | GCA000213975_00209 | CDS | open | 236005-236751 | _na 248_aa | DUF3153 domain-containing protein | |
| 252 | GL892076.1 | GCA000213975_00210 | CDS | open | 237136-238353 | _na 405_aa | DUF1963 domain-containing protein | |
| 253 | GL892076.1 | GCA000213975_00211 | CDS | open | 238350-240269 | _na 639_aa | dctM | TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein |
| 254 | GL892076.1 | GCA000213975_00212 | CDS | open | 240434-240901 | _na 155_aa | DUF1850 domain-containing protein | |
| 255 | GL892076.1 | GCA000213975_00213 | CDS | open | 240898-241872 | _na 324_aa | TAXI family TRAP transporter solute receptor | |
| 256 | GL892076.1 | GCA000213975_00214 | CDS | open | 242049-242465 | _na 138_aa | hypothetical protein | |
| 257 | GL892076.1 | GCA000213975_00215 | CDS | open | 242465-243034 | _na 189_aa | Hexapeptide transferase | |
| 258 | GL892076.1 | GCA000213975_00216 | CDS | open | 243049-244107 | _na 352_aa | DUF4316 domain-containing protein | |
| 259 | GL892076.1 | GCA000213975_00217 | CDS | open | 244617-246311 | _na 564_aa | Methyl-accepting chemotaxis sensory transducer | |
| 260 | GL892076.1 | GCA000213975_00218 | CDS | open | 246463-246681 | _na 72_aa | Cadmium-exporting ATPase | |
| 261 | GL892076.1 | GCA000213975_00219 | CDS | open | 246702-248558 | _na 618_aa | Cd(2+)-exporting ATPase | |
| 262 | GL892076.1 | GCA000213975_00220 | CDS | open | 248910-250085 | _na 391_aa | nirJ2 | putative heme d1 biosynthesis radical SAM protein NirJ2 |
| 263 | GL892076.1 | GCA000213975_00221 | CDS | open | 250094-251284 | _na 396_aa | nirJ1 | putative heme d1 biosynthesis radical SAM protein NirJ1 |
| 264 | GL892076.1 | GCA000213975_00222 | CDS | open | 251324-251956 | _na 210_aa | tetR | TetR family transcriptional regulator |
| 265 | GL892076.1 | GCA000213975_00224 | CDS | open | 252290-253591 | _na 433_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 266 | GL892076.1 | GCA000213975_00225 | CDS | open | 253745-254572 | _na 275_aa | Flagellar hook-associated protein 2 C-terminal domain-containing protein | |
| 267 | GL892076.1 | GCA000213975_00226 | CDS | open | 254584-254769 | _na 61_aa | Motility protein | |
| 268 | GL892076.1 | GCA000213975_00227 | CDS | open | 254860-255945 | _na 361_aa | DUF1963 domain-containing protein | |
| 269 | GL892076.1 | GCA000213975_00228 | CDS | open | 255955-256386 | _na 143_aa | hypothetical protein | |
| 270 | GL892076.1 | GCA000213975_00229 | CDS | open | 256364-258334 | _na 656_aa | Suppressor of fused-like domain-containing protein | |
| 271 | GL892076.1 | GCA000213975_00230 | CDS | open | 258350-260881 | _na 843_aa | Tetratricopeptide repeat family protein | |
| 272 | GL892076.1 | GCA000213975_00231 | CDS | open | 260977-262254 | _na 425_aa | PepSY-associated TM helix superfamily protein | |
| 273 | GL892076.1 | GCA000213975_00232 | CDS | open | 262317-264464 | _na 715_aa | TonB-dependent receptor | |
| 274 | GL892076.1 | GCA000213975_00233 | CDS | open | 264684-265313 | _na 209_aa | LUD domain-containing protein | |
| 275 | GL892076.1 | GCA000213975_00234 | CDS | open | 265383-266468 | _na 361_aa | mqnE | aminofutalosine synthase MqnE |
| 276 | GL892076.1 | GCA000213975_00235 | CDS | open | 266583-267350 | _na 255_aa | Cyclase | |
| 277 | GL892076.1 | GCA000213975_00236 | CDS | open | 267415-267999 | _na 194_aa | hypothetical protein | |
| 278 | GL892076.1 | GCA000213975_00237 | CDS | open | 268141-270168 | _na 675_aa | OPT family oligopeptide transporter | |
| 279 | GL892076.1 | GCA000213975_00238 | CDS | open | 270273-270461 | _na 62_aa | hicA | HicA family toxin-antitoxin system |
| 280 | GL892076.1 | GCA000213975_00239 | CDS | open | 270495-270929 | _na 144_aa | hicB | HicB family toxin-antitoxin system |
| 281 | GL892076.1 | GCA000213975_00240 | CDS | open | 271033-271503 | _na 156_aa | Glycosyl hydrolase family 98 putative carbohydrate-binding module domain-containing protein | |
| 282 | GL892076.1 | GCA000213975_00241 | CDS | open | 271528-271947 | _na 139_aa | Pyridoxamine 5'-phosphate oxidase-like domain-containing protein | |
| 283 | GL892076.1 | GCA000213975_00242 | CDS | open | 272011-273264 | _na 417_aa | Peptidase M48 domain-containing protein | |
| 284 | GL892076.1 | GCA000213975_00243 | CDS | open | 274330-275259 | _na 309_aa | hypothetical protein | |
| 285 | GL892076.1 | GCA000213975_00244 | CDS | open | 276544-276837 | _na 97_aa | hypothetical protein | |
| 286 | GL892076.1 | GCA000213975_00245 | CDS | open | 276924-277844 | _na 306_aa | HipA-like C-terminal domain-containing protein | |
| 287 | GL892076.1 | GCA000213975_00246 | CDS | open | 277837-278061 | _na 74_aa | Complexin-2 | |
| 288 | GL892076.1 | GCA000213975_00247 | CDS | open | 278520-279302 | _na 260_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 289 | GL892076.1 | GCA000213975_00248 | CDS | open | 279306-279722 | _na 138_aa | mlpA | MlpA |
| 290 | GL892076.1 | GCA000213975_00249 | CDS | open | 279794-282826 | _na 1010_aa | MobA/MobL family protein | |
| 291 | GL892076.1 | GCA000213975_00250 | CDS | open | 283050-283190 | _na 46_aa | hypothetical protein | |
| 292 | GL892076.1 | GCA000213975_00251 | CDS | open | 283470-284801 | _na 443_aa | csm6 | type III-A CRISPR-associated CARF protein Csm6 |
| 293 | GL892076.1 | GCA000213975_00252 | CDS | open | 284803-285561 | _na 252_aa | CRISPR-associated protein Cas6 C-terminal domain-containing protein | |
| 294 | GL892076.1 | GCA000213975_00253 | CDS | open | 285545-286759 | _na 404_aa | csm5 | type III-A CRISPR-associated RAMP protein Csm5 |
| 295 | GL892076.1 | GCA000213975_00254 | CDS | open | 286756-287757 | _na 333_aa | csm4 | type III-A CRISPR-associated RAMP protein Csm4 |
| 296 | GL892076.1 | GCA000213975_00255 | CDS | open | 287754-288473 | _na 239_aa | csm3 | type III-A CRISPR-associated RAMP protein Csm3 |
| 297 | GL892076.1 | GCA000213975_00256 | CDS | open | 288476-288877 | _na 133_aa | CRISPR system Cms protein Csm2 | |
| 298 | GL892076.1 | GCA000213975_00257 | CDS | open | 288870-291326 | _na 818_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 299 | GL892076.1 | GCA000213975_00258 | CDS | open | 291456-291770 | _na 104_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 300 | GL892076.1 | GCA000213975_00259 | CDS | open | 291781-292776 | _na 331_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 301 | GL892076.1 | GCA000213975_00260 | CDS | open | 293531-293830 | _na 99_aa | hypothetical protein | |
| 302 | GL892076.1 | GCA000213975_00261 | CDS | open | 293989-294480 | _na 163_aa | thiW | energy coupling factor transporter S component ThiW |
| 303 | GL892076.1 | GCA000213975_00262 | CDS | open | 294474-295277 | _na 267_aa | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase | |
| 304 | GL892076.1 | GCA000213975_00263 | CDS | open | 295354-296175 | _na 273_aa | thiM | hydroxyethylthiazole kinase |
| 305 | GL892076.1 | GCA000213975_00264 | CDS | open | 296396-297571 | _na 391_aa | cytX | Hydroxymethylpyrimidine transporter CytX |
| 306 | GL892076.1 | GCA000213975_00265 | CDS | open | 297800-298738 | _na 312_aa | PRC-barrel domain protein | |
| 307 | GL892076.1 | GCA000213975_00266 | CDS | open | 298767-299513 | _na 248_aa | traD | Conjugal transfer TraD |
| 308 | GL892076.1 | GCA000213975_00267 | CDS | open | 299789-300055 | _na 88_aa | Phosphocarrier protein HPr | |
| 309 | GL892076.1 | GCA000213975_00268 | CDS | open | 300178-301911 | _na 577_aa | Phosphoenolpyruvate-protein phosphotransferase | |
| 310 | GL892076.1 | GCA000213975_00269 | CDS | open | 302197-302394 | _na 65_aa | Ferredoxin | |
| 311 | GL892076.1 | GCA000213975_00270 | CDS | open | 302425-303525 | _na 366_aa | Aldose 1-epimerase | |
| 312 | GL892076.1 | GCA000213975_00271 | CDS | open | 303689-304879 | _na 396_aa | sucC | ADP-forming succinate--CoA ligase subunit beta |
| 313 | GL892076.1 | GCA000213975_00272 | CDS | open | 304899-305804 | _na 301_aa | sucD | succinate--CoA ligase subunit alpha |
| 314 | GL892076.1 | GCA000213975_00273 | CDS | open | 306390-307718 | _na 442_aa | TPM domain-containing protein | |
| 315 | GL892076.1 | GCA000213975_00274 | CDS | open | 307916-308485 | _na 189_aa | lemA | LemA family protein |
| 316 | GL892076.1 | GCA000213975_00275 | CDS | open | 308522-309394 | _na 290_aa | Copper amine oxidase | |
| 317 | GL892076.1 | GCA000213975_00276 | CDS | open | 309420-310292 | _na 290_aa | Tat pathway signal sequence domain protein | |
| 318 | GL892076.1 | GCA000213975_00277 | CDS | open | 310317-311189 | _na 290_aa | Outer membrane lipoprotein-sorting protein | |
| 319 | GL892076.1 | GCA000213975_00278 | CDS | open | 311290-312564 | _na 424_aa | GGDEF domain-containing protein | |
| 320 | GL892076.1 | GCA000213975_00279 | CDS | open | 312690-313499 | _na 269_aa | hypothetical protein | |
| 321 | GL892076.1 | GCA000213975_00280 | CDS | open | 313697-314584 | _na 295_aa | fructose bisphosphate aldolase | |
| 322 | GL892076.1 | GCA000213975_00281 | CDS | open | 315292-316482 | _na 396_aa | Transposase | |
| 323 | GL892076.1 | GCA000213975_00282 | CDS | open | 316684-318297 | _na 537_aa | Cytosine-specific methyltransferase | |
| 324 | GL892076.1 | GCA000213975_00283 | CDS | open | 318336-319085 | _na 249_aa | DUF4037 domain-containing protein | |
| 325 | GL892076.1 | GCA000213975_00284 | CDS | open | 319082-319960 | _na 292_aa | hypothetical protein | |
| 326 | GL892076.1 | GCA000213975_00285 | CDS | open | 319944-321848 | _na 634_aa | hypothetical protein | |
| 327 | GL892076.1 | GCA000213975_00286 | CDS | open | 322305-325313 | _na 1002_aa | SIR2-like domain-containing protein | |
| 328 | GL892076.1 | GCA000213975_00287 | CDS | open | 325331-328387 | _na 1018_aa | Type I restriction enzyme endonuclease subunit | |
| 329 | GL892076.1 | GCA000213975_00288 | CDS | open | 328580-330058 | _na 492_aa | Transcriptional regulator | |
| 330 | GL892076.1 | GCA000213975_00289 | CDS | open | 330448-330981 | _na 177_aa | O-acetyl-ADP-ribose deacetylase | |
| 331 | GL892076.1 | GCA000213975_00290 | CDS | open | 331162-332457 | _na 431_aa | TFIIB-type zinc ribbon-containing protein | |
| 332 | GL892076.1 | GCA000213975_00291 | CDS | open | 332574-334109 | _na 511_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 333 | GL892076.1 | GCA000213975_00292 | CDS | open | 334150-334902 | _na 250_aa | Lipoprotein | |
| 334 | GL892076.1 | GCA000213975_00293 | CDS | open | 335524-336069 | _na 181_aa | hypothetical protein | |
| 335 | GL892076.1 | GCA000213975_00294 | CDS | open | 336177-336542 | _na 121_aa | hypothetical protein | |
| 336 | GL892076.1 | GCA000213975_00295 | CDS | open | 336759-337616 | _na 285_aa | DUF3298 domain-containing protein | |
| 337 | GL892076.1 | GCA000213975_00296 | CDS | open | 337955-338908 | _na 317_aa | hypothetical protein | |
| 338 | GL892076.1 | GCA000213975_00297 | CDS | open | 339326-341758 | _na 810_aa | Histidine kinase N-terminal 7TM region domain-containing protein | |
| 339 | GL892076.1 | GCA000213975_00298 | CDS | open | 341746-343134 | _na 462_aa | histidine kinase | |
| 340 | GL892076.1 | GCA000213975_00299 | CDS | open | 343131-343751 | _na 206_aa | Response regulator | |
| 341 | GL892076.1 | GCA000213975_00300 | CDS | open | 343924-345333 | _na 469_aa | SPFH domain-containing protein | |
| 342 | GL892076.1 | GCA000213975_00301 | CDS | open | 345363-346481 | _na 372_aa | Zinc finger domain protein%2C LSD1 subclass | |
| 343 | GL892076.1 | GCA000213975_00302 | CDS | open | 346494-347327 | _na 277_aa | TPM domain-containing protein | |
| 344 | GL892076.1 | GCA000213975_00303 | CDS | open | 347452-348024 | _na 190_aa | DUF3862 domain-containing protein | |
| 345 | GL892076.1 | GCA000213975_00304 | CDS | open | 348592-349227 | _na 211_aa | hypothetical protein | |
| 346 | GL892076.1 | GCA000213975_00305 | CDS | open | 349224-349430 | _na 68_aa | Esterase | |
| 347 | GL892076.1 | GCA000213975_00306 | CDS | open | 349704-351428 | _na 574_aa | GTPase | |
| 348 | GL892076.1 | GCA000213975_00307 | CDS | open | 351443-353575 | _na 710_aa | GTPase | |
| 349 | GL892076.1 | GCA000213975_00308 | CDS | open | 353625-354524 | _na 299_aa | ADP-ribosylglycohydrolase | |
| 350 | GL892076.1 | GCA000213975_00309 | CDS | open | 354531-355748 | _na 405_aa | 3'-phosphate/5'-hydroxy nucleic acid ligase | |
| 351 | GL892076.1 | GCA000213975_00310 | CDS | open | 355761-355907 | _na 48_aa | Preprotein translocase | |
| 352 | GL892076.1 | GCA000213975_00311 | CDS | open | 355915-356148 | _na 77_aa | dnaJ | Chaperone DnaJ |
| 353 | GL892076.1 | GCA000213975_00312 | CDS | open | 356301-357974 | _na 557_aa | GTP-binding protein | |
| 354 | GL892076.1 | GCA000213975_00313 | CDS | open | 358041-359876 | _na 611_aa | G domain-containing protein | |
| 355 | GL892076.1 | GCA000213975_00314 | CDS | open | 359893-360507 | _na 204_aa | recX | Regulatory protein RecX |
| 356 | GL892076.1 | GCA000213975_00315 | CDS | open | 360675-361496 | _na 273_aa | VWFA domain-containing protein | |
| 357 | GL892076.1 | GCA000213975_00316 | CDS | open | 361641-362378 | _na 245_aa | VWFA domain-containing protein | |
| 358 | GL892076.1 | GCA000213975_00317 | CDS | open | 362523-363191 | _na 222_aa | VWFA domain-containing protein | |
| 359 | GL892076.1 | GCA000213975_00318 | CDS | open | 363342-363827 | _na 161_aa | Methylated-DNA--protein-cysteine methyltransferase | |
| 360 | GL892076.1 | GCA000213975_00319 | CDS | open | 363846-364244 | _na 132_aa | putative toxin-antitoxin system toxin component%2C PIN family | |
| 361 | GL892076.1 | GCA000213975_00320 | CDS | open | 364228-364515 | _na 95_aa | SpoVT-AbrB domain-containing protein | |
| 362 | GL892076.1 | GCA000213975_00321 | CDS | open | 364797-366272 | _na 491_aa | DUF2828 domain-containing protein | |
| 363 | GL892076.1 | GCA000213975_00322 | CDS | open | 366580-367143 | _na 187_aa | HotDog ACOT-type domain-containing protein | |
| 364 | GL892076.1 | GCA000213975_00323 | CDS | open | 367301-369058 | _na 585_aa | 1-deoxy-D-xylulose-5-phosphate synthase | |
| 365 | GL892076.1 | GCA000213975_00324 | CDS | open | 369263-371020 | _na 585_aa | 1-deoxy-D-xylulose-5-phosphate synthase | |
| 366 | GL892076.1 | GCA000213975_00326 | CDS | open | 371525-372016 | _na 163_aa | nimA | 5-nitroimidazole resistance protein NimA |
| 367 | GL892076.1 | GCA000213975_00327 | CDS | open | 372248-372964 | _na 238_aa | Methyltransferase | |
| 368 | GL892076.1 | GCA000213975_00328 | CDS | open | 373071-377417 | _na 1448_aa | DNA helicase | |
| 369 | GL892076.1 | GCA000213975_00329 | CDS | open | 377449-378876 | _na 475_aa | Succinate-semialdehyde dehydrogenase | |
| 370 | GL892076.1 | GCA000213975_00330 | CDS | open | 379486-380517 | _na 343_aa | ABC transporter | |
| 371 | GL892076.1 | GCA000213975_00331 | CDS | open | 380514-381287 | _na 257_aa | Ferrichrome ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 372 | GL892076.1 | GCA000213975_00332 | CDS | open | 381284-382318 | _na 344_aa | Iron(III) ABC superfamily ATP binding cassette transporter%2C iron(III)-binding protein | |
| 373 | GL892076.1 | GCA000213975_00333 | CDS | open | 382334-384268 | _na 644_aa | TonB-dependent receptor | |
| 374 | GL892076.1 | GCA000213975_00334 | CDS | open | 384691-385206 | _na 171_aa | SMI1/KNR4 family protein | |
| 375 | GL892076.1 | GCA000213975_00335 | CDS | open | 385257-385400 | _na 47_aa | hypothetical protein | |
| 376 | GL892076.1 | GCA000213975_00336 | CDS | open | 385718-386449 | _na 243_aa | NAD-dependent protein deacylase | |
| 377 | GL892076.1 | GCA000213975_00337 | CDS | open | 386574-387458 | _na 294_aa | Drug/metabolite exporter family protein | |
| 378 | GL892076.1 | GCA000213975_00339 | CDS | open | 387755-388273 | _na 172_aa | hypothetical protein | |
| 379 | GL892076.1 | GCA000213975_00340 | CDS | open | 388415-389377 | _na 320_aa | Tetratricopeptide repeat protein | |
| 380 | GL892076.1 | GCA000213975_00341 | CDS | open | 389389-390381 | _na 330_aa | Tetratricopeptide repeat protein | |
| 381 | GL892076.1 | GCA000213975_00342 | CDS | open | 390532-391446 | _na 304_aa | DUF3829 domain-containing protein | |
| 382 | GL892076.1 | GCA000213975_00343 | CDS | open | 391606-392730 | _na 374_aa | Flagellar assembly protein T N-terminal domain-containing protein | |
| 383 | GL892076.1 | GCA000213975_00344 | CDS | open | 393065-393739 | _na 224_aa | csgG | Curli production assembly/transport component CsgG |
| 384 | GL892076.1 | GCA000213975_00345 | CDS | open | 393803-394705 | _na 300_aa | Lipoprotein LPP20-like domain-containing protein | |
| 385 | GL892076.1 | GCA000213975_00346 | CDS | open | 395437-396594 | _na 385_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 386 | GL892076.1 | GCA000213975_00347 | CDS | open | 396596-397108 | _na 170_aa | PIN domain protein | |
| 387 | GL892076.1 | GCA000213975_00348 | CDS | open | 397236-397808 | _na 190_aa | DUF4375 domain-containing protein | |
| 388 | GL892076.1 | GCA000213975_00349 | CDS | open | 397886-399085 | _na 399_aa | dpaL | diaminopropionate ammonia-lyase |
| 389 | GL892076.1 | GCA000213975_00350 | CDS | open | 399573-400490 | _na 305_aa | hypothetical protein | |
| 390 | GL892076.1 | GCA000213975_00351 | CDS | open | 400971-401978 | _na 335_aa | hypothetical protein | |
| 391 | GL892076.1 | GCA000213975_00352 | CDS | open | 402155-402625 | _na 156_aa | Esterase/lipase/thioesterase | |
| 392 | GL892076.1 | GCA000213975_00353 | CDS | open | 402612-403154 | _na 180_aa | Hydrolase%2C alpha/beta domain protein | |
| 393 | GL892076.1 | GCA000213975_00354 | CDS | open | 403226-404854 | _na 542_aa | malolactic enzyme | |
| 394 | GL892076.1 | GCA000213975_00355 | CDS | open | 405006-405281 | _na 91_aa | Acetyltransferase | |
| 395 | GL892076.1 | GCA000213975_00356 | CDS | open | 405356-405790 | _na 144_aa | flavodoxin | |
| 396 | GL892076.1 | GCA000213975_00357 | CDS | open | 406106-408745 | _na 879_aa | copZ | copper chaperone CopZ |
| 397 | GL892076.1 | GCA000213975_00358 | CDS | open | 408888-409412 | _na 174_aa | hypothetical protein | |
| 398 | GL892076.1 | GCA000213975_00359 | CDS | open | 409555-410295 | _na 246_aa | azlC | LIV-E family branched chain amino acid permease AzlC |
| 399 | GL892076.1 | GCA000213975_00360 | CDS | open | 410288-410599 | _na 103_aa | Branched-chain amino acid transporter | |
| 400 | GL892076.1 | GCA000213975_00361 | CDS | open | 410701-411558 | _na 285_aa | Rpn family recombination-promoting nuclease/putative transposase | |
| 401 | GL892076.1 | GCA000213975_00362 | CDS | open | 411748-412713 | _na 321_aa | DUF4178 domain-containing protein | |
| 402 | GL892076.1 | GCA000213975_00363 | CDS | open | 412774-413748 | _na 324_aa | DUF4178 domain-containing protein | |
| 403 | GL892076.1 | GCA000213975_00364 | CDS | open | 413759-414190 | _na 143_aa | DUF350 domain-containing protein | |
| 404 | GL892076.1 | GCA000213975_00365 | CDS | open | 414304-414867 | _na 187_aa | Tat pathway signal protein | |
| 405 | GL892076.1 | GCA000213975_00366 | CDS | open | 414870-416174 | _na 434_aa | Glutathionylspermidine synthase subfamily | |
| 406 | GL892076.1 | GCA000213975_00367 | CDS | open | 416501-417949 | _na 482_aa | panF | sodium/pantothenate symporter |
| 407 | GL892076.1 | GCA000213975_00368 | CDS | open | 417946-418209 | _na 87_aa | SAM-dependent methyltransferase | |
| 408 | GL892076.1 | GCA000213975_00369 | CDS | open | 418457-420430 | _na 657_aa | Sensor histidine kinase | |
| 409 | GL892076.1 | GCA000213975_00370 | CDS | open | 420674-421426 | _na 250_aa | Hydrolase | |
| 410 | GL892076.1 | GCA000213975_00371 | CDS | open | 421745-423967 | _na 740_aa | Outer membrane receptor | |
| 411 | GL892076.1 | GCA000213975_00372 | CDS | open | 424036-424806 | _na 256_aa | Methyltransferase domain-containing protein | |
| 412 | GL892076.1 | GCA000213975_00373 | CDS | open | 425141-425365 | _na 74_aa | Addiction module antitoxin%2C RelB/DinJ family | |
| 413 | GL892076.1 | GCA000213975_00374 | CDS | open | 425458-426108 | _na 216_aa | RNA polymerase%2C sigma-24 subunit%2C ECF subfamily protein | |
| 414 | GL892076.1 | GCA000213975_00375 | CDS | open | 426429-428612 | _na 727_aa | EAL domain-containing protein | |
| 415 | GL892076.1 | GCA000213975_00376 | CDS | open | 428627-429679 | _na 350_aa | hypothetical protein | |
| 416 | GL892076.1 | GCA000213975_00377 | CDS | open | 429794-430495 | _na 233_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 417 | GL892076.1 | GCA000213975_00378 | CDS | open | 431051-431737 | _na 228_aa | hypothetical protein | |
| 418 | GL892076.1 | GCA000213975_00379 | CDS | open | 431837-434518 | _na 893_aa | hypothetical protein | |
| 419 | GL892076.1 | GCA000213975_00380 | CDS | open | 434515-435381 | _na 288_aa | Outer membrane autotransporter barrel domain protein | |
| 420 | GL892076.1 | GCA000213975_00381 | CDS | open | 435486-436424 | _na 312_aa | Flagellar assembly protein H | |
| 421 | GL892076.1 | GCA000213975_00382 | CDS | open | 436482-437720 | _na 412_aa | Hydroxypyruvate reductase | |
| 422 | GL892076.1 | GCA000213975_00383 | CDS | open | 437955-439616 | _na 553_aa | treC | alpha%2Calpha-phosphotrehalase |
| 423 | GL892076.1 | GCA000213975_00384 | CDS | open | 439657-440103 | _na 148_aa | Membrane-bound metal-dependent hydrolase | |
| 424 | GL892076.1 | GCA000213975_00385 | CDS | open | 440407-441591 | _na 394_aa | NADH-dependent butanol dehydrogenase A | |
| 425 | GL892076.1 | GCA000213975_00386 | CDS | open | 441760-443307 | _na 515_aa | sdcS | Sodium-dependent dicarboxylate transporter SdcS |
| 426 | GL892076.1 | GCA000213975_00387 | CDS | open | 443396-443848 | _na 150_aa | DUF3601 domain-containing protein | |
| 427 | GL892076.1 | GCA000213975_00388 | CDS | open | 443985-444947 | _na 320_aa | Glycerate dehydrogenase | |
| 428 | GL892076.1 | GCA000213975_00389 | CDS | open | 444981-445835 | _na 284_aa | Aldo/keto reductase family oxidoreductase | |
| 429 | GL892076.1 | GCA000213975_00390 | CDS | open | 446032-447975 | _na 647_aa | TonB-dependent receptor | |
| 430 | GL892076.1 | GCA000213975_00391 | CDS | open | 448037-449014 | _na 325_aa | Heme ABC superfamily ATP binding cassette transporter%2C binding protein | |
| 431 | GL892076.1 | GCA000213975_00392 | CDS | open | 450267-451526 | _na 419_aa | Citrate transporter-like domain-containing protein | |
| 432 | GL892076.1 | GCA000213975_00393 | CDS | open | 451686-453002 | _na 438_aa | Glycine hydroxymethyltransferase | |
| 433 | GL892076.1 | GCA000213975_00394 | CDS | open | 453222-454457 | _na 411_aa | Glycine hydroxymethyltransferase | |
| 434 | GL892076.1 | GCA000213975_00395 | CDS | open | 454690-455034 | _na 114_aa | copG | Ribbon-helix-helix protein CopG domain-containing protein |
| 435 | GL892076.1 | GCA000213975_00396 | CDS | open | 455097-455420 | _na 107_aa | hypothetical protein | |
| 436 | GL892076.1 | GCA000213975_00397 | CDS | open | 455455-456150 | _na 231_aa | hypothetical protein | |
| 437 | GL892076.1 | GCA000213975_00398 | CDS | open | 457041-459638 | _na 865_aa | N-6 DNA Methylase | |
| 438 | GL892076.1 | GCA000213975_00399 | CDS | open | 460233-460820 | _na 195_aa | hypothetical protein | |
| 439 | GL892076.1 | GCA000213975_00401 | CDS | open | 462178-462567 | _na 129_aa | Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 2 domain-containing protein | |
| 440 | GL892076.1 | GCA000213975_00402 | CDS | open | 462573-463496 | _na 307_aa | Ppx/GppA phosphatase N-terminal domain-containing protein | |
| 441 | GL892076.1 | GCA000213975_00403 | CDS | open | 463500-464501 | _na 333_aa | Threonine synthase | |
| 442 | GL892076.1 | GCA000213975_00404 | CDS | open | 464813-466672 | _na 619_aa | Arylsulfatase | |
| 443 | GL892076.1 | GCA000213975_00405 | CDS | open | 466684-467388 | _na 234_aa | lysM | LysM domain protein |
| 444 | GL892076.1 | GCA000213975_00406 | CDS | open | 467483-468316 | _na 277_aa | Chorismate dehydratase | |
| 445 | GL892076.1 | GCA000213975_00407 | CDS | open | 468489-469661 | _na 390_aa | phosphoribosylaminoimidazolecarboxamide formyltransferase | |
| 446 | GL892076.1 | GCA000213975_00408 | CDS | open | 469892-472009 | _na 705_aa | TonB-dependent copper receptor | |
| 447 | GL892076.1 | GCA000213975_00409 | CDS | open | 472282-472911 | _na 209_aa | hypothetical protein | |
| 448 | GL892076.1 | GCA000213975_00410 | CDS | open | 472948-473379 | _na 143_aa | lktC | LktC family protein |
| 449 | GL892076.1 | GCA000213975_00412 | CDS | open | 473637-474812 | _na 391_aa | ATPase AAA-type core domain-containing protein | |
| 450 | GL892076.1 | GCA000213975_00413 | CDS | open | 474794-475369 | _na 191_aa | hypothetical protein | |
| 451 | GL892076.1 | GCA000213975_00414 | CDS | open | 475414-476058 | _na 214_aa | Single-stranded DNA-binding protein | |
| 452 | GL892076.1 | GCA000213975_00415 | CDS | open | 476115-476579 | _na 154_aa | Siphovirus Gp157 | |
| 453 | GL892076.1 | GCA000213975_00416 | CDS | open | 476594-476914 | _na 106_aa | hypothetical protein | |
| 454 | GL892076.1 | GCA000213975_00417 | CDS | open | 476974-477636 | _na 220_aa | DUF932 domain-containing protein | |
| 455 | GL892076.1 | GCA000213975_00418 | CDS | open | 477611-478066 | _na 151_aa | hypothetical protein | |
| 456 | GL892076.1 | GCA000213975_00419 | CDS | open | 478828-479202 | _na 124_aa | hypothetical protein | |
| 457 | GL892076.1 | GCA000213975_00420 | CDS | open | 480043-480468 | _na 141_aa | Lipoprotein | |
| 458 | GL892076.1 | GCA000213975_00421 | CDS | open | 480691-481332 | _na 213_aa | Zinc-ribbon domain-containing protein | |
| 459 | GL892076.1 | GCA000213975_00422 | CDS | open | 481441-482085 | _na 214_aa | Zinc-ribbon domain-containing protein | |
| 460 | GL892076.1 | GCA000213975_00423 | CDS | open | 482228-482869 | _na 213_aa | Lipoprotein | |
| 461 | GL892076.1 | GCA000213975_00424 | CDS | open | 482996-484171 | _na 391_aa | beta-N-acetylhexosaminidase | |
| 462 | GL892076.1 | GCA000213975_00425 | CDS | open | 484510-485046 | _na 178_aa | TNT domain-containing protein | |
| 463 | GL892076.1 | GCA000213975_00426 | CDS | open | 485156-485575 | _na 139_aa | Major facilitator family transporter | |
| 464 | GL892076.1 | GCA000213975_00427 | CDS | open | 485797-485952 | _na 51_aa | hypothetical protein | |
| 465 | GL892076.1 | GCA000213975_00428 | CDS | open | 485988-487124 | _na 378_aa | HipA-like C-terminal domain-containing protein | |
| 466 | GL892076.1 | GCA000213975_00429 | CDS | open | 487121-487483 | _na 120_aa | hicB | HicB family protein |
| 467 | GL892076.1 | GCA000213975_00430 | CDS | open | 487642-488028 | _na 128_aa | Phospholipase D-like domain-containing protein | |
| 468 | GL892076.1 | GCA000213975_00431 | CDS | open | 488028-488903 | _na 291_aa | Lipoprotein | |
| 469 | GL892076.1 | GCA000213975_00432 | CDS | open | 489065-489607 | _na 180_aa | 3-hexulose-6-phosphate isomerase | |
| 470 | GL892076.1 | GCA000213975_00433 | CDS | open | 489619-490254 | _na 211_aa | Hexulose-6-phosphate synthase | |
| 471 | GL892076.1 | GCA000213975_00434 | CDS | open | 490251-491201 | _na 316_aa | 2-dehydro-3-deoxygluconokinase | |
| 472 | GL892076.1 | GCA000213975_00435 | CDS | open | 491214-491675 | _na 153_aa | YhcH/YjgK/YiaL family protein | |
| 473 | GL892076.1 | GCA000213975_00436 | CDS | open | 491669-492439 | _na 256_aa | hypothetical protein | |
| 474 | GL892076.1 | GCA000213975_00437 | CDS | open | 492470-494611 | _na 713_aa | N-methylhydaintoinase A | |
| 475 | GL892076.1 | GCA000213975_00438 | CDS | open | 494631-495986 | _na 451_aa | CitMHS family citrate-magnesium (Mg2+):proton (H+) citrate-calcium (Ca2+): proton (H+) symporter | |
| 476 | GL892076.1 | GCA000213975_00439 | CDS | open | 496513-497517 | _na 334_aa | purR | PurR family transcriptional regulator |
| 477 | GL892076.1 | GCA000213975_00440 | CDS | open | 497571-498386 | _na 271_aa | hypothetical protein | |
| 478 | GL892076.1 | GCA000213975_00441 | CDS | open | 498403-498681 | _na 92_aa | RelE/StbE family addiction module toxin | |
| 479 | GL892076.1 | GCA000213975_00442 | CDS | open | 498683-498946 | _na 87_aa | Addiction module antitoxin RelB/DinJ family | |
| 480 | GL892076.1 | GCA000213975_00443 | CDS | open | 499487-500101 | _na 204_aa | TNT domain-containing protein | |
| 481 | GL892076.1 | GCA000213975_00444 | CDS | open | 500197-501363 | _na 388_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 482 | GL892076.1 | GCA000213975_00445 | CDS | open | 501442-503235 | _na 597_aa | Type II restriction endonuclease | |
| 483 | GL892076.1 | GCA000213975_00446 | CDS | open | 503222-505117 | _na 631_aa | Site-specific DNA-methyltransferase (adenine-specific) | |
| 484 | GL892076.1 | GCA000213975_00447 | CDS | open | 505206-505508 | _na 100_aa | Polymerase beta nucleotidyltransferase domain-containing protein | |
| 485 | GL892076.1 | GCA000213975_00448 | CDS | open | 505895-507343 | _na 482_aa | Lipoprotein | |
| 486 | GL892076.1 | GCA000213975_00449 | CDS | open | 507651-507899 | _na 82_aa | Transposase | |
| 487 | GL892076.1 | GCA000213975_00450 | CDS | open | 509025-509540 | _na 171_aa | Nicotinamidase | |
| 488 | GL892076.1 | GCA000213975_00451 | CDS | open | 509693-510298 | _na 201_aa | hypothetical protein | |
| 489 | GL892076.1 | GCA000213975_00452 | CDS | open | 510386-512113 | _na 575_aa | Adenine deaminase | |
| 490 | GL892076.1 | GCA000213975_00453 | CDS | open | 512123-513451 | _na 442_aa | Permease | |
| 491 | GL892076.1 | GCA000213975_00454 | CDS | open | 513882-514712 | _na 276_aa | TIM-barrel domain-containing protein | |
| 492 | GL892076.1 | GCA000213975_00455 | CDS | open | 514734-515963 | _na 409_aa | ABC superfamily ATP binding cassette transporter permease | |
| 493 | GL892076.1 | GCA000213975_00456 | CDS | open | 516095-517291 | _na 398_aa | araC | AraC family transcriptional regulator |
| 494 | GL892076.1 | GCA000213975_00457 | CDS | open | 517481-517765 | _na 94_aa | sipA | Cell invasion protein SipA |
| 495 | GL892076.1 | GCA000213975_00458 | CDS | open | 517918-518550 | _na 210_aa | N-acetylmuramoyl-L-alanine amidase domain-containing protein | |
| 496 | GL892076.1 | GCA000213975_00459 | CDS | open | 518547-518720 | _na 57_aa | Holin | |
| 497 | GL892076.1 | GCA000213975_00460 | CDS | open | 518893-519072 | _na 59_aa | Chaperonin | |
| 498 | GL892076.1 | GCA000213975_00461 | CDS | open | 519276-519674 | _na 132_aa | DUF559 domain-containing protein | |
| 499 | GL892076.1 | GCA000213975_00462 | CDS | open | 521041-522402 | _na 453_aa | Amino acid carrier protein | |
| 500 | GL892076.1 | GCA000213975_00463 | CDS | open | 522848-523858 | _na 336_aa | Dicarboxylate:H+ TRAP-T family tripartite ATP-independent transporter%2C binding protein |

