HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria weaveri (GCA_000224275.2)

Select a Genome:
BAKTA Annotations for GCA_000224275.2
Genome Selected: Neisseria weaveri
ContigsBases CDSrRNA tmRNAtRNA
40 2125582 1928 3 2 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3983 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3983 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 AFWR01000019.1 GCA000224275_01737 gene open 7432-7974 ahpD
502 AFWR01000019.1 GCA000224275_01738 gene open 8259-10835 mutS
503 AFWR01000019.1 GCA000224275_01739 gene open 10987-12090 prfB
504 AFWR01000019.1 GCA000224275_01740 gene open 12170-14041
505 AFWR01000019.1 GCA000224275_01741 gene open 14230-15033 truC
506 AFWR01000019.1 GCA000224275_01742 gene open 15209-16456 htpX
507 AFWR01000019.1 GCA000224275_01743 gene open 16588-17457 rsgA
508 AFWR01000019.1 GCA000224275_01744 gene open 17676-18404 lytR
509 AFWR01000019.1 GCA000224275_01745 gene open 18542-19825 hemL
510 AFWR01000019.1 GCA000224275_01746 gene open 20625-21098
511 AFWR01000019.1 GCA000224275_01747 gene open 21114-21536
512 AFWR01000019.1 GCA000224275_01748 gene open 21673-22182
513 AFWR01000019.1 GCA000224275_01749 gene open 22390-22465 trnK
514 AFWR01000019.1 GCA000224275_01749 tRNA open 22390-22465 trnK tRNA-Lys(ttt)
515 AFWR01000020.1 regulatory_region open 20260-20304 PreQ1 (pre queuosine) riboswitch aptamer
516 AFWR01000020.1 GCA000224275_01712 CDS open 240-1628 _na     462_aa fumC class II fumarate hydratase
517 AFWR01000020.1 GCA000224275_01713 CDS open 1808-2518 _na     236_aa Oxidative stress defense protein
518 AFWR01000020.1 GCA000224275_01714 CDS open 2609-3415 _na     268_aa Peptidase%2C M48 family
519 AFWR01000020.1 GCA000224275_01715 CDS open 3722-6307 _na     861_aa acnB bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
520 AFWR01000020.1 GCA000224275_01716 CDS open 6528-6875 _na     115_aa PepSY domain-containing protein
521 AFWR01000020.1 GCA000224275_01717 CDS open 7446-8741 _na     431_aa valine--pyruvate transaminase
522 AFWR01000020.1 GCA000224275_01718 CDS open 9296-10177 _na     293_aa Iron ABC superfamily ATP binding cassette transporter%2C binding protein
523 AFWR01000020.1 GCA000224275_01719 CDS open 10177-11106 _na     309_aa Iron ABC superfamily ATP binding cassette transporter%2C ABC protein
524 AFWR01000020.1 GCA000224275_01720 CDS open 11109-11972 _na     287_aa Iron ABC transporter permease
525 AFWR01000020.1 GCA000224275_01721 CDS open 11965-12792 _na     275_aa Membrane protein
526 AFWR01000020.1 GCA000224275_01722 CDS open 13334-14863 _na     509_aa katE Catalase
527 AFWR01000020.1 GCA000224275_01723 CDS open 15157-15549 _na     130_aa glpE Thiosulfate sulfurtransferase glpE
528 AFWR01000020.1 GCA000224275_01724 CDS open 15626-17149 _na     507_aa Fumarate hydratase class I
529 AFWR01000020.1 GCA000224275_01725 CDS open 17393-18793 _na     466_aa trkA Trk system potassium transporter TrkA
530 AFWR01000020.1 GCA000224275_01726 CDS open 18864-19526 _na     220_aa 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter
531 AFWR01000020.1 GCA000224275_01727 CDS open 19782-20255 _na     157_aa queF preQ(1) synthase
532 AFWR01000020.1 GCA000224275_01728 CDS open 20709-21203 _na     164_aa marR Multiple antibiotic resistance protein marR
533 AFWR01000020.1 GCA000224275_01729 CDS open 21252-22565 _na     437_aa ttgC putative efflux pump outer membrane protein ttgC
534 AFWR01000020.1 GCA000224275_01730 CDS open 22635-23801 _na     388_aa Multidrug resistance translocase
535 AFWR01000020.1 GCA000224275_01712 gene open 240-1628 fumC
536 AFWR01000020.1 GCA000224275_01713 gene open 1808-2518
537 AFWR01000020.1 GCA000224275_01714 gene open 2609-3415
538 AFWR01000020.1 GCA000224275_01715 gene open 3722-6307 acnB
539 AFWR01000020.1 GCA000224275_01716 gene open 6528-6875
540 AFWR01000020.1 GCA000224275_01717 gene open 7446-8741
541 AFWR01000020.1 GCA000224275_01718 gene open 9296-10177
542 AFWR01000020.1 GCA000224275_01719 gene open 10177-11106
543 AFWR01000020.1 GCA000224275_01720 gene open 11109-11972
544 AFWR01000020.1 GCA000224275_01721 gene open 11965-12792
545 AFWR01000020.1 GCA000224275_01722 gene open 13334-14863 katE
546 AFWR01000020.1 GCA000224275_01723 gene open 15157-15549 glpE
547 AFWR01000020.1 GCA000224275_01724 gene open 15626-17149
548 AFWR01000020.1 GCA000224275_01725 gene open 17393-18793 trkA
549 AFWR01000020.1 GCA000224275_01726 gene open 18864-19526
550 AFWR01000020.1 GCA000224275_01727 gene open 19782-20255 queF
551 AFWR01000020.1 GCA000224275_01728 gene open 20709-21203 marR
552 AFWR01000020.1 GCA000224275_01729 gene open 21252-22565 ttgC
553 AFWR01000020.1 GCA000224275_01730 gene open 22635-23801
554 AFWR01000021.1 GCA000224275_01683 CDS open 229-1155 _na     308_aa lysR LysR family transcriptional regulator
555 AFWR01000021.1 GCA000224275_01684 CDS open 1326-2411 _na     361_aa hppD 4-hydroxyphenylpyruvate dioxygenase
556 AFWR01000021.1 GCA000224275_01685 CDS open 2521-3066 _na     181_aa Metapyrocatechase
557 AFWR01000021.1 GCA000224275_01686 CDS open 3154-4155 _na     333_aa 2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1%2C7-dioic acid hydratase (Catechol pathway)
558 AFWR01000021.1 GCA000224275_01687 CDS open 4309-5697 _na     462_aa nhaC Na+/H+ antiporter NhaC
559 AFWR01000021.1 GCA000224275_01688 CDS open 5764-6405 _na     213_aa maiA maleylacetoacetate isomerase
560 AFWR01000021.1 GCA000224275_01689 CDS open 6468-7166 _na     232_aa putative succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A
561 AFWR01000021.1 GCA000224275_01690 CDS open 7169-7798 _na     209_aa putative succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B
562 AFWR01000021.1 GCA000224275_01691 CDS open 7885-9066 _na     393_aa Acetyl-CoA acetyltransferase
563 AFWR01000021.1 GCA000224275_01692 CDS open 9531-10565 _na     344_aa hemS Hemin transport protein hemS
564 AFWR01000021.1 GCA000224275_01693 CDS open 10579-11379 _na     266_aa hmuT Hemin-binding periplasmic protein hmuT
565 AFWR01000021.1 GCA000224275_01694 CDS open 11397-12398 _na     333_aa ABC transporter permease%2C enterobactin
566 AFWR01000021.1 GCA000224275_01695 CDS open 12395-13159 _na     254_aa ABC transporter ATP-binding protein
567 AFWR01000021.1 GCA000224275_01696 CDS open 13236-14078 _na     280_aa Glutathione synthetase
568 AFWR01000021.1 GCA000224275_01697 CDS open 14148-14576 _na     142_aa pseudoazurin
569 AFWR01000021.1 GCA000224275_01698 CDS open 14648-15415 _na     255_aa Iron chelate ABC transporter%2C ATP-binding protein
570 AFWR01000021.1 GCA000224275_01699 CDS open 15428-16660 _na     410_aa Vitamin B12-binding protein
571 AFWR01000021.1 GCA000224275_01700 CDS open 16672-17745 _na     357_aa ABC transporter permease%2C enterobactin
572 AFWR01000021.1 GCA000224275_01701 CDS open 17869-18993 _na     374_aa Vitamin B12-binding protein
573 AFWR01000021.1 GCA000224275_01702 CDS open 19263-19715 _na     150_aa dut dUTP diphosphatase
574 AFWR01000021.1 GCA000224275_01703 CDS open 19925-21013 _na     362_aa trmA tRNA (uridine(54)-C5)-methyltransferase TrmA
575 AFWR01000021.1 GCA000224275_01704 CDS open 21121-21612 _na     163_aa ppiB Peptidyl-prolyl cis-trans isomerase
576 AFWR01000021.1 GCA000224275_01705 CDS open 21715-23382 _na     555_aa Glutamate synthase [NADPH] large chain
577 AFWR01000021.1 GCA000224275_01706 CDS open 23728-24705 _na     325_aa mdh malate dehydrogenase
578 AFWR01000021.1 GCA000224275_01707 CDS open 25473-25850 _na     125_aa sdhC succinate dehydrogenase%2C cytochrome b556 subunit
579 AFWR01000021.1 GCA000224275_01708 CDS open 25844-26191 _na     115_aa sdhD succinate dehydrogenase%2C hydrophobic membrane anchor protein
580 AFWR01000021.1 GCA000224275_01709 CDS open 26188-27951 _na     587_aa sdhA succinate dehydrogenase flavoprotein subunit
581 AFWR01000021.1 GCA000224275_01710 CDS open 27965-28672 _na     235_aa sdhB Succinate dehydrogenase iron-sulfur subunit
582 AFWR01000021.1 GCA000224275_01711 CDS open 28675-28923 _na     82_aa sdhE FAD assembly factor SdhE
583 AFWR01000021.1 GCA000224275_01683 gene open 229-1155 lysR
584 AFWR01000021.1 GCA000224275_01684 gene open 1326-2411 hppD
585 AFWR01000021.1 GCA000224275_01685 gene open 2521-3066
586 AFWR01000021.1 GCA000224275_01686 gene open 3154-4155
587 AFWR01000021.1 GCA000224275_01687 gene open 4309-5697 nhaC
588 AFWR01000021.1 GCA000224275_01688 gene open 5764-6405 maiA
589 AFWR01000021.1 GCA000224275_01689 gene open 6468-7166
590 AFWR01000021.1 GCA000224275_01690 gene open 7169-7798
591 AFWR01000021.1 GCA000224275_01691 gene open 7885-9066
592 AFWR01000021.1 GCA000224275_01692 gene open 9531-10565 hemS
593 AFWR01000021.1 GCA000224275_01693 gene open 10579-11379 hmuT
594 AFWR01000021.1 GCA000224275_01694 gene open 11397-12398
595 AFWR01000021.1 GCA000224275_01695 gene open 12395-13159
596 AFWR01000021.1 GCA000224275_01696 gene open 13236-14078
597 AFWR01000021.1 GCA000224275_01697 gene open 14148-14576
598 AFWR01000021.1 GCA000224275_01698 gene open 14648-15415
599 AFWR01000021.1 GCA000224275_01699 gene open 15428-16660
600 AFWR01000021.1 GCA000224275_01700 gene open 16672-17745
601 AFWR01000021.1 GCA000224275_01701 gene open 17869-18993
602 AFWR01000021.1 GCA000224275_01702 gene open 19263-19715 dut
603 AFWR01000021.1 GCA000224275_01703 gene open 19925-21013 trmA
604 AFWR01000021.1 GCA000224275_01704 gene open 21121-21612 ppiB
605 AFWR01000021.1 GCA000224275_01705 gene open 21715-23382
606 AFWR01000021.1 GCA000224275_01706 gene open 23728-24705 mdh
607 AFWR01000021.1 GCA000224275_01707 gene open 25473-25850 sdhC
608 AFWR01000021.1 GCA000224275_01708 gene open 25844-26191 sdhD
609 AFWR01000021.1 GCA000224275_01709 gene open 26188-27951 sdhA
610 AFWR01000021.1 GCA000224275_01710 gene open 27965-28672 sdhB
611 AFWR01000021.1 GCA000224275_01711 gene open 28675-28923 sdhE
612 AFWR01000022.1 GCA000224275_01657 CDS open 108-2225 _na     705_aa VCBS domain-containing protein
613 AFWR01000022.1 GCA000224275_01658 CDS open 2539-4491 _na     650_aa rpoD RNA polymerase sigma factor RpoD
614 AFWR01000022.1 GCA000224275_01659 CDS open 4637-6406 _na     589_aa DNA primase
615 AFWR01000022.1 GCA000224275_01660 CDS open 6462-6908 _na     148_aa GatB/Yqey domain-containing protein
616 AFWR01000022.1 GCA000224275_01661 CDS open 7030-7242 _na     70_aa rpsU 30S ribosomal protein S21
617 AFWR01000022.1 GCA000224275_01662 CDS open 7526-9682 _na     718_aa Guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase
618 AFWR01000022.1 GCA000224275_01663 CDS open 9712-9918 _na     68_aa rpoZ DNA-directed RNA polymerase subunit omega
619 AFWR01000022.1 GCA000224275_01664 CDS open 9982-10599 _na     205_aa gmk guanylate kinase
620 AFWR01000022.1 GCA000224275_01665 CDS open 10754-11320 _na     188_aa adenine phosphoribosyltransferase
621 AFWR01000022.1 GCA000224275_01666 CDS open 11404-12360 _na     318_aa D-alanyl-D-alanine carboxypeptidase
622 AFWR01000022.1 GCA000224275_01667 CDS open 12697-14007 _na     436_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
623 AFWR01000022.1 GCA000224275_01668 CDS open 14127-15014 _na     295_aa Putative spermidine/putrescine transport system permease
624 AFWR01000022.1 GCA000224275_01669 CDS open 15014-15979 _na     321_aa ABC transporter permease%2C polyamine
625 AFWR01000022.1 GCA000224275_01670 CDS open 15992-17116 _na     374_aa potA Spermidine/putrescine import ATP-binding protein PotA
626 AFWR01000022.1 GCA000224275_01671 CDS open 17338-19158 _na     606_aa Para-aminobenzoate synthase component I
627 AFWR01000022.1 GCA000224275_01672 CDS open 19380-20309 _na     309_aa ppk2 polyphosphate kinase 2
628 AFWR01000022.1 GCA000224275_01673 CDS open 20515-20880 _na     121_aa rplS 50S ribosomal protein L19
629 AFWR01000022.1 GCA000224275_01674 CDS open 20894-21652 _na     252_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
630 AFWR01000022.1 GCA000224275_01675 CDS open 21652-22161 _na     169_aa rimM ribosome maturation factor RimM
631 AFWR01000022.1 GCA000224275_01676 CDS open 22170-22418 _na     82_aa rpsP 30S ribosomal protein S16
632 AFWR01000022.1 GCA000224275_01677 CDS open 22473-24716 _na     747_aa Putative N-acetyltransferase
633 AFWR01000022.1 GCA000224275_01678 CDS open 24926-25414 _na     162_aa Dihydrofolate reductase
634 AFWR01000022.1 GCA000224275_01679 CDS open 25513-26082 _na     189_aa azu azurin
635 AFWR01000022.1 GCA000224275_01680 CDS open 26244-26663 _na     139_aa Zn-ribbon-containing%2C possibly RNA-binding protein and truncated derivatives
636 AFWR01000022.1 GCA000224275_01681 CDS open 26798-29554 _na     918_aa secA preprotein translocase subunit SecA
637 AFWR01000022.1 GCA000224275_01682 CDS open 29759-30025 _na     88_aa Transposase
638 AFWR01000022.1 GCA000224275_01657 gene open 108-2225
639 AFWR01000022.1 GCA000224275_01658 gene open 2539-4491 rpoD
640 AFWR01000022.1 GCA000224275_01659 gene open 4637-6406
641 AFWR01000022.1 GCA000224275_01660 gene open 6462-6908
642 AFWR01000022.1 GCA000224275_01661 gene open 7030-7242 rpsU
643 AFWR01000022.1 GCA000224275_01662 gene open 7526-9682
644 AFWR01000022.1 GCA000224275_01663 gene open 9712-9918 rpoZ
645 AFWR01000022.1 GCA000224275_01664 gene open 9982-10599 gmk
646 AFWR01000022.1 GCA000224275_01665 gene open 10754-11320
647 AFWR01000022.1 GCA000224275_01666 gene open 11404-12360
648 AFWR01000022.1 GCA000224275_01667 gene open 12697-14007 clpX
649 AFWR01000022.1 GCA000224275_01668 gene open 14127-15014
650 AFWR01000022.1 GCA000224275_01669 gene open 15014-15979
651 AFWR01000022.1 GCA000224275_01670 gene open 15992-17116 potA
652 AFWR01000022.1 GCA000224275_01671 gene open 17338-19158
653 AFWR01000022.1 GCA000224275_01672 gene open 19380-20309 ppk2
654 AFWR01000022.1 GCA000224275_01673 gene open 20515-20880 rplS
655 AFWR01000022.1 GCA000224275_01674 gene open 20894-21652 trmD
656 AFWR01000022.1 GCA000224275_01675 gene open 21652-22161 rimM
657 AFWR01000022.1 GCA000224275_01676 gene open 22170-22418 rpsP
658 AFWR01000022.1 GCA000224275_01677 gene open 22473-24716
659 AFWR01000022.1 GCA000224275_01678 gene open 24926-25414
660 AFWR01000022.1 GCA000224275_01679 gene open 25513-26082 azu
661 AFWR01000022.1 GCA000224275_01680 gene open 26244-26663
662 AFWR01000022.1 GCA000224275_01681 gene open 26798-29554 secA
663 AFWR01000022.1 GCA000224275_01682 gene open 29759-30025
664 AFWR01000023.1 GCA000224275_01626 CDS open 126-497 _na     123_aa DUF498 DUF598 domains-containing protein
665 AFWR01000023.1 GCA000224275_01627 CDS open 620-1930 _na     436_aa Homoserine dehydrogenase
666 AFWR01000023.1 GCA000224275_01628 CDS open 1923-2348 _na     141_aa Membrane protein
667 AFWR01000023.1 GCA000224275_01629 CDS open 2491-3123 _na     210_aa pdxH pyridoxamine 5'-phosphate oxidase
668 AFWR01000023.1 GCA000224275_01630 CDS open 3215-4036 _na     273_aa hydroxymethylpyrimidine kinase
669 AFWR01000023.1 GCA000224275_01631 CDS open 4180-4995 _na     271_aa Glycosyl transferase family protein
670 AFWR01000023.1 GCA000224275_01632 CDS open 5124-5762 _na     212_aa dedA DedA family protein
671 AFWR01000023.1 GCA000224275_01633 CDS open 5960-6634 _na     224_aa hda DnaA regulatory inactivator Hda
672 AFWR01000023.1 GCA000224275_01634 CDS open 6631-7299 _na     222_aa Putative hydrolase
673 AFWR01000023.1 GCA000224275_01636 CDS open 7876-9114 _na     412_aa icd NADP-dependent isocitrate dehydrogenase
674 AFWR01000023.1 GCA000224275_01637 CDS open 9262-9819 _na     185_aa Pseudouridine synthase
675 AFWR01000023.1 GCA000224275_01638 CDS open 9899-10753 _na     284_aa lgt prolipoprotein diacylglyceryl transferase
676 AFWR01000023.1 GCA000224275_01639 CDS open 11071-12933 _na     620_aa ilvD dihydroxy-acid dehydratase
677 AFWR01000023.1 GCA000224275_01640 CDS open 13138-13821 _na     227_aa putative protein conserved in archaea
678 AFWR01000023.1 GCA000224275_01641 CDS open 13969-14838 _na     289_aa putative inner membrane transporter yiJE
679 AFWR01000023.1 GCA000224275_01642 CDS open 15020-16360 _na     446_aa deoxyguanosinetriphosphate triphosphohydrolase
680 AFWR01000023.1 GCA000224275_01645 CDS open 17052-17750 _na     232_aa VIT family
681 AFWR01000023.1 GCA000224275_01646 CDS open 17967-19649 _na     560_aa glutamine--tRNA ligase/YqeY domain fusion protein
682 AFWR01000023.1 GCA000224275_01647 CDS open 20045-21313 _na     422_aa rho transcription termination factor Rho
683 AFWR01000023.1 GCA000224275_01648 CDS open 21436-23106 _na     556_aa recN DNA repair protein RecN
684 AFWR01000023.1 GCA000224275_01649 CDS open 23416-24240 _na     274_aa ABC transporter periplasmic binding protein%2C amino acid
685 AFWR01000023.1 GCA000224275_01650 CDS open 24263-24946 _na     227_aa ABC transporter permease%2C amino acid
686 AFWR01000023.1 GCA000224275_01651 CDS open 24956-25711 _na     251_aa ABC transporter ATP-binding protein%2C amino acid
687 AFWR01000023.1 GCA000224275_01652 CDS open 25778-26398 _na     206_aa lolA outer membrane lipoprotein chaperone LolA
688 AFWR01000023.1 GCA000224275_01653 CDS open 26718-27590 _na     290_aa putative protein conserved in bacteria
689 AFWR01000023.1 GCA000224275_01654 CDS open 27657-28304 _na     215_aa Phosphatase
690 AFWR01000023.1 GCA000224275_01655 CDS open 28474-29664 _na     396_aa Aminotransferase
691 AFWR01000023.1 GCA000224275_01656 CDS open 29789-30634 _na     281_aa Ribosomal RNA large subunit methyltransferase J
692 AFWR01000023.1 GCA000224275_01626 gene open 126-497
693 AFWR01000023.1 GCA000224275_01627 gene open 620-1930
694 AFWR01000023.1 GCA000224275_01628 gene open 1923-2348
695 AFWR01000023.1 GCA000224275_01629 gene open 2491-3123 pdxH
696 AFWR01000023.1 GCA000224275_01630 gene open 3215-4036
697 AFWR01000023.1 GCA000224275_01631 gene open 4180-4995
698 AFWR01000023.1 GCA000224275_01632 gene open 5124-5762 dedA
699 AFWR01000023.1 GCA000224275_01633 gene open 5960-6634 hda
700 AFWR01000023.1 GCA000224275_01634 gene open 6631-7299
701 AFWR01000023.1 GCA000224275_01636 gene open 7876-9114 icd
702 AFWR01000023.1 GCA000224275_01637 gene open 9262-9819
703 AFWR01000023.1 GCA000224275_01638 gene open 9899-10753 lgt
704 AFWR01000023.1 GCA000224275_01639 gene open 11071-12933 ilvD
705 AFWR01000023.1 GCA000224275_01640 gene open 13138-13821
706 AFWR01000023.1 GCA000224275_01641 gene open 13969-14838
707 AFWR01000023.1 GCA000224275_01642 gene open 15020-16360
708 AFWR01000023.1 GCA000224275_01645 gene open 17052-17750
709 AFWR01000023.1 GCA000224275_01646 gene open 17967-19649
710 AFWR01000023.1 GCA000224275_01647 gene open 20045-21313 rho
711 AFWR01000023.1 GCA000224275_01648 gene open 21436-23106 recN
712 AFWR01000023.1 GCA000224275_01649 gene open 23416-24240
713 AFWR01000023.1 GCA000224275_01650 gene open 24263-24946
714 AFWR01000023.1 GCA000224275_01651 gene open 24956-25711
715 AFWR01000023.1 GCA000224275_01652 gene open 25778-26398 lolA
716 AFWR01000023.1 GCA000224275_01653 gene open 26718-27590
717 AFWR01000023.1 GCA000224275_01654 gene open 27657-28304
718 AFWR01000023.1 GCA000224275_01655 gene open 28474-29664
719 AFWR01000023.1 GCA000224275_01656 gene open 29789-30634
720 AFWR01000023.1 GCA000224275_01635 gene open 7476-7569 trnS
721 AFWR01000023.1 GCA000224275_01643 gene open 16503-16579 trnR
722 AFWR01000023.1 GCA000224275_01644 gene open 16593-16667 trnE
723 AFWR01000023.1 GCA000224275_01635 tRNA open 7476-7569 trnS tRNA-Ser(gct)
724 AFWR01000023.1 GCA000224275_01643 tRNA open 16503-16579 trnR tRNA-Arg(acg)
725 AFWR01000023.1 GCA000224275_01644 tRNA open 16593-16667 trnE tRNA-Glu(ttc)
726 AFWR01000024.1 GCA000224275_01600 CDS open 62-172 _na     36_aa hypothetical protein
727 AFWR01000024.1 GCA000224275_01601 CDS open 424-1242 _na     272_aa Putative phosphoenolpyruvate synthase regulatory protein
728 AFWR01000024.1 GCA000224275_01602 CDS open 1742-4135 _na     797_aa ppsA phosphoenolpyruvate synthase
729 AFWR01000024.1 GCA000224275_01603 CDS open 4282-5433 _na     383_aa Putrescine-binding periplasmic protein
730 AFWR01000024.1 GCA000224275_01604 CDS open 5751-6014 _na     87_aa rpsT 30S ribosomal protein S20
731 AFWR01000024.1 GCA000224275_01605 CDS open 6170-7357 _na     395_aa Phospholipase A1
732 AFWR01000024.1 GCA000224275_01606 CDS open 7449-8126 _na     225_aa Integral membrane protein
733 AFWR01000024.1 GCA000224275_01607 CDS open 8247-10055 _na     602_aa aspS aspartate--tRNA ligase
734 AFWR01000024.1 GCA000224275_01608 CDS open 10295-11821 _na     508_aa Hypothetical periplasmic protein
735 AFWR01000024.1 GCA000224275_01609 CDS open 12006-13010 _na     334_aa Slam-dependent surface lipoprotein
736 AFWR01000024.1 GCA000224275_01610 CDS open 13031-15553 _na     840_aa Hemoglobin-haptoglobin-utilization protein
737 AFWR01000024.1 GCA000224275_01611 CDS open 15625-16227 _na     200_aa Haem utilisation protein
738 AFWR01000024.1 GCA000224275_01612 CDS open 16297-16707 _na     136_aa gloA lactoylglutathione lyase
739 AFWR01000024.1 GCA000224275_01613 CDS open 16979-18514 _na     511_aa Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha
740 AFWR01000024.1 GCA000224275_01614 CDS open 18525-19910 _na     461_aa pntB Re/Si-specific NAD(P)(+) transhydrogenase subunit beta
741 AFWR01000024.1 GCA000224275_01615 CDS open 20003-22648 _na     881_aa DEAD/DEAH box helicase
742 AFWR01000024.1 GCA000224275_01616 CDS open 22850-24469 _na     539_aa site-specific DNA-methyltransferase
743 AFWR01000024.1 GCA000224275_01617 CDS open 24885-26189 _na     434_aa Putative 8-amino-7-oxononanoate synthase
744 AFWR01000024.1 GCA000224275_01618 CDS open 26438-27868 _na     476_aa ccoG cytochrome c oxidase accessory protein CcoG
745 AFWR01000024.1 GCA000224275_01619 CDS open 27870-28424 _na     184_aa Inner membrane protein
746 AFWR01000024.1 GCA000224275_01620 CDS open 28821-31100 _na     759_aa Malic enzyme%2C malate dehydrogenase/oxaloacetate-decarboxylating
747 AFWR01000024.1 GCA000224275_01621 CDS open 31220-32536 _na     438_aa Replication-associated recombination protein A
748 AFWR01000024.1 GCA000224275_01622 CDS open 32623-32814 _na     63_aa hypothetical protein
749 AFWR01000024.1 GCA000224275_01623 CDS open 32886-34298 _na     470_aa thrC threonine synthase
750 AFWR01000024.1 GCA000224275_01624 CDS open 34471-36219 _na     582_aa msbA lipid A export permease/ATP-binding protein MsbA
751 AFWR01000024.1 GCA000224275_01625 CDS open 36291-37067 _na     258_aa fpr ferredoxin--NADP(+) reductase
752 AFWR01000024.1 GCA000224275_01600 gene open 62-172
753 AFWR01000024.1 GCA000224275_01601 gene open 424-1242
754 AFWR01000024.1 GCA000224275_01602 gene open 1742-4135 ppsA
755 AFWR01000024.1 GCA000224275_01603 gene open 4282-5433
756 AFWR01000024.1 GCA000224275_01604 gene open 5751-6014 rpsT
757 AFWR01000024.1 GCA000224275_01605 gene open 6170-7357
758 AFWR01000024.1 GCA000224275_01606 gene open 7449-8126
759 AFWR01000024.1 GCA000224275_01607 gene open 8247-10055 aspS
760 AFWR01000024.1 GCA000224275_01608 gene open 10295-11821
761 AFWR01000024.1 GCA000224275_01609 gene open 12006-13010
762 AFWR01000024.1 GCA000224275_01610 gene open 13031-15553
763 AFWR01000024.1 GCA000224275_01611 gene open 15625-16227
764 AFWR01000024.1 GCA000224275_01612 gene open 16297-16707 gloA
765 AFWR01000024.1 GCA000224275_01613 gene open 16979-18514
766 AFWR01000024.1 GCA000224275_01614 gene open 18525-19910 pntB
767 AFWR01000024.1 GCA000224275_01615 gene open 20003-22648
768 AFWR01000024.1 GCA000224275_01616 gene open 22850-24469
769 AFWR01000024.1 GCA000224275_01617 gene open 24885-26189
770 AFWR01000024.1 GCA000224275_01618 gene open 26438-27868 ccoG
771 AFWR01000024.1 GCA000224275_01619 gene open 27870-28424
772 AFWR01000024.1 GCA000224275_01620 gene open 28821-31100
773 AFWR01000024.1 GCA000224275_01621 gene open 31220-32536
774 AFWR01000024.1 GCA000224275_01622 gene open 32623-32814
775 AFWR01000024.1 GCA000224275_01623 gene open 32886-34298 thrC
776 AFWR01000024.1 GCA000224275_01624 gene open 34471-36219 msbA
777 AFWR01000024.1 GCA000224275_01625 gene open 36291-37067 fpr
778 AFWR01000025.1 GCA000224275_01549 CDS open 41-1717 _na     558_aa fhs formate--tetrahydrofolate ligase
779 AFWR01000025.1 GCA000224275_01550 CDS open 1877-2473 _na     198_aa Periplasmic protein
780 AFWR01000025.1 GCA000224275_01551 CDS open 2634-3281 _na     215_aa Putative psedouridine synthase
781 AFWR01000025.1 GCA000224275_01552 CDS open 3409-4449 _na     346_aa aroG 3-deoxy-7-phosphoheptulonate synthase AroG
782 AFWR01000025.1 GCA000224275_01553 CDS open 4677-5165 _na     162_aa Putative thioredoxin
783 AFWR01000025.1 GCA000224275_01554 CDS open 5162-5557 _na     131_aa Thioesterase family protein
784 AFWR01000025.1 GCA000224275_01555 CDS open 5567-5929 _na     120_aa VacJ-like protein
785 AFWR01000025.1 GCA000224275_01556 CDS open 6071-6946 _na     291_aa Putative VacJ-like protein
786 AFWR01000025.1 GCA000224275_01557 CDS open 6943-7218 _na     91_aa NTP binding protein
787 AFWR01000025.1 GCA000224275_01558 CDS open 7222-7821 _na     199_aa Periplasmic transport protein
788 AFWR01000025.1 GCA000224275_01559 CDS open 7858-8349 _na     163_aa mlaD outer membrane lipid asymmetry maintenance protein MlaD
789 AFWR01000025.1 GCA000224275_01560 CDS open 8355-9131 _na     258_aa mlaE lipid asymmetry maintenance ABC transporter permease subunit MlaE
790 AFWR01000025.1 GCA000224275_01561 CDS open 9319-10116 _na     265_aa ABC transporter ATP-binding protein
791 AFWR01000025.1 GCA000224275_01562 CDS open 10423-11739 _na     438_aa Permease
792 AFWR01000025.1 GCA000224275_01564 CDS open 12558-15995 _na     1145_aa dnaE DNA polymerase III subunit alpha
793 AFWR01000025.1 GCA000224275_01565 CDS open 16116-16430 _na     104_aa arsR ArsR family transcriptional regulator
794 AFWR01000025.1 GCA000224275_01566 CDS open 16607-17158 _na     183_aa ygaP Inner membrane protein ygaP
795 AFWR01000025.1 GCA000224275_01567 CDS open 17204-17398 _na     64_aa DUF2892 domain-containing protein
796 AFWR01000025.1 GCA000224275_01568 CDS open 17577-17810 _na     77_aa Putative RNA-binding protein
797 AFWR01000025.1 GCA000224275_01569 CDS open 17788-17988 _na     66_aa Oxidoreductase-like domain-containing protein
798 AFWR01000025.1 GCA000224275_01570 CDS open 18009-18845 _na     278_aa Putative metal-dependent phosphoesterase
799 AFWR01000025.1 GCA000224275_01571 CDS open 18905-20755 _na     616_aa Protoporphyrinogen oxidase
800 AFWR01000025.1 GCA000224275_01572 CDS open 21041-21418 _na     125_aa Putative adhesin complex protein
801 AFWR01000025.1 GCA000224275_01573 CDS open 21533-22153 _na     206_aa tsaC L-threonylcarbamoyladenylate synthase
802 AFWR01000025.1 GCA000224275_01574 CDS open 22193-22807 _na     204_aa putative peptidase Lmo0363
803 AFWR01000025.1 GCA000224275_01575 CDS open 22846-23508 _na     220_aa Putative metallopeptidase
804 AFWR01000025.1 GCA000224275_01576 CDS open 23533-23868 _na     111_aa Putative endonuclease
805 AFWR01000025.1 GCA000224275_01577 CDS open 24042-25928 _na     628_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
806 AFWR01000025.1 GCA000224275_01578 CDS open 26019-26888 _na     289_aa Quercetin 2%2C3-dioxygenase
807 AFWR01000025.1 GCA000224275_01579 CDS open 26939-27178 _na     79_aa putative protein conserved in bacteria
808 AFWR01000025.1 GCA000224275_01580 CDS open 27290-27691 _na     133_aa hxlR HxlR family transcriptional regulator
809 AFWR01000025.1 GCA000224275_01581 CDS open 27927-30050 _na     707_aa Hemoglobin-haptoglobin-utilization protein
810 AFWR01000025.1 GCA000224275_01582 CDS open 30117-31463 _na     448_aa Poly(3-hydroxybutyrate) depolymerase
811 AFWR01000025.1 GCA000224275_01583 CDS open 31643-33070 _na     475_aa ompU Outer membrane protein OmpU
812 AFWR01000025.1 GCA000224275_01584 CDS open 33171-33899 _na     242_aa Slam-dependent surface lipoprotein
813 AFWR01000025.1 GCA000224275_01585 CDS open 34307-34705 _na     132_aa hypothetical protein
814 AFWR01000025.1 GCA000224275_01586 CDS open 34858-35505 _na     215_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
815 AFWR01000025.1 GCA000224275_01587 CDS open 35616-36383 _na     255_aa parA ParA family protein - ATPase
816 AFWR01000025.1 GCA000224275_01588 CDS open 36543-37037 _na     164_aa putative conserved protein
817 AFWR01000025.1 GCA000224275_01589 CDS open 37113-38360 _na     415_aa Flavoprotein%2C HI0933 family
818 AFWR01000025.1 GCA000224275_01590 CDS open 38512-39372 _na     286_aa Chromosome segregation protein
819 AFWR01000025.1 GCA000224275_01591 CDS open 39668-40021 _na     117_aa ATP synthase I
820 AFWR01000025.1 GCA000224275_01592 CDS open 40026-40877 _na     283_aa atpB F0F1 ATP synthase subunit A
821 AFWR01000025.1 GCA000224275_01593 CDS open 40962-41195 _na     77_aa atpE F0F1 ATP synthase subunit C
822 AFWR01000025.1 GCA000224275_01594 CDS open 41268-41738 _na     156_aa atpF F0F1 ATP synthase subunit B
823 AFWR01000025.1 GCA000224275_01595 CDS open 41743-42276 _na     177_aa F0F1 ATP synthase subunit delta
824 AFWR01000025.1 GCA000224275_01596 CDS open 42287-43834 _na     515_aa atpA F0F1 ATP synthase subunit alpha
825 AFWR01000025.1 GCA000224275_01597 CDS open 43858-44733 _na     291_aa atpG F0F1 ATP synthase subunit gamma
826 AFWR01000025.1 GCA000224275_01598 CDS open 44771-46168 _na     465_aa atpD F0F1 ATP synthase subunit beta
827 AFWR01000025.1 GCA000224275_01599 CDS open 46179-46604 _na     141_aa F0F1 ATP synthase subunit epsilon
828 AFWR01000025.1 GCA000224275_01549 gene open 41-1717 fhs
829 AFWR01000025.1 GCA000224275_01550 gene open 1877-2473
830 AFWR01000025.1 GCA000224275_01551 gene open 2634-3281
831 AFWR01000025.1 GCA000224275_01552 gene open 3409-4449 aroG
832 AFWR01000025.1 GCA000224275_01553 gene open 4677-5165
833 AFWR01000025.1 GCA000224275_01554 gene open 5162-5557
834 AFWR01000025.1 GCA000224275_01555 gene open 5567-5929
835 AFWR01000025.1 GCA000224275_01556 gene open 6071-6946
836 AFWR01000025.1 GCA000224275_01557 gene open 6943-7218
837 AFWR01000025.1 GCA000224275_01558 gene open 7222-7821
838 AFWR01000025.1 GCA000224275_01559 gene open 7858-8349 mlaD
839 AFWR01000025.1 GCA000224275_01560 gene open 8355-9131 mlaE
840 AFWR01000025.1 GCA000224275_01561 gene open 9319-10116
841 AFWR01000025.1 GCA000224275_01562 gene open 10423-11739
842 AFWR01000025.1 GCA000224275_01564 gene open 12558-15995 dnaE
843 AFWR01000025.1 GCA000224275_01565 gene open 16116-16430 arsR
844 AFWR01000025.1 GCA000224275_01566 gene open 16607-17158 ygaP
845 AFWR01000025.1 GCA000224275_01567 gene open 17204-17398
846 AFWR01000025.1 GCA000224275_01568 gene open 17577-17810
847 AFWR01000025.1 GCA000224275_01569 gene open 17788-17988
848 AFWR01000025.1 GCA000224275_01570 gene open 18009-18845
849 AFWR01000025.1 GCA000224275_01571 gene open 18905-20755
850 AFWR01000025.1 GCA000224275_01572 gene open 21041-21418
851 AFWR01000025.1 GCA000224275_01573 gene open 21533-22153 tsaC
852 AFWR01000025.1 GCA000224275_01574 gene open 22193-22807
853 AFWR01000025.1 GCA000224275_01575 gene open 22846-23508
854 AFWR01000025.1 GCA000224275_01576 gene open 23533-23868
855 AFWR01000025.1 GCA000224275_01577 gene open 24042-25928 mnmG
856 AFWR01000025.1 GCA000224275_01578 gene open 26019-26888
857 AFWR01000025.1 GCA000224275_01579 gene open 26939-27178
858 AFWR01000025.1 GCA000224275_01580 gene open 27290-27691 hxlR
859 AFWR01000025.1 GCA000224275_01581 gene open 27927-30050
860 AFWR01000025.1 GCA000224275_01582 gene open 30117-31463
861 AFWR01000025.1 GCA000224275_01583 gene open 31643-33070 ompU
862 AFWR01000025.1 GCA000224275_01584 gene open 33171-33899
863 AFWR01000025.1 GCA000224275_01585 gene open 34307-34705
864 AFWR01000025.1 GCA000224275_01586 gene open 34858-35505 rsmG
865 AFWR01000025.1 GCA000224275_01587 gene open 35616-36383 parA
866 AFWR01000025.1 GCA000224275_01588 gene open 36543-37037
867 AFWR01000025.1 GCA000224275_01589 gene open 37113-38360
868 AFWR01000025.1 GCA000224275_01590 gene open 38512-39372
869 AFWR01000025.1 GCA000224275_01591 gene open 39668-40021
870 AFWR01000025.1 GCA000224275_01592 gene open 40026-40877 atpB
871 AFWR01000025.1 GCA000224275_01593 gene open 40962-41195 atpE
872 AFWR01000025.1 GCA000224275_01594 gene open 41268-41738 atpF
873 AFWR01000025.1 GCA000224275_01595 gene open 41743-42276
874 AFWR01000025.1 GCA000224275_01596 gene open 42287-43834 atpA
875 AFWR01000025.1 GCA000224275_01597 gene open 43858-44733 atpG
876 AFWR01000025.1 GCA000224275_01598 gene open 44771-46168 atpD
877 AFWR01000025.1 GCA000224275_01599 gene open 46179-46604
878 AFWR01000025.1 GCA000224275_01563 gene open 12187-12262 trnF
879 AFWR01000025.1 GCA000224275_01563 tRNA open 12187-12262 trnF tRNA-Phe(gaa)
880 AFWR01000026.1 repeat_region open 251-426 CRISPR array with 3 repeats of length 32%2C consensus sequence TGTTTCAACACACAGCCGCCCGAAGGCGGCTG and spacer length 35
881 AFWR01000026.1 repeat_region open 650-2396 CRISPR array with 27 repeats of length 31%2C consensus sequence GTTTCAACACACAGCCGCCCGAAGGCGGCTG and spacer length 34
882 AFWR01000026.1 GCA000224275_01498 CDS open 2579-2866 _na     95_aa cas2 CRISPR-associated endonuclease Cas2
883 AFWR01000026.1 GCA000224275_01499 CDS open 2951-3964 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
884 AFWR01000026.1 GCA000224275_01500 CDS open 4139-5080 _na     313_aa LPO_1073/Vpar_1526 family protein
885 AFWR01000026.1 GCA000224275_01501 CDS open 5083-5403 _na     106_aa hypothetical protein
886 AFWR01000026.1 GCA000224275_01502 CDS open 5372-5983 _na     203_aa cas4 CRISPR-associated protein Cas4
887 AFWR01000026.1 GCA000224275_01503 CDS open 5987-6850 _na     287_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
888 AFWR01000026.1 GCA000224275_01504 CDS open 6869-8752 _na     627_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
889 AFWR01000026.1 GCA000224275_01505 CDS open 8749-9423 _na     224_aa cas5c type I-C CRISPR-associated protein Cas5c
890 AFWR01000026.1 GCA000224275_01506 CDS open 9532-12225 _na     897_aa Type III restriction enzyme%2C res subunit
891 AFWR01000026.1 GCA000224275_01507 CDS open 12222-12383 _na     53_aa hypothetical protein
892 AFWR01000026.1 GCA000224275_01508 CDS open 12373-13449 _na     358_aa DNA-binding protein
893 AFWR01000026.1 GCA000224275_01509 CDS open 13446-15125 _na     559_aa site-specific DNA-methyltransferase
894 AFWR01000026.1 GCA000224275_01510 CDS open 15125-16735 _na     536_aa Sporadically distributed protein%2C TIGR04141 family
895 AFWR01000026.1 GCA000224275_01511 CDS open 16736-19627 _na     963_aa Putative DEAD/DEAH box helicase
896 AFWR01000026.1 GCA000224275_01512 CDS open 19717-22011 _na     764_aa Superfamily II helicase
897 AFWR01000026.1 GCA000224275_01513 CDS open 22040-22309 _na     89_aa Putative phage-related tail protein
898 AFWR01000026.1 GCA000224275_01514 CDS open 22352-22546 _na     64_aa Phage associated protein
899 AFWR01000026.1 GCA000224275_01515 CDS open 22868-23347 _na     159_aa DUF3465 domain-containing protein
900 AFWR01000026.1 GCA000224275_01516 CDS open 23398-24198 _na     266_aa hypothetical protein
901 AFWR01000026.1 GCA000224275_01517 CDS open 24304-24555 _na     83_aa NGO1151 family protein
902 AFWR01000026.1 GCA000224275_01518 CDS open 24658-25446 _na     262_aa ABC transporter periplasmic histidine-binding protein
903 AFWR01000026.1 GCA000224275_01519 CDS open 25660-26613 _na     317_aa rihB Pyrimidine-specific ribonucleoside hydrolase rihB
904 AFWR01000026.1 GCA000224275_01520 CDS open 26723-29923 _na     1066_aa recC exodeoxyribonuclease V subunit gamma
905 AFWR01000026.1 GCA000224275_01521 CDS open 30062-30763 _na     233_aa rpe ribulose-phosphate 3-epimerase
906 AFWR01000026.1 GCA000224275_01522 CDS open 31064-31438 _na     124_aa Periplasmic protein
907 AFWR01000026.1 GCA000224275_01523 CDS open 31576-33201 _na     541_aa CTP synthase
908 AFWR01000026.1 GCA000224275_01524 CDS open 33544-33909 _na     121_aa putative conserved protein
909 AFWR01000026.1 GCA000224275_01525 CDS open 34049-34909 _na     286_aa Putative aminomethyl transferase
910 AFWR01000026.1 GCA000224275_01526 CDS open 35047-35307 _na     86_aa Acetyltransferase (GNAT) family
911 AFWR01000026.1 GCA000224275_01527 CDS open 35385-36131 _na     248_aa gloB hydroxyacylglutathione hydrolase
912 AFWR01000026.1 GCA000224275_01528 CDS open 36172-36708 _na     178_aa GDP-mannose pyrophosphatase
913 AFWR01000026.1 GCA000224275_01529 CDS open 36788-38080 _na     430_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
914 AFWR01000026.1 GCA000224275_01530 CDS open 38203-38877 _na     224_aa radC DNA repair protein RadC
915 AFWR01000026.1 GCA000224275_01531 CDS open 39028-39510 _na     160_aa Lipoprotein
916 AFWR01000026.1 GCA000224275_01532 CDS open 39679-40611 _na     310_aa cysK cysteine synthase A
917 AFWR01000026.1 GCA000224275_01533 CDS open 40722-41327 _na     201_aa Membrane protein
918 AFWR01000026.1 GCA000224275_01534 CDS open 41447-42298 _na     283_aa dapF diaminopimelate epimerase
919 AFWR01000026.1 GCA000224275_01535 CDS open 42859-43182 _na     107_aa tonB TonB family C-terminal domain
920 AFWR01000026.1 GCA000224275_01536 CDS open 43360-43842 _na     160_aa Lipoprotein
921 AFWR01000026.1 GCA000224275_01537 CDS open 44079-44819 _na     246_aa Periplasmic protein
922 AFWR01000026.1 GCA000224275_01538 CDS open 44821-46164 _na     447_aa Aldehyde dehydrogenase
923 AFWR01000026.1 GCA000224275_01539 CDS open 46391-46651 _na     86_aa Phage associated protein
924 AFWR01000026.1 GCA000224275_01540 CDS open 46654-47064 _na     136_aa putative membrane protein
925 AFWR01000026.1 GCA000224275_01541 CDS open 47301-47612 _na     103_aa DUF883 domain-containing protein
926 AFWR01000026.1 GCA000224275_01542 CDS open 47864-49387 _na     507_aa Propionyl-CoA:succinate CoA transferase
927 AFWR01000026.1 GCA000224275_01543 CDS open 49667-49954 _na     95_aa Membrane protein
928 AFWR01000026.1 GCA000224275_01544 CDS open 50050-51483 _na     477_aa lpdA dihydrolipoyl dehydrogenase
929 AFWR01000026.1 GCA000224275_01545 CDS open 51614-52801 _na     395_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
930 AFWR01000026.1 GCA000224275_01546 CDS open 52864-55695 _na     943_aa 2-oxoglutarate dehydrogenase E1 component
931 AFWR01000026.1 GCA000224275_01547 CDS open 55920-57203 _na     427_aa gltA citrate synthase
932 AFWR01000026.1 GCA000224275_01548 CDS open 57274-58080 _na     268_aa Integrase core domain
933 AFWR01000026.1 GCA000224275_01498 gene open 2579-2866 cas2
934 AFWR01000026.1 GCA000224275_01499 gene open 2951-3964 cas1c
935 AFWR01000026.1 GCA000224275_01500 gene open 4139-5080
936 AFWR01000026.1 GCA000224275_01501 gene open 5083-5403
937 AFWR01000026.1 GCA000224275_01502 gene open 5372-5983 cas4
938 AFWR01000026.1 GCA000224275_01503 gene open 5987-6850 cas7c
939 AFWR01000026.1 GCA000224275_01504 gene open 6869-8752 cas8c
940 AFWR01000026.1 GCA000224275_01505 gene open 8749-9423 cas5c
941 AFWR01000026.1 GCA000224275_01506 gene open 9532-12225
942 AFWR01000026.1 GCA000224275_01507 gene open 12222-12383
943 AFWR01000026.1 GCA000224275_01508 gene open 12373-13449
944 AFWR01000026.1 GCA000224275_01509 gene open 13446-15125
945 AFWR01000026.1 GCA000224275_01510 gene open 15125-16735
946 AFWR01000026.1 GCA000224275_01511 gene open 16736-19627
947 AFWR01000026.1 GCA000224275_01512 gene open 19717-22011
948 AFWR01000026.1 GCA000224275_01513 gene open 22040-22309
949 AFWR01000026.1 GCA000224275_01514 gene open 22352-22546
950 AFWR01000026.1 GCA000224275_01515 gene open 22868-23347
951 AFWR01000026.1 GCA000224275_01516 gene open 23398-24198
952 AFWR01000026.1 GCA000224275_01517 gene open 24304-24555
953 AFWR01000026.1 GCA000224275_01518 gene open 24658-25446
954 AFWR01000026.1 GCA000224275_01519 gene open 25660-26613 rihB
955 AFWR01000026.1 GCA000224275_01520 gene open 26723-29923 recC
956 AFWR01000026.1 GCA000224275_01521 gene open 30062-30763 rpe
957 AFWR01000026.1 GCA000224275_01522 gene open 31064-31438
958 AFWR01000026.1 GCA000224275_01523 gene open 31576-33201
959 AFWR01000026.1 GCA000224275_01524 gene open 33544-33909
960 AFWR01000026.1 GCA000224275_01525 gene open 34049-34909
961 AFWR01000026.1 GCA000224275_01526 gene open 35047-35307
962 AFWR01000026.1 GCA000224275_01527 gene open 35385-36131 gloB
963 AFWR01000026.1 GCA000224275_01528 gene open 36172-36708
964 AFWR01000026.1 GCA000224275_01529 gene open 36788-38080 bioA
965 AFWR01000026.1 GCA000224275_01530 gene open 38203-38877 radC
966 AFWR01000026.1 GCA000224275_01531 gene open 39028-39510
967 AFWR01000026.1 GCA000224275_01532 gene open 39679-40611 cysK
968 AFWR01000026.1 GCA000224275_01533 gene open 40722-41327
969 AFWR01000026.1 GCA000224275_01534 gene open 41447-42298 dapF
970 AFWR01000026.1 GCA000224275_01535 gene open 42859-43182 tonB
971 AFWR01000026.1 GCA000224275_01536 gene open 43360-43842
972 AFWR01000026.1 GCA000224275_01537 gene open 44079-44819
973 AFWR01000026.1 GCA000224275_01538 gene open 44821-46164
974 AFWR01000026.1 GCA000224275_01539 gene open 46391-46651
975 AFWR01000026.1 GCA000224275_01540 gene open 46654-47064
976 AFWR01000026.1 GCA000224275_01541 gene open 47301-47612
977 AFWR01000026.1 GCA000224275_01542 gene open 47864-49387
978 AFWR01000026.1 GCA000224275_01543 gene open 49667-49954
979 AFWR01000026.1 GCA000224275_01544 gene open 50050-51483 lpdA
980 AFWR01000026.1 GCA000224275_01545 gene open 51614-52801 odhB
981 AFWR01000026.1 GCA000224275_01546 gene open 52864-55695
982 AFWR01000026.1 GCA000224275_01547 gene open 55920-57203 gltA
983 AFWR01000026.1 GCA000224275_01548 gene open 57274-58080
984 AFWR01000027.1 GCA000224275_01450 CDS open 2399-3295 _na     298_aa ompA OmpA family protein
985 AFWR01000027.1 GCA000224275_01451 CDS open 3794-7288 _na     1164_aa smc chromosome segregation protein SMC
986 AFWR01000027.1 GCA000224275_01452 CDS open 7387-8970 _na     527_aa Secreted protein
987 AFWR01000027.1 GCA000224275_01453 CDS open 9082-9729 _na     215_aa Lipoprotein
988 AFWR01000027.1 GCA000224275_01454 CDS open 9887-10240 _na     117_aa arsC ArsC family reductase
989 AFWR01000027.1 GCA000224275_01455 CDS open 10391-11254 _na     287_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
990 AFWR01000027.1 GCA000224275_01456 CDS open 11356-12291 _na     311_aa secF Protein-export membrane protein SecF
991 AFWR01000027.1 GCA000224275_01457 CDS open 12297-14153 _na     618_aa secD Protein translocase subunit SecD
992 AFWR01000027.1 GCA000224275_01458 CDS open 14222-14518 _na     98_aa yajC preprotein translocase subunit YajC
993 AFWR01000027.1 GCA000224275_01459 CDS open 14740-15753 _na     337_aa Histone deacetylase family protein
994 AFWR01000027.1 GCA000224275_01460 CDS open 15831-18581 _na     916_aa Right handed beta helix domain-containing protein
995 AFWR01000027.1 GCA000224275_01461 CDS open 19089-20687 _na     532_aa prfC peptide chain release factor 3
996 AFWR01000027.1 GCA000224275_01462 CDS open 20831-21616 _na     261_aa bamD Outer membrane protein assembly factor BamD
997 AFWR01000027.1 GCA000224275_01463 CDS open 21633-22751 _na     372_aa rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
998 AFWR01000027.1 GCA000224275_01464 CDS open 22825-23607 _na     260_aa pgeF peptidoglycan editing factor PgeF
999 AFWR01000027.1 GCA000224275_01465 CDS open 23957-25294 _na     445_aa brnQ branched-chain amino acid transport system II carrier protein
1000 AFWR01000027.1 GCA000224275_01467 CDS open 25737-26780 _na     347_aa argC N-acetyl-gamma-glutamyl-phosphate reductase