HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Haemophilus sputorum (GCA_000238795.2)

Select a Genome:
BAKTA Annotations for GCA_000238795.2
Genome Selected: Haemophilus sputorum
ContigsBases CDSrRNA tmRNAtRNA
87 2143543 2004 4 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4155 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4155 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 AFNK01000001.1 regulatory_region open 28505-28593 TPP riboswitch aptamer (THI element)
2 AFNK01000001.1 regulatory_region open 67160-67272 Alpha operon ribosome binding site
3 AFNK01000001.1 GCA000238795_01980 CDS open 399-1358 _na     319_aa Cold shock domain-containing protein
4 AFNK01000001.1 GCA000238795_01981 CDS open 1597-2226 _na     209_aa DUF417 domain-containing protein
5 AFNK01000001.1 GCA000238795_01982 CDS open 2430-6323 _na     1297_aa purL phosphoribosylformylglycinamidine synthase
6 AFNK01000001.1 GCA000238795_01983 CDS open 6593-7189 _na     198_aa DUF1440 domain-containing protein
7 AFNK01000001.1 GCA000238795_01984 CDS open 7256-8311 _na     351_aa citC [citrate (pro-3S)-lyase] ligase
8 AFNK01000001.1 GCA000238795_01985 CDS open 8325-9944 _na     539_aa Bifunctional UDP-sugar hydrolase/5'-nucleotidase
9 AFNK01000001.1 GCA000238795_01986 CDS open 10196-10741 _na     181_aa Serine hydrolase family protein
10 AFNK01000001.1 GCA000238795_01987 CDS open 10995-12791 _na     598_aa frdA fumarate reductase (quinol) flavoprotein subunit
11 AFNK01000001.1 GCA000238795_01988 CDS open 12806-13576 _na     256_aa sdhB succinate dehydrogenase/fumarate reductase iron-sulfur subunit
12 AFNK01000001.1 GCA000238795_01989 CDS open 13585-13980 _na     131_aa frdC fumarate reductase subunit FrdC
13 AFNK01000001.1 GCA000238795_01990 CDS open 13990-14340 _na     116_aa frdD fumarate reductase subunit FrdD
14 AFNK01000001.1 GCA000238795_01991 CDS open 14461-14577 _na     38_aa lptM LPS translocon maturation chaperone LptM
15 AFNK01000001.1 GCA000238795_01992 CDS open 14655-15911 _na     418_aa lysA diaminopimelate decarboxylase
16 AFNK01000001.1 GCA000238795_01993 CDS open 16031-16600 _na     189_aa nusG transcription termination/antitermination protein NusG
17 AFNK01000001.1 GCA000238795_01994 CDS open 16613-17020 _na     135_aa secE preprotein translocase subunit SecE
18 AFNK01000001.1 GCA000238795_01995 CDS open 17184-18815 _na     543_aa yidC membrane protein insertase YidC
19 AFNK01000001.1 GCA000238795_01996 CDS open 18944-19372 _na     142_aa Hotdog fold thioesterase
20 AFNK01000001.1 GCA000238795_01997 CDS open 19436-22531 _na     1031_aa FAD-binding oxidoreductase
21 AFNK01000001.1 GCA000238795_01998 CDS open 22888-23976 _na     362_aa ompA porin OmpA
22 AFNK01000001.1 GCA000238795_01999 CDS open 24262-25386 _na     374_aa ompA porin OmpA
23 AFNK01000001.1 GCA000238795_02000 CDS open 25519-26016 _na     165_aa YbhB/YbcL family Raf kinase inhibitor-like protein
24 AFNK01000001.1 GCA000238795_02001 CDS open 26079-27071 _na     330_aa asnA aspartate--ammonia ligase
25 AFNK01000001.1 GCA000238795_02002 CDS open 27246-27719 _na     157_aa asnC transcriptional regulator AsnC
26 AFNK01000001.1 GCA000238795_02003 CDS open 27912-28394 _na     160_aa DNA starvation/stationary phase protection protein
27 AFNK01000001.1 GCA000238795_02004 CDS open 28640-29443 _na     267_aa thiM hydroxyethylthiazole kinase
28 AFNK01000001.1 GCA000238795_02005 CDS open 29436-30242 _na     268_aa hydroxymethylpyrimidine kinase
29 AFNK01000001.1 GCA000238795_02006 CDS open 30205-30894 _na     229_aa Thiamine-phosphate synthase
30 AFNK01000001.1 GCA000238795_02007 CDS open 30960-32282 _na     440_aa C4-dicarboxylate transporter
31 AFNK01000001.1 GCA000238795_02008 CDS open 32410-33234 _na     274_aa dapF diaminopimelate epimerase
32 AFNK01000001.1 GCA000238795_02009 CDS open 33646-37674 _na     1342_aa rpoB DNA-directed RNA polymerase subunit beta
33 AFNK01000001.1 GCA000238795_02010 CDS open 37936-42222 _na     1428_aa rpoC DNA-directed RNA polymerase subunit beta'
34 AFNK01000001.1 GCA000238795_02011 CDS open 42307-43122 _na     271_aa DUF4435 domain-containing protein
35 AFNK01000001.1 GCA000238795_02012 CDS open 43112-44395 _na     427_aa ATP-binding protein
36 AFNK01000001.1 GCA000238795_02013 CDS open 44747-44848 _na     33_aa hypothetical protein
37 AFNK01000001.1 GCA000238795_02014 CDS open 44845-45084 _na     79_aa Antitoxin
38 AFNK01000001.1 GCA000238795_02015 CDS open 45194-46057 _na     287_aa cdd cytidine deaminase
39 AFNK01000001.1 GCA000238795_02016 CDS open 46170-46454 _na     94_aa rpoZ DNA-directed RNA polymerase subunit omega
40 AFNK01000001.1 GCA000238795_02017 CDS open 46579-48285 _na     568_aa guanosine-3'%2C5'-bis(diphosphate) 3'-diphosphatase
41 AFNK01000001.1 GCA000238795_02018 CDS open 48357-49112 _na     251_aa wzzE Lipopolysaccharide biosynthesis protein WzzE
42 AFNK01000001.1 GCA000238795_02019 CDS open 49116-50186 _na     356_aa wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
43 AFNK01000001.1 GCA000238795_02020 CDS open 50335-51618 _na     427_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
44 AFNK01000001.1 GCA000238795_02021 CDS open 51822-53531 _na     569_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
45 AFNK01000001.1 GCA000238795_02022 CDS open 53531-54286 _na     251_aa menH 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase
46 AFNK01000001.1 GCA000238795_02023 CDS open 54294-54623 _na     109_aa fluC Fluoride-specific ion channel FluC
47 AFNK01000001.1 GCA000238795_02024 CDS open 54659-55663 _na     334_aa MFS transporter
48 AFNK01000001.1 GCA000238795_02025 CDS open 55806-56930 _na     374_aa anhydro-N-acetylmuramic acid kinase
49 AFNK01000001.1 GCA000238795_02026 CDS open 56941-57855 _na     304_aa murQ N-acetylmuramic acid 6-phosphate etherase
50 AFNK01000001.1 GCA000238795_02027 CDS open 57897-59465 _na     522_aa murJ murein biosynthesis integral membrane protein MurJ
51 AFNK01000001.1 GCA000238795_02028 CDS open 59808-60071 _na     87_aa rpsT 30S ribosomal protein S20
52 AFNK01000001.1 GCA000238795_02029 CDS open 60290-60718 _na     142_aa rplK 50S ribosomal protein L11
53 AFNK01000001.1 GCA000238795_02030 CDS open 60723-61412 _na     229_aa rplA 50S ribosomal protein L1
54 AFNK01000001.1 GCA000238795_02031 CDS open 61586-61957 _na     123_aa rplN 50S ribosomal protein L14
55 AFNK01000001.1 GCA000238795_02032 CDS open 61968-62279 _na     103_aa rplX 50S ribosomal protein L24
56 AFNK01000001.1 GCA000238795_02033 CDS open 62297-62836 _na     179_aa rplE 50S ribosomal protein L5
57 AFNK01000001.1 GCA000238795_02034 CDS open 62863-63153 _na     96_aa rpsN 30S ribosomal protein S14
58 AFNK01000001.1 GCA000238795_02035 CDS open 63190-63582 _na     130_aa rpsH 30S ribosomal protein S8
59 AFNK01000001.1 GCA000238795_02036 CDS open 63599-64132 _na     177_aa rplF 50S ribosomal protein L6
60 AFNK01000001.1 GCA000238795_02037 CDS open 64147-64500 _na     117_aa rplR 50S ribosomal protein L18
61 AFNK01000001.1 GCA000238795_02038 CDS open 64515-65015 _na     166_aa rpsE 30S ribosomal protein S5
62 AFNK01000001.1 GCA000238795_02039 CDS open 65022-65198 _na     58_aa rpmD 50S ribosomal protein L30
63 AFNK01000001.1 GCA000238795_02040 CDS open 65203-65637 _na     144_aa rplO 50S ribosomal protein L15
64 AFNK01000001.1 GCA000238795_02041 CDS open 65641-66966 _na     441_aa secY preprotein translocase subunit SecY
65 AFNK01000001.1 GCA000238795_02042 CDS open 66992-67105 _na     37_aa rpmJ 50S ribosomal protein L36
66 AFNK01000001.1 GCA000238795_02043 CDS open 67240-67596 _na     118_aa rpsM 30S ribosomal protein S13
67 AFNK01000001.1 GCA000238795_02044 CDS open 67613-68002 _na     129_aa rpsK 30S ribosomal protein S11
68 AFNK01000001.1 GCA000238795_02045 CDS open 68031-68657 _na     208_aa rpsD 30S ribosomal protein S4
69 AFNK01000001.1 GCA000238795_02046 CDS open 68724-69713 _na     329_aa rpoA DNA-directed RNA polymerase subunit alpha
70 AFNK01000001.1 GCA000238795_02047 CDS open 69749-70129 _na     126_aa rplQ 50S ribosomal protein L17
71 AFNK01000001.1 GCA000238795_02048 CDS open 70286-71944 _na     552_aa Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain I
72 AFNK01000001.1 GCA000238795_02049 CDS open 71996-72352 _na     118_aa yybR putative HTH-type transcriptional regulator yybR
73 AFNK01000001.1 GCA000238795_02050 CDS open 72519-73370 _na     283_aa NAD(P)H:quinone oxidoreductase
74 AFNK01000001.1 GCA000238795_02051 CDS open 73632-73880 _na     82_aa rpsP 30S ribosomal protein S16
75 AFNK01000001.1 GCA000238795_02052 CDS open 73924-74451 _na     175_aa rimM ribosome maturation factor RimM
76 AFNK01000001.1 GCA000238795_02053 CDS open 74510-75265 _na     251_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
77 AFNK01000001.1 GCA000238795_02054 CDS open 75291-75641 _na     116_aa rplS 50S ribosomal protein L19
78 AFNK01000001.1 GCA000238795_02055 CDS open 75731-78436 _na     901_aa UvrD-helicase domain-containing protein
79 AFNK01000001.1 GCA000238795_02056 CDS open 78816-79673 _na     285_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
80 AFNK01000001.1 GCA000238795_02057 CDS open 79757-82165 _na     802_aa mrcB penicillin-binding protein 1B
81 AFNK01000001.1 GCA000238795_02058 CDS open 82260-83417 _na     385_aa galK galactokinase
82 AFNK01000001.1 GCA000238795_02059 CDS open 83436-84482 _na     348_aa galT galactose-1-phosphate uridylyltransferase
83 AFNK01000001.1 GCA000238795_02060 CDS open 84656-85657 _na     333_aa lacI LacI family DNA-binding transcriptional regulator
84 AFNK01000001.1 GCA000238795_02061 CDS open 85822-86811 _na     329_aa mglB galactose/glucose ABC transporter substrate-binding protein MglB
85 AFNK01000001.1 GCA000238795_02062 CDS open 86876-88396 _na     506_aa mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
86 AFNK01000001.1 GCA000238795_02063 CDS open 88413-89423 _na     336_aa mglC galactose/methyl galactoside ABC transporter permease MglC
87 AFNK01000001.1 GCA000238795_02064 CDS open 89588-90313 _na     241_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
88 AFNK01000001.1 GCA000238795_02065 CDS open 90313-91728 _na     471_aa ftsP Cell division protein FtsP
89 AFNK01000001.1 GCA000238795_02066 CDS open 91864-92817 _na     317_aa accA acetyl-CoA carboxylase carboxyl transferase subunit alpha
90 AFNK01000001.1 GCA000238795_02067 CDS open 92931-94355 _na     474_aa glnA type I glutamate--ammonia ligase
91 AFNK01000001.1 GCA000238795_02068 CDS open 94485-94910 _na     141_aa Lipoprotein
92 AFNK01000001.1 GCA000238795_01980 gene open 399-1358
93 AFNK01000001.1 GCA000238795_01981 gene open 1597-2226
94 AFNK01000001.1 GCA000238795_01982 gene open 2430-6323 purL
95 AFNK01000001.1 GCA000238795_01983 gene open 6593-7189
96 AFNK01000001.1 GCA000238795_01984 gene open 7256-8311 citC
97 AFNK01000001.1 GCA000238795_01985 gene open 8325-9944
98 AFNK01000001.1 GCA000238795_01986 gene open 10196-10741
99 AFNK01000001.1 GCA000238795_01987 gene open 10995-12791 frdA
100 AFNK01000001.1 GCA000238795_01988 gene open 12806-13576 sdhB
101 AFNK01000001.1 GCA000238795_01989 gene open 13585-13980 frdC
102 AFNK01000001.1 GCA000238795_01990 gene open 13990-14340 frdD
103 AFNK01000001.1 GCA000238795_01991 gene open 14461-14577 lptM
104 AFNK01000001.1 GCA000238795_01992 gene open 14655-15911 lysA
105 AFNK01000001.1 GCA000238795_01993 gene open 16031-16600 nusG
106 AFNK01000001.1 GCA000238795_01994 gene open 16613-17020 secE
107 AFNK01000001.1 GCA000238795_01995 gene open 17184-18815 yidC
108 AFNK01000001.1 GCA000238795_01996 gene open 18944-19372
109 AFNK01000001.1 GCA000238795_01997 gene open 19436-22531
110 AFNK01000001.1 GCA000238795_01998 gene open 22888-23976 ompA
111 AFNK01000001.1 GCA000238795_01999 gene open 24262-25386 ompA
112 AFNK01000001.1 GCA000238795_02000 gene open 25519-26016
113 AFNK01000001.1 GCA000238795_02001 gene open 26079-27071 asnA
114 AFNK01000001.1 GCA000238795_02002 gene open 27246-27719 asnC
115 AFNK01000001.1 GCA000238795_02003 gene open 27912-28394
116 AFNK01000001.1 GCA000238795_02004 gene open 28640-29443 thiM
117 AFNK01000001.1 GCA000238795_02005 gene open 29436-30242
118 AFNK01000001.1 GCA000238795_02006 gene open 30205-30894
119 AFNK01000001.1 GCA000238795_02007 gene open 30960-32282
120 AFNK01000001.1 GCA000238795_02008 gene open 32410-33234 dapF
121 AFNK01000001.1 GCA000238795_02009 gene open 33646-37674 rpoB
122 AFNK01000001.1 GCA000238795_02010 gene open 37936-42222 rpoC
123 AFNK01000001.1 GCA000238795_02011 gene open 42307-43122
124 AFNK01000001.1 GCA000238795_02012 gene open 43112-44395
125 AFNK01000001.1 GCA000238795_02013 gene open 44747-44848
126 AFNK01000001.1 GCA000238795_02014 gene open 44845-45084
127 AFNK01000001.1 GCA000238795_02015 gene open 45194-46057 cdd
128 AFNK01000001.1 GCA000238795_02016 gene open 46170-46454 rpoZ
129 AFNK01000001.1 GCA000238795_02017 gene open 46579-48285
130 AFNK01000001.1 GCA000238795_02018 gene open 48357-49112 wzzE
131 AFNK01000001.1 GCA000238795_02019 gene open 49116-50186 wecA
132 AFNK01000001.1 GCA000238795_02020 gene open 50335-51618 hemL
133 AFNK01000001.1 GCA000238795_02021 gene open 51822-53531 menD
134 AFNK01000001.1 GCA000238795_02022 gene open 53531-54286 menH
135 AFNK01000001.1 GCA000238795_02023 gene open 54294-54623 fluC
136 AFNK01000001.1 GCA000238795_02024 gene open 54659-55663
137 AFNK01000001.1 GCA000238795_02025 gene open 55806-56930
138 AFNK01000001.1 GCA000238795_02026 gene open 56941-57855 murQ
139 AFNK01000001.1 GCA000238795_02027 gene open 57897-59465 murJ
140 AFNK01000001.1 GCA000238795_02028 gene open 59808-60071 rpsT
141 AFNK01000001.1 GCA000238795_02029 gene open 60290-60718 rplK
142 AFNK01000001.1 GCA000238795_02030 gene open 60723-61412 rplA
143 AFNK01000001.1 GCA000238795_02031 gene open 61586-61957 rplN
144 AFNK01000001.1 GCA000238795_02032 gene open 61968-62279 rplX
145 AFNK01000001.1 GCA000238795_02033 gene open 62297-62836 rplE
146 AFNK01000001.1 GCA000238795_02034 gene open 62863-63153 rpsN
147 AFNK01000001.1 GCA000238795_02035 gene open 63190-63582 rpsH
148 AFNK01000001.1 GCA000238795_02036 gene open 63599-64132 rplF
149 AFNK01000001.1 GCA000238795_02037 gene open 64147-64500 rplR
150 AFNK01000001.1 GCA000238795_02038 gene open 64515-65015 rpsE
151 AFNK01000001.1 GCA000238795_02039 gene open 65022-65198 rpmD
152 AFNK01000001.1 GCA000238795_02040 gene open 65203-65637 rplO
153 AFNK01000001.1 GCA000238795_02041 gene open 65641-66966 secY
154 AFNK01000001.1 GCA000238795_02042 gene open 66992-67105 rpmJ
155 AFNK01000001.1 GCA000238795_02043 gene open 67240-67596 rpsM
156 AFNK01000001.1 GCA000238795_02044 gene open 67613-68002 rpsK
157 AFNK01000001.1 GCA000238795_02045 gene open 68031-68657 rpsD
158 AFNK01000001.1 GCA000238795_02046 gene open 68724-69713 rpoA
159 AFNK01000001.1 GCA000238795_02047 gene open 69749-70129 rplQ
160 AFNK01000001.1 GCA000238795_02048 gene open 70286-71944
161 AFNK01000001.1 GCA000238795_02049 gene open 71996-72352 yybR
162 AFNK01000001.1 GCA000238795_02050 gene open 72519-73370
163 AFNK01000001.1 GCA000238795_02051 gene open 73632-73880 rpsP
164 AFNK01000001.1 GCA000238795_02052 gene open 73924-74451 rimM
165 AFNK01000001.1 GCA000238795_02053 gene open 74510-75265 trmD
166 AFNK01000001.1 GCA000238795_02054 gene open 75291-75641 rplS
167 AFNK01000001.1 GCA000238795_02055 gene open 75731-78436
168 AFNK01000001.1 GCA000238795_02056 gene open 78816-79673 menB
169 AFNK01000001.1 GCA000238795_02057 gene open 79757-82165 mrcB
170 AFNK01000001.1 GCA000238795_02058 gene open 82260-83417 galK
171 AFNK01000001.1 GCA000238795_02059 gene open 83436-84482 galT
172 AFNK01000001.1 GCA000238795_02060 gene open 84656-85657 lacI
173 AFNK01000001.1 GCA000238795_02061 gene open 85822-86811 mglB
174 AFNK01000001.1 GCA000238795_02062 gene open 86876-88396 mglA
175 AFNK01000001.1 GCA000238795_02063 gene open 88413-89423 mglC
176 AFNK01000001.1 GCA000238795_02064 gene open 89588-90313
177 AFNK01000001.1 GCA000238795_02065 gene open 90313-91728 ftsP
178 AFNK01000001.1 GCA000238795_02066 gene open 91864-92817 accA
179 AFNK01000001.1 GCA000238795_02067 gene open 92931-94355 glnA
180 AFNK01000001.1 GCA000238795_02068 gene open 94485-94910
181 AFNK01000001.1 GCA000238795_02069 gene open 95100-95176 trnR
182 AFNK01000001.1 GCA000238795_02070 gene open 95202-95277 trnH
183 AFNK01000001.1 GCA000238795_02071 gene open 95304-95380 trnP
184 AFNK01000001.1 GCA000238795_02069 tRNA open 95100-95176 trnR tRNA-Arg(ccg)
185 AFNK01000001.1 GCA000238795_02070 tRNA open 95202-95277 trnH tRNA-His(gtg)
186 AFNK01000001.1 GCA000238795_02071 tRNA open 95304-95380 trnP tRNA-Pro(tgg)
187 AFNK01000002.1 GCA000238795_01979 gene open 9092-9207 rrf
188 AFNK01000002.1 GCA000238795_01979 rRNA open 9092-9207 rrf 5S ribosomal RNA
189 AFNK01000002.1 GCA000238795_01968 CDS open 62-868 _na     268_aa murI glutamate racemase
190 AFNK01000002.1 GCA000238795_01969 CDS open 1031-1315 _na     94_aa Antibiotic biosynthesis monooxygenase
191 AFNK01000002.1 GCA000238795_01970 CDS open 1373-2257 _na     294_aa prmA 50S ribosomal protein L11 methyltransferase
192 AFNK01000002.1 GCA000238795_01971 CDS open 2399-2824 _na     141_aa Secreted protein
193 AFNK01000002.1 GCA000238795_01972 CDS open 2866-4326 _na     486_aa tldD metalloprotease TldD
194 AFNK01000002.1 GCA000238795_01973 CDS open 4402-5028 _na     208_aa Glutathione S-transferase family protein
195 AFNK01000002.1 GCA000238795_01974 CDS open 5194-6552 _na     452_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
196 AFNK01000002.1 GCA000238795_01975 CDS open 6655-7920 _na     421_aa tRNA(Ile)-lysidine synthase
197 AFNK01000002.1 GCA000238795_01976 CDS open 7917-8810 _na     297_aa xerD site-specific tyrosine recombinase XerD
198 AFNK01000002.1 GCA000238795_01968 gene open 62-868 murI
199 AFNK01000002.1 GCA000238795_01969 gene open 1031-1315
200 AFNK01000002.1 GCA000238795_01970 gene open 1373-2257 prmA
201 AFNK01000002.1 GCA000238795_01971 gene open 2399-2824
202 AFNK01000002.1 GCA000238795_01972 gene open 2866-4326 tldD
203 AFNK01000002.1 GCA000238795_01973 gene open 4402-5028
204 AFNK01000002.1 GCA000238795_01974 gene open 5194-6552 mnmE
205 AFNK01000002.1 GCA000238795_01975 gene open 6655-7920
206 AFNK01000002.1 GCA000238795_01976 gene open 7917-8810 xerD
207 AFNK01000002.1 GCA000238795_01977 gene open 8890-8965 trnW
208 AFNK01000002.1 GCA000238795_01978 gene open 9003-9079 trnD
209 AFNK01000002.1 GCA000238795_01977 tRNA open 8890-8965 trnW tRNA-Trp(cca)
210 AFNK01000002.1 GCA000238795_01978 tRNA open 9003-9079 trnD tRNA-Asp(gtc)
211 AFNK01000003.1 GCA000238795_01894 CDS open 190-807 _na     205_aa Diadenosine tetraphosphatase
212 AFNK01000003.1 GCA000238795_01897 CDS open 1227-2084 _na     285_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
213 AFNK01000003.1 GCA000238795_01898 CDS open 2319-3914 _na     531_aa L-lactate permease
214 AFNK01000003.1 GCA000238795_01899 CDS open 4071-4808 _na     245_aa glpC Dehydrogenase subunit
215 AFNK01000003.1 GCA000238795_01900 CDS open 4808-6217 _na     469_aa lutB LutB/LldF family L-lactate oxidation iron-sulfur protein
216 AFNK01000003.1 GCA000238795_01901 CDS open 6241-6939 _na     232_aa Lactate utilization protein C
217 AFNK01000003.1 GCA000238795_01902 CDS open 7005-7664 _na     219_aa MOSC domain-containing protein
218 AFNK01000003.1 GCA000238795_01903 CDS open 7661-9289 _na     542_aa rmuC DNA recombination protein RmuC
219 AFNK01000003.1 GCA000238795_01904 CDS open 9291-9653 _na     120_aa psiE phosphate-starvation-inducible protein PsiE
220 AFNK01000003.1 GCA000238795_01905 CDS open 9785-11374 _na     529_aa prfC peptide chain release factor 3
221 AFNK01000003.1 GCA000238795_01906 CDS open 11678-12268 _na     196_aa DUF805 domain-containing protein
222 AFNK01000003.1 GCA000238795_01907 CDS open 12296-12943 _na     215_aa DUF805 domain-containing protein
223 AFNK01000003.1 GCA000238795_01908 CDS open 13034-15328 _na     764_aa TonB-dependent hemoglobin/transferrin/lactoferrin family receptor
224 AFNK01000003.1 GCA000238795_01909 CDS open 15484-16473 _na     329_aa ABC transporter substrate-binding protein
225 AFNK01000003.1 GCA000238795_01910 CDS open 16498-16992 _na     164_aa hutX heme utilization cystosolic carrier protein HutX
226 AFNK01000003.1 GCA000238795_01911 CDS open 17013-17540 _na     175_aa hutZ heme utilization protein HutZ
227 AFNK01000003.1 GCA000238795_01912 CDS open 17653-18546 _na     297_aa asd archaetidylserine decarboxylase
228 AFNK01000003.1 GCA000238795_01913 CDS open 18592-19440 _na     282_aa Alpha/beta hydrolase
229 AFNK01000003.1 GCA000238795_01914 CDS open 19496-21577 _na     693_aa TonB-dependent receptor
230 AFNK01000003.1 GCA000238795_01915 CDS open 21801-24074 _na     757_aa gshB bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB
231 AFNK01000003.1 GCA000238795_01916 CDS open 24177-24551 _na     124_aa Transposase
232 AFNK01000003.1 GCA000238795_01917 CDS open 24593-25354 _na     253_aa IS3 family transposase
233 AFNK01000003.1 GCA000238795_01918 CDS open 25395-27350 _na     651_aa Site-specific recombinase
234 AFNK01000003.1 GCA000238795_01919 CDS open 27466-29958 _na     830_aa DUF2157 domain-containing protein
235 AFNK01000003.1 GCA000238795_01920 CDS open 30006-33464 _na     1152_aa acyl-[ACP]--phospholipid O-acyltransferase
236 AFNK01000003.1 GCA000238795_01921 CDS open 33766-36048 _na     760_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
237 AFNK01000003.1 GCA000238795_01922 CDS open 36268-37146 _na     292_aa metF methylenetetrahydrofolate reductase
238 AFNK01000003.1 GCA000238795_01923 CDS open 37202-37846 _na     214_aa merR MerR family transcriptional regulator
239 AFNK01000003.1 GCA000238795_01924 CDS open 38013-39215 _na     400_aa Aromatic amino acid permease
240 AFNK01000003.1 GCA000238795_01925 CDS open 39293-39790 _na     165_aa rraA ribonuclease E activity regulator RraA
241 AFNK01000003.1 GCA000238795_01926 CDS open 39948-40835 _na     295_aa DUF4189 domain-containing protein
242 AFNK01000003.1 GCA000238795_01927 CDS open 41105-42043 _na     312_aa znuA zinc ABC transporter substrate-binding protein ZnuA
243 AFNK01000003.1 GCA000238795_01928 CDS open 42188-43171 _na     327_aa DUF4163 domain-containing protein
244 AFNK01000003.1 GCA000238795_01929 CDS open 43556-46540 _na     994_aa rne ribonuclease E
245 AFNK01000003.1 GCA000238795_01930 CDS open 46645-47139 _na     164_aa Histone
246 AFNK01000003.1 GCA000238795_01931 CDS open 47209-48927 _na     572_aa dsbD Thiol:disulfide interchange protein DsbD
247 AFNK01000003.1 GCA000238795_01932 CDS open 49165-49899 _na     244_aa artP arginine ABC transporter ATP-binding protein ArtP
248 AFNK01000003.1 GCA000238795_01933 CDS open 49929-50654 _na     241_aa Arginine ABC transporter substrate-binding protein
249 AFNK01000003.1 GCA000238795_01934 CDS open 50656-51330 _na     224_aa artQ arginine ABC transporter permease ArtQ
250 AFNK01000003.1 GCA000238795_01935 CDS open 51330-52013 _na     227_aa artM arginine ABC transporter permease ArtM
251 AFNK01000003.1 GCA000238795_01936 CDS open 52063-53205 _na     380_aa nagA N-acetylglucosamine-6-phosphate deacetylase
252 AFNK01000003.1 GCA000238795_01937 CDS open 53387-53971 _na     194_aa pth aminoacyl-tRNA hydrolase
253 AFNK01000003.1 GCA000238795_01938 CDS open 54007-55098 _na     363_aa ychF redox-regulated ATPase YchF
254 AFNK01000003.1 GCA000238795_01939 CDS open 55170-55511 _na     113_aa erpA iron-sulfur cluster insertion protein ErpA
255 AFNK01000003.1 GCA000238795_01940 CDS open 55668-56456 _na     262_aa Transport permease protein
256 AFNK01000003.1 GCA000238795_01941 CDS open 56456-57187 _na     243_aa tagH BexA
257 AFNK01000003.1 GCA000238795_01942 CDS open 57236-58990 _na     584_aa Glycosyltransferase
258 AFNK01000003.1 GCA000238795_01943 CDS open 59004-60149 _na     381_aa glf UDP-galactopyranose mutase
259 AFNK01000003.1 GCA000238795_01944 CDS open 60222-61148 _na     308_aa Glycosyl transferase
260 AFNK01000003.1 GCA000238795_01945 CDS open 61150-61920 _na     256_aa DUF4422 domain-containing protein
261 AFNK01000003.1 GCA000238795_01946 CDS open 61932-62999 _na     355_aa rfbB dTDP-glucose 4%2C6-dehydratase
262 AFNK01000003.1 GCA000238795_01947 CDS open 63084-64502 _na     472_aa wbaP Undecaprenyl-phosphate galactose phosphotransferase WbaP
263 AFNK01000003.1 GCA000238795_01948 CDS open 64666-66513 _na     615_aa typA translational GTPase TypA
264 AFNK01000003.1 GCA000238795_01949 CDS open 66976-67449 _na     157_aa DMT family transporter
265 AFNK01000003.1 GCA000238795_01950 CDS open 67552-68370 _na     272_aa ABC transporter substrate-binding protein
266 AFNK01000003.1 GCA000238795_01951 CDS open 68710-69657 _na     315_aa cysK cysteine synthase A
267 AFNK01000003.1 GCA000238795_01952 CDS open 69847-71037 _na     396_aa tyrS tyrosine--tRNA ligase
268 AFNK01000003.1 GCA000238795_01953 CDS open 71247-72902 _na     551_aa ilvG acetolactate synthase 2 catalytic subunit
269 AFNK01000003.1 GCA000238795_01954 CDS open 72904-73122 _na     72_aa ilvM acetolactate synthase 2 small subunit
270 AFNK01000003.1 GCA000238795_01955 CDS open 73593-73829 _na     78_aa Dihydroxy-acid dehydratase
271 AFNK01000003.1 GCA000238795_01956 CDS open 73898-74503 _na     201_aa Lipoprotein
272 AFNK01000003.1 GCA000238795_01957 CDS open 74643-75365 _na     240_aa Lipoprotein
273 AFNK01000003.1 GCA000238795_01958 CDS open 75434-75931 _na     165_aa Lipoprotein
274 AFNK01000003.1 GCA000238795_01959 CDS open 76115-77953 _na     612_aa ilvD dihydroxy-acid dehydratase
275 AFNK01000003.1 GCA000238795_01960 CDS open 78047-78382 _na     111_aa glycosyltransferase family 25 protein
276 AFNK01000003.1 GCA000238795_01961 CDS open 78445-78765 _na     106_aa Glycosyltransferase family 25 (LPS biosynthesis protein)
277 AFNK01000003.1 GCA000238795_01962 CDS open 78804-80039 _na     411_aa lapB lipopolysaccharide assembly protein LapB
278 AFNK01000003.1 GCA000238795_01963 CDS open 80098-82125 _na     675_aa ligA NAD-dependent DNA ligase LigA
279 AFNK01000003.1 GCA000238795_01964 CDS open 82189-83088 _na     299_aa zipA cell division protein ZipA
280 AFNK01000003.1 GCA000238795_01965 CDS open 83198-84070 _na     290_aa cysZ sulfate transporter CysZ
281 AFNK01000003.1 GCA000238795_01966 CDS open 84111-84959 _na     282_aa DNA ligase
282 AFNK01000003.1 GCA000238795_01967 CDS open 85069-85905 _na     278_aa DUF5718 domain-containing protein
283 AFNK01000003.1 GCA000238795_01894 gene open 190-807
284 AFNK01000003.1 GCA000238795_01897 gene open 1227-2084
285 AFNK01000003.1 GCA000238795_01898 gene open 2319-3914
286 AFNK01000003.1 GCA000238795_01899 gene open 4071-4808 glpC
287 AFNK01000003.1 GCA000238795_01900 gene open 4808-6217 lutB
288 AFNK01000003.1 GCA000238795_01901 gene open 6241-6939
289 AFNK01000003.1 GCA000238795_01902 gene open 7005-7664
290 AFNK01000003.1 GCA000238795_01903 gene open 7661-9289 rmuC
291 AFNK01000003.1 GCA000238795_01904 gene open 9291-9653 psiE
292 AFNK01000003.1 GCA000238795_01905 gene open 9785-11374 prfC
293 AFNK01000003.1 GCA000238795_01906 gene open 11678-12268
294 AFNK01000003.1 GCA000238795_01907 gene open 12296-12943
295 AFNK01000003.1 GCA000238795_01908 gene open 13034-15328
296 AFNK01000003.1 GCA000238795_01909 gene open 15484-16473
297 AFNK01000003.1 GCA000238795_01910 gene open 16498-16992 hutX
298 AFNK01000003.1 GCA000238795_01911 gene open 17013-17540 hutZ
299 AFNK01000003.1 GCA000238795_01912 gene open 17653-18546 asd
300 AFNK01000003.1 GCA000238795_01913 gene open 18592-19440
301 AFNK01000003.1 GCA000238795_01914 gene open 19496-21577
302 AFNK01000003.1 GCA000238795_01915 gene open 21801-24074 gshB
303 AFNK01000003.1 GCA000238795_01916 gene open 24177-24551
304 AFNK01000003.1 GCA000238795_01917 gene open 24593-25354
305 AFNK01000003.1 GCA000238795_01918 gene open 25395-27350
306 AFNK01000003.1 GCA000238795_01919 gene open 27466-29958
307 AFNK01000003.1 GCA000238795_01920 gene open 30006-33464
308 AFNK01000003.1 GCA000238795_01921 gene open 33766-36048 metE
309 AFNK01000003.1 GCA000238795_01922 gene open 36268-37146 metF
310 AFNK01000003.1 GCA000238795_01923 gene open 37202-37846 merR
311 AFNK01000003.1 GCA000238795_01924 gene open 38013-39215
312 AFNK01000003.1 GCA000238795_01925 gene open 39293-39790 rraA
313 AFNK01000003.1 GCA000238795_01926 gene open 39948-40835
314 AFNK01000003.1 GCA000238795_01927 gene open 41105-42043 znuA
315 AFNK01000003.1 GCA000238795_01928 gene open 42188-43171
316 AFNK01000003.1 GCA000238795_01929 gene open 43556-46540 rne
317 AFNK01000003.1 GCA000238795_01930 gene open 46645-47139
318 AFNK01000003.1 GCA000238795_01931 gene open 47209-48927 dsbD
319 AFNK01000003.1 GCA000238795_01932 gene open 49165-49899 artP
320 AFNK01000003.1 GCA000238795_01933 gene open 49929-50654
321 AFNK01000003.1 GCA000238795_01934 gene open 50656-51330 artQ
322 AFNK01000003.1 GCA000238795_01935 gene open 51330-52013 artM
323 AFNK01000003.1 GCA000238795_01936 gene open 52063-53205 nagA
324 AFNK01000003.1 GCA000238795_01937 gene open 53387-53971 pth
325 AFNK01000003.1 GCA000238795_01938 gene open 54007-55098 ychF
326 AFNK01000003.1 GCA000238795_01939 gene open 55170-55511 erpA
327 AFNK01000003.1 GCA000238795_01940 gene open 55668-56456
328 AFNK01000003.1 GCA000238795_01941 gene open 56456-57187 tagH
329 AFNK01000003.1 GCA000238795_01942 gene open 57236-58990
330 AFNK01000003.1 GCA000238795_01943 gene open 59004-60149 glf
331 AFNK01000003.1 GCA000238795_01944 gene open 60222-61148
332 AFNK01000003.1 GCA000238795_01945 gene open 61150-61920
333 AFNK01000003.1 GCA000238795_01946 gene open 61932-62999 rfbB
334 AFNK01000003.1 GCA000238795_01947 gene open 63084-64502 wbaP
335 AFNK01000003.1 GCA000238795_01948 gene open 64666-66513 typA
336 AFNK01000003.1 GCA000238795_01949 gene open 66976-67449
337 AFNK01000003.1 GCA000238795_01950 gene open 67552-68370
338 AFNK01000003.1 GCA000238795_01951 gene open 68710-69657 cysK
339 AFNK01000003.1 GCA000238795_01952 gene open 69847-71037 tyrS
340 AFNK01000003.1 GCA000238795_01953 gene open 71247-72902 ilvG
341 AFNK01000003.1 GCA000238795_01954 gene open 72904-73122 ilvM
342 AFNK01000003.1 GCA000238795_01955 gene open 73593-73829
343 AFNK01000003.1 GCA000238795_01956 gene open 73898-74503
344 AFNK01000003.1 GCA000238795_01957 gene open 74643-75365
345 AFNK01000003.1 GCA000238795_01958 gene open 75434-75931
346 AFNK01000003.1 GCA000238795_01959 gene open 76115-77953 ilvD
347 AFNK01000003.1 GCA000238795_01960 gene open 78047-78382
348 AFNK01000003.1 GCA000238795_01961 gene open 78445-78765
349 AFNK01000003.1 GCA000238795_01962 gene open 78804-80039 lapB
350 AFNK01000003.1 GCA000238795_01963 gene open 80098-82125 ligA
351 AFNK01000003.1 GCA000238795_01964 gene open 82189-83088 zipA
352 AFNK01000003.1 GCA000238795_01965 gene open 83198-84070 cysZ
353 AFNK01000003.1 GCA000238795_01966 gene open 84111-84959
354 AFNK01000003.1 GCA000238795_01967 gene open 85069-85905
355 AFNK01000003.1 GCA000238795_01893 gene open 50-125 trnV
356 AFNK01000003.1 GCA000238795_01895 gene open 937-1023 trnL
357 AFNK01000003.1 GCA000238795_01896 gene open 1041-1116 trnG
358 AFNK01000003.1 GCA000238795_01893 tRNA open 50-125 trnV tRNA-Val(tac)
359 AFNK01000003.1 GCA000238795_01895 tRNA open 937-1023 trnL tRNA-Leu(taa)
360 AFNK01000003.1 GCA000238795_01896 tRNA open 1041-1116 trnG tRNA-Gly(gcc)
361 AFNK01000004.1 repeat_region open 16245-17102 CRISPR array with 13 repeats of length 36%2C consensus sequence ATTATAGCACTGCGAAATGAAAAAGGGAGCTACAAC and spacer length 30
362 AFNK01000004.1 GCA000238795_01861 CDS open 93-1544 _na     483_aa Aminoacyl-histidine dipeptidase
363 AFNK01000004.1 GCA000238795_01862 CDS open 1601-5074 _na     1157_aa dnaE DNA polymerase III subunit alpha
364 AFNK01000004.1 GCA000238795_01863 CDS open 5126-6208 _na     360_aa lptG LPS export ABC transporter permease LptG
365 AFNK01000004.1 GCA000238795_01864 CDS open 6208-7311 _na     367_aa lptF LPS export ABC transporter permease LptF
366 AFNK01000004.1 GCA000238795_01865 CDS open 7529-9028 _na     499_aa pepA leucyl aminopeptidase
367 AFNK01000004.1 GCA000238795_01866 CDS open 9202-10620 _na     472_aa aspA aspartate ammonia-lyase
368 AFNK01000004.1 GCA000238795_01867 CDS open 10661-11512 _na     283_aa lprI lysozyme inhibitor LprI family protein
369 AFNK01000004.1 GCA000238795_01868 CDS open 11730-14888 _na     1052_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
370 AFNK01000004.1 GCA000238795_01869 CDS open 14945-15862 _na     305_aa cas1 type II CRISPR-associated endonuclease Cas1
371 AFNK01000004.1 GCA000238795_01870 CDS open 15873-16181 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
372 AFNK01000004.1 GCA000238795_01871 CDS open 17188-18381 _na     397_aa Bcr/CflA family multidrug efflux MFS transporter
373 AFNK01000004.1 GCA000238795_01872 CDS open 18381-19073 _na     230_aa rsuA 16S rRNA pseudouridine(516) synthase RsuA
374 AFNK01000004.1 GCA000238795_01873 CDS open 19216-20187 _na     323_aa menC o-succinylbenzoate synthase
375 AFNK01000004.1 GCA000238795_01874 CDS open 20308-22365 _na     685_aa metG methionine--tRNA ligase
376 AFNK01000004.1 GCA000238795_01875 CDS open 22439-22828 _na     129_aa Lipoprotein
377 AFNK01000004.1 GCA000238795_01876 CDS open 23092-27564 _na     1490_aa Autotransporter domain-containing protein
378 AFNK01000004.1 GCA000238795_01877 CDS open 27634-28440 _na     268_aa dppD Leukotoxin translocation ATP-binding protein LktB
379 AFNK01000004.1 GCA000238795_01878 CDS open 28450-30408 _na     652_aa dppC Leukotoxin translocation ATP-binding protein LktB
380 AFNK01000004.1 GCA000238795_01879 CDS open 30408-31361 _na     317_aa dppB ABC transporter permease
381 AFNK01000004.1 GCA000238795_01880 CDS open 31534-33114 _na     526_aa Putative ABC transporter periplasmic binding protein
382 AFNK01000004.1 GCA000238795_01881 CDS open 33327-33920 _na     197_aa Acylneuraminate cytidylyltransferase
383 AFNK01000004.1 GCA000238795_01882 CDS open 33929-34615 _na     228_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
384 AFNK01000004.1 GCA000238795_01883 CDS open 34625-35497 _na     290_aa ROK family protein
385 AFNK01000004.1 GCA000238795_01884 CDS open 35527-36408 _na     293_aa nanA N-acetylneuraminate lyase
386 AFNK01000004.1 GCA000238795_01885 CDS open 36533-37327 _na     264_aa nagB glucosamine-6-phosphate deaminase
387 AFNK01000004.1 GCA000238795_01886 CDS open 37558-39168 _na     536_aa pckA phosphoenolpyruvate carboxykinase (ATP)
388 AFNK01000004.1 GCA000238795_01887 CDS open 39356-40198 _na     280_aa Glycosyltransferase family 8 protein
389 AFNK01000004.1 GCA000238795_01888 CDS open 40221-41195 _na     324_aa Glycosyltransferase family 2 protein
390 AFNK01000004.1 GCA000238795_01889 CDS open 41231-42370 _na     379_aa Glycosyltransferase
391 AFNK01000004.1 GCA000238795_01890 CDS open 42555-43934 _na     459_aa cysS cysteine--tRNA ligase
392 AFNK01000004.1 GCA000238795_01891 CDS open 43975-45222 _na     415_aa multifunctional CCA addition/repair protein
393 AFNK01000004.1 GCA000238795_01892 CDS open 45281-45790 _na     169_aa ppiB Peptidyl-prolyl cis-trans isomerase
394 AFNK01000004.1 GCA000238795_01861 gene open 93-1544
395 AFNK01000004.1 GCA000238795_01862 gene open 1601-5074 dnaE
396 AFNK01000004.1 GCA000238795_01863 gene open 5126-6208 lptG
397 AFNK01000004.1 GCA000238795_01864 gene open 6208-7311 lptF
398 AFNK01000004.1 GCA000238795_01865 gene open 7529-9028 pepA
399 AFNK01000004.1 GCA000238795_01866 gene open 9202-10620 aspA
400 AFNK01000004.1 GCA000238795_01867 gene open 10661-11512 lprI
401 AFNK01000004.1 GCA000238795_01868 gene open 11730-14888 cas9
402 AFNK01000004.1 GCA000238795_01869 gene open 14945-15862 cas1
403 AFNK01000004.1 GCA000238795_01870 gene open 15873-16181 cas2
404 AFNK01000004.1 GCA000238795_01871 gene open 17188-18381
405 AFNK01000004.1 GCA000238795_01872 gene open 18381-19073 rsuA
406 AFNK01000004.1 GCA000238795_01873 gene open 19216-20187 menC
407 AFNK01000004.1 GCA000238795_01874 gene open 20308-22365 metG
408 AFNK01000004.1 GCA000238795_01875 gene open 22439-22828
409 AFNK01000004.1 GCA000238795_01876 gene open 23092-27564
410 AFNK01000004.1 GCA000238795_01877 gene open 27634-28440 dppD
411 AFNK01000004.1 GCA000238795_01878 gene open 28450-30408 dppC
412 AFNK01000004.1 GCA000238795_01879 gene open 30408-31361 dppB
413 AFNK01000004.1 GCA000238795_01880 gene open 31534-33114
414 AFNK01000004.1 GCA000238795_01881 gene open 33327-33920
415 AFNK01000004.1 GCA000238795_01882 gene open 33929-34615
416 AFNK01000004.1 GCA000238795_01883 gene open 34625-35497
417 AFNK01000004.1 GCA000238795_01884 gene open 35527-36408 nanA
418 AFNK01000004.1 GCA000238795_01885 gene open 36533-37327 nagB
419 AFNK01000004.1 GCA000238795_01886 gene open 37558-39168 pckA
420 AFNK01000004.1 GCA000238795_01887 gene open 39356-40198
421 AFNK01000004.1 GCA000238795_01888 gene open 40221-41195
422 AFNK01000004.1 GCA000238795_01889 gene open 41231-42370
423 AFNK01000004.1 GCA000238795_01890 gene open 42555-43934 cysS
424 AFNK01000004.1 GCA000238795_01891 gene open 43975-45222
425 AFNK01000004.1 GCA000238795_01892 gene open 45281-45790 ppiB
426 AFNK01000005.1 GCA000238795_01860 gene open 45-1586 rrs
427 AFNK01000005.1 GCA000238795_01860 rRNA open 45-1586 rrs 16S ribosomal RNA
428 AFNK01000006.1 GCA000238795_01696 CDS open 64-933 _na     289_aa NAD(P)-dependent oxidoreductase
429 AFNK01000006.1 GCA000238795_01697 CDS open 1042-1497 _na     151_aa mgsA methylglyoxal synthase
430 AFNK01000006.1 GCA000238795_01698 CDS open 1621-2895 _na     424_aa thrC threonine synthase
431 AFNK01000006.1 GCA000238795_01699 CDS open 2972-3544 _na     190_aa Flavodoxin family protein
432 AFNK01000006.1 GCA000238795_01700 CDS open 3752-4300 _na     182_aa napF ferredoxin-type protein NapF
433 AFNK01000006.1 GCA000238795_01701 CDS open 4287-4550 _na     87_aa napD Chaperone NapD
434 AFNK01000006.1 GCA000238795_01702 CDS open 4678-7164 _na     828_aa napA nitrate reductase catalytic subunit NapA
435 AFNK01000006.1 GCA000238795_01703 CDS open 7283-8188 _na     301_aa napG ferredoxin-type protein NapG
436 AFNK01000006.1 GCA000238795_01704 CDS open 8188-9078 _na     296_aa napH quinol dehydrogenase ferredoxin subunit NapH
437 AFNK01000006.1 GCA000238795_01705 CDS open 9100-9528 _na     142_aa Periplasmic nitrate reductase%2C electron transfer subunit
438 AFNK01000006.1 GCA000238795_01706 CDS open 9540-10178 _na     212_aa Cytochrome c-type protein
439 AFNK01000006.1 GCA000238795_01707 CDS open 10324-11289 _na     321_aa Sel1 repeat family protein
440 AFNK01000006.1 GCA000238795_01708 CDS open 11374-12549 _na     391_aa cgtA Obg family GTPase CgtA
441 AFNK01000006.1 GCA000238795_01709 CDS open 12693-14420 _na     575_aa argS arginine--tRNA ligase
442 AFNK01000006.1 GCA000238795_01710 CDS open 14452-15057 _na     201_aa VOC family protein
443 AFNK01000006.1 GCA000238795_01711 CDS open 15083-15547 _na     154_aa Glycine zipper 2TM domain-containing protein
444 AFNK01000006.1 GCA000238795_01712 CDS open 15601-15879 _na     92_aa Deoxyribose-phosphate aldolase
445 AFNK01000006.1 GCA000238795_01713 CDS open 15930-17039 _na     369_aa Gfo/Idh/MocA family oxidoreductase
446 AFNK01000006.1 GCA000238795_01714 CDS open 17255-17893 _na     212_aa dsbA thiol:disulfide interchange protein DsbA
447 AFNK01000006.1 GCA000238795_01715 CDS open 18634-19005 _na     123_aa DUF305 domain-containing protein
448 AFNK01000006.1 GCA000238795_01716 CDS open 19135-19281 _na     48_aa hypothetical protein
449 AFNK01000006.1 GCA000238795_01717 CDS open 19422-19691 _na     89_aa DUF1040 domain-containing protein
450 AFNK01000006.1 GCA000238795_01718 CDS open 19795-20871 _na     358_aa mobA molybdenum cofactor guanylyltransferase MobA
451 AFNK01000006.1 GCA000238795_01719 CDS open 20899-21639 _na     246_aa queH Epoxyqueuosine reductase QueH
452 AFNK01000006.1 GCA000238795_01720 CDS open 21659-22642 _na     327_aa ispB octaprenyl diphosphate synthase
453 AFNK01000006.1 GCA000238795_01721 CDS open 22798-23682 _na     294_aa ygfZ tRNA-modifying protein YgfZ
454 AFNK01000006.1 GCA000238795_01722 CDS open 23811-25655 _na     614_aa J domain-containing protein
455 AFNK01000006.1 GCA000238795_01723 CDS open 25665-27374 _na     569_aa dnaK Molecular chaperone DnaK
456 AFNK01000006.1 GCA000238795_01724 CDS open 27500-29386 _na     628_aa mutL DNA mismatch repair endonuclease MutL
457 AFNK01000006.1 GCA000238795_01726 CDS open 29631-30440 _na     269_aa Cof-type HAD-IIB family hydrolase
458 AFNK01000006.1 GCA000238795_01727 CDS open 30564-31241 _na     225_aa Amidophosphoribosyltransferase
459 AFNK01000006.1 GCA000238795_01728 CDS open 31389-32504 _na     371_aa asd aspartate-semialdehyde dehydrogenase
460 AFNK01000006.1 GCA000238795_01729 CDS open 32685-33233 _na     182_aa sodC superoxide dismutase [Cu-Zn] SodC
461 AFNK01000006.1 GCA000238795_01730 CDS open 33328-34671 _na     447_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
462 AFNK01000006.1 GCA000238795_01731 CDS open 34798-35262 _na     154_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
463 AFNK01000006.1 GCA000238795_01732 CDS open 35524-35661 _na     45_aa hypothetical protein
464 AFNK01000006.1 GCA000238795_01733 CDS open 35612-37066 _na     484_aa mltF membrane-bound lytic murein transglycosylase MltF
465 AFNK01000006.1 GCA000238795_01734 CDS open 37076-38374 _na     432_aa FAD-binding oxidoreductase
466 AFNK01000006.1 GCA000238795_01738 CDS open 38962-39480 _na     172_aa Porin family protein
467 AFNK01000006.1 GCA000238795_01739 CDS open 39553-40269 _na     238_aa arcA two-component system response regulator ArcA
468 AFNK01000006.1 GCA000238795_01740 CDS open 40424-41116 _na     230_aa Calcineurin-like phosphoesterase domain-containing protein
469 AFNK01000006.1 GCA000238795_01741 CDS open 41113-42387 _na     424_aa nadR multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR
470 AFNK01000006.1 GCA000238795_01742 CDS open 42607-43560 _na     317_aa ribF bifunctional riboflavin kinase/FAD synthetase
471 AFNK01000006.1 GCA000238795_01743 CDS open 43703-46519 _na     938_aa ileS isoleucine--tRNA ligase
472 AFNK01000006.1 GCA000238795_01744 CDS open 46773-48131 _na     452_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
473 AFNK01000006.1 GCA000238795_01745 CDS open 48219-48959 _na     246_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
474 AFNK01000006.1 GCA000238795_01746 CDS open 48996-52457 _na     1153_aa mfd transcription-repair coupling factor
475 AFNK01000006.1 GCA000238795_01747 CDS open 52577-52870 _na     97_aa DUF406 domain-containing protein
476 AFNK01000006.1 GCA000238795_01748 CDS open 52867-53217 _na     116_aa ridA RidA family protein
477 AFNK01000006.1 GCA000238795_01749 CDS open 53214-53711 _na     165_aa Lipoprotein
478 AFNK01000006.1 GCA000238795_01750 CDS open 53796-54833 _na     345_aa ilvE branched-chain amino acid aminotransferase
479 AFNK01000006.1 GCA000238795_01751 CDS open 54921-55865 _na     314_aa 2-hydroxyacid dehydrogenase
480 AFNK01000006.1 GCA000238795_01752 CDS open 55943-56797 _na     284_aa kdsA 3-deoxy-8-phosphooctulonate synthase
481 AFNK01000006.1 GCA000238795_01753 CDS open 56933-58600 _na     555_aa Anaerobic C4-dicarboxylate transporter
482 AFNK01000006.1 GCA000238795_01754 CDS open 58743-59177 _na     144_aa Isoprenylcysteine carboxylmethyltransferase family protein
483 AFNK01000006.1 GCA000238795_01755 CDS open 59204-60289 _na     361_aa recF DNA replication/repair protein RecF
484 AFNK01000006.1 GCA000238795_01756 CDS open 60356-61459 _na     367_aa dnaN DNA polymerase III subunit beta
485 AFNK01000006.1 GCA000238795_01757 CDS open 61477-62808 _na     443_aa dnaA chromosomal replication initiator protein DnaA
486 AFNK01000006.1 GCA000238795_01758 CDS open 63027-64109 _na     360_aa prfA peptide chain release factor 1
487 AFNK01000006.1 GCA000238795_01759 CDS open 64151-64708 _na     185_aa Lipoprotein
488 AFNK01000006.1 GCA000238795_01760 CDS open 64865-65347 _na     160_aa hypothetical protein
489 AFNK01000006.1 GCA000238795_01761 CDS open 65354-66223 _na     289_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
490 AFNK01000006.1 GCA000238795_01762 CDS open 66223-67086 _na     287_aa sirB1 Protein SirB1 N-terminal domain-containing protein
491 AFNK01000006.1 GCA000238795_01763 CDS open 67257-67664 _na     135_aa soxR putative HTH-type transcriptional regulator HI_0186
492 AFNK01000006.1 GCA000238795_01764 CDS open 67786-68922 _na     378_aa frmA S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase
493 AFNK01000006.1 GCA000238795_01765 CDS open 68931-69758 _na     275_aa fghA S-formylglutathione hydrolase
494 AFNK01000006.1 GCA000238795_01766 CDS open 69883-70836 _na     317_aa corA magnesium/cobalt transporter CorA
495 AFNK01000006.1 GCA000238795_01767 CDS open 71201-71422 _na     73_aa tatA Sec-independent protein translocase subunit TatA
496 AFNK01000006.1 GCA000238795_01768 CDS open 71426-72019 _na     197_aa tatB Sec-independent protein translocase protein TatB
497 AFNK01000006.1 GCA000238795_01769 CDS open 72009-72767 _na     252_aa tatC twin-arginine translocase subunit TatC
498 AFNK01000006.1 GCA000238795_01770 CDS open 72809-73171 _na     120_aa DUF4870 domain-containing protein
499 AFNK01000006.1 GCA000238795_01771 CDS open 73259-74074 _na     271_aa cysE serine O-acetyltransferase
500 AFNK01000006.1 GCA000238795_01772 CDS open 74114-75124 _na     336_aa gpsA NAD(P)H-dependent glycerol-3-phosphate dehydrogenase