BAKTAGenome Explorer: Campylobacter showae (GCA_000344295.2)
Select a Genome:
|
BAKTA Annotations for GCA_000344295.2
|
Search & Sort all 4440 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | AOTD01000229.1 | GCA000344295_01761 | CDS | open | 23834-24511 | _na 225_aa | Putative two-component response regulator | |
| 3502 | AOTD01000229.1 | GCA000344295_01762 | CDS | open | 24508-25725 | _na 405_aa | histidine kinase | |
| 3503 | AOTD01000229.1 | GCA000344295_01763 | CDS | open | 25718-26389 | _na 223_aa | Urease accessory protein UreH-like transmembrane domain-containing protein | |
| 3504 | AOTD01000229.1 | GCA000344295_01764 | CDS | open | 26496-27614 | _na 372_aa | carbamoyl phosphate synthase small subunit | |
| 3505 | AOTD01000229.1 | GCA000344295_01765 | CDS | open | 27611-28162 | _na 183_aa | Competence/damage-inducible domain protein | |
| 3506 | AOTD01000229.1 | GCA000344295_01766 | CDS | open | 28477-29106 | _na 209_aa | mgtE | Magnesium transporter MgtE intracellular domain-containing protein |
| 3507 | AOTD01000229.1 | GCA000344295_01767 | CDS | open | 29103-29531 | _na 142_aa | fliJ | Flagellar FliJ protein |
| 3508 | AOTD01000229.1 | GCA000344295_01768 | CDS | open | 29533-30783 | _na 416_aa | adenylosuccinate synthase | |
| 3509 | AOTD01000229.1 | GCA000344295_01769 | CDS | open | 30780-31649 | _na 289_aa | ATP phosphoribosyltransferase regulatory subunit | |
| 3510 | AOTD01000229.1 | GCA000344295_01770 | CDS | open | 31646-33838 | _na 730_aa | Diguanylate cyclase with PAS sensor(S) | |
| 3511 | AOTD01000229.1 | GCA000344295_01772 | CDS | open | 34172-34780 | _na 202_aa | Phospholipid-binding domain protein | |
| 3512 | AOTD01000229.1 | GCA000344295_01738 | gene | open | 338-658 | |||
| 3513 | AOTD01000229.1 | GCA000344295_01739 | gene | open | 904-1224 | |||
| 3514 | AOTD01000229.1 | GCA000344295_01740 | gene | open | 1326-2471 | ywqK | ||
| 3515 | AOTD01000229.1 | GCA000344295_01741 | gene | open | 2798-2938 | |||
| 3516 | AOTD01000229.1 | GCA000344295_01742 | gene | open | 2987-3739 | |||
| 3517 | AOTD01000229.1 | GCA000344295_01743 | gene | open | 4098-4598 | |||
| 3518 | AOTD01000229.1 | GCA000344295_01744 | gene | open | 4731-8312 | nifJ | ||
| 3519 | AOTD01000229.1 | GCA000344295_01745 | gene | open | 9440-10123 | |||
| 3520 | AOTD01000229.1 | GCA000344295_01746 | gene | open | 10568-11395 | |||
| 3521 | AOTD01000229.1 | GCA000344295_01747 | gene | open | 11416-12414 | ompA | ||
| 3522 | AOTD01000229.1 | GCA000344295_01748 | gene | open | 12559-12948 | rpsI | ||
| 3523 | AOTD01000229.1 | GCA000344295_01749 | gene | open | 12951-13379 | rplM | ||
| 3524 | AOTD01000229.1 | GCA000344295_01750 | gene | open | 13456-16251 | |||
| 3525 | AOTD01000229.1 | GCA000344295_01751 | gene | open | 16248-18830 | addB | ||
| 3526 | AOTD01000229.1 | GCA000344295_01752 | gene | open | 18889-19359 | |||
| 3527 | AOTD01000229.1 | GCA000344295_01753 | gene | open | 19352-19867 | |||
| 3528 | AOTD01000229.1 | GCA000344295_01754 | gene | open | 20193-20294 | |||
| 3529 | AOTD01000229.1 | GCA000344295_01755 | gene | open | 20297-20506 | |||
| 3530 | AOTD01000229.1 | GCA000344295_01756 | gene | open | 20566-21366 | |||
| 3531 | AOTD01000229.1 | GCA000344295_01757 | gene | open | 21366-21587 | ccoQ | ||
| 3532 | AOTD01000229.1 | GCA000344295_01758 | gene | open | 21596-22261 | ccoO | ||
| 3533 | AOTD01000229.1 | GCA000344295_01759 | gene | open | 22254-23468 | ccoN | ||
| 3534 | AOTD01000229.1 | GCA000344295_01760 | gene | open | 23490-23735 | |||
| 3535 | AOTD01000229.1 | GCA000344295_01761 | gene | open | 23834-24511 | |||
| 3536 | AOTD01000229.1 | GCA000344295_01762 | gene | open | 24508-25725 | |||
| 3537 | AOTD01000229.1 | GCA000344295_01763 | gene | open | 25718-26389 | |||
| 3538 | AOTD01000229.1 | GCA000344295_01764 | gene | open | 26496-27614 | |||
| 3539 | AOTD01000229.1 | GCA000344295_01765 | gene | open | 27611-28162 | |||
| 3540 | AOTD01000229.1 | GCA000344295_01766 | gene | open | 28477-29106 | mgtE | ||
| 3541 | AOTD01000229.1 | GCA000344295_01767 | gene | open | 29103-29531 | fliJ | ||
| 3542 | AOTD01000229.1 | GCA000344295_01768 | gene | open | 29533-30783 | |||
| 3543 | AOTD01000229.1 | GCA000344295_01769 | gene | open | 30780-31649 | |||
| 3544 | AOTD01000229.1 | GCA000344295_01770 | gene | open | 31646-33838 | |||
| 3545 | AOTD01000229.1 | GCA000344295_01772 | gene | open | 34172-34780 | |||
| 3546 | AOTD01000229.1 | GCA000344295_01771 | gene | open | 33982-34079 | trnU | ||
| 3547 | AOTD01000229.1 | GCA000344295_01771 | tRNA | open | 33982-34079 | trnU | tRNA-SeC(tca) | |
| 3548 | AOTD01000230.1 | GCA000344295_01773 | CDS | open | 124-789 | _na 221_aa | hypothetical protein | |
| 3549 | AOTD01000230.1 | GCA000344295_01774 | CDS | open | 737-2020 | _na 427_aa | Family 9 glycosyl transferase | |
| 3550 | AOTD01000230.1 | GCA000344295_01775 | CDS | open | 2113-3393 | _na 426_aa | O-antigen polymerase | |
| 3551 | AOTD01000230.1 | GCA000344295_01776 | CDS | open | 3383-4141 | _na 252_aa | Polysaccharide deacetylase | |
| 3552 | AOTD01000230.1 | GCA000344295_01777 | CDS | open | 4284-5075 | _na 263_aa | hypothetical protein | |
| 3553 | AOTD01000230.1 | GCA000344295_01778 | CDS | open | 5730-6818 | _na 362_aa | rfaQ | putative lipopolysaccharide heptosyltransferase III |
| 3554 | AOTD01000230.1 | GCA000344295_01779 | CDS | open | 6815-7588 | _na 257_aa | Glycosyltransferase%2C group 2 family protein | |
| 3555 | AOTD01000230.1 | GCA000344295_01780 | CDS | open | 7582-8475 | _na 297_aa | lipid A biosynthesis lauroyl acyltransferase | |
| 3556 | AOTD01000230.1 | GCA000344295_01781 | CDS | open | 8468-9376 | _na 302_aa | waaC | lipopolysaccharide heptosyltransferase I |
| 3557 | AOTD01000230.1 | GCA000344295_01773 | gene | open | 124-789 | |||
| 3558 | AOTD01000230.1 | GCA000344295_01774 | gene | open | 737-2020 | |||
| 3559 | AOTD01000230.1 | GCA000344295_01775 | gene | open | 2113-3393 | |||
| 3560 | AOTD01000230.1 | GCA000344295_01776 | gene | open | 3383-4141 | |||
| 3561 | AOTD01000230.1 | GCA000344295_01777 | gene | open | 4284-5075 | |||
| 3562 | AOTD01000230.1 | GCA000344295_01778 | gene | open | 5730-6818 | rfaQ | ||
| 3563 | AOTD01000230.1 | GCA000344295_01779 | gene | open | 6815-7588 | |||
| 3564 | AOTD01000230.1 | GCA000344295_01780 | gene | open | 7582-8475 | |||
| 3565 | AOTD01000230.1 | GCA000344295_01781 | gene | open | 8468-9376 | waaC | ||
| 3566 | AOTD01000231.1 | GCA000344295_01782 | CDS | open | 12-1238 | _na 408_aa | lysA | diaminopimelate decarboxylase |
| 3567 | AOTD01000231.1 | GCA000344295_01783 | CDS | open | 1248-2324 | _na 358_aa | pheA | prephenate dehydratase |
| 3568 | AOTD01000231.1 | GCA000344295_01784 | CDS | open | 2326-3426 | _na 366_aa | hisC | histidinol-phosphate transaminase |
| 3569 | AOTD01000231.1 | GCA000344295_01782 | gene | open | 12-1238 | lysA | ||
| 3570 | AOTD01000231.1 | GCA000344295_01783 | gene | open | 1248-2324 | pheA | ||
| 3571 | AOTD01000231.1 | GCA000344295_01784 | gene | open | 2326-3426 | hisC | ||
| 3572 | AOTD01000232.1 | GCA000344295_01785 | CDS | open | 178-882 | _na 234_aa | Serine/threonine protein phosphatase | |
| 3573 | AOTD01000232.1 | GCA000344295_01785 | gene | open | 178-882 | |||
| 3574 | AOTD01000233.1 | GCA000344295_01786 | CDS | open | 429-845 | _na 138_aa | ybeY | rRNA maturation RNase YbeY |
| 3575 | AOTD01000233.1 | GCA000344295_01787 | CDS | open | 1156-2283 | _na 375_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 3576 | AOTD01000233.1 | GCA000344295_01788 | CDS | open | 2280-3080 | _na 266_aa | phosphatidylserine decarboxylase | |
| 3577 | AOTD01000233.1 | GCA000344295_01789 | CDS | open | 3090-3452 | _na 120_aa | hypothetical protein | |
| 3578 | AOTD01000233.1 | GCA000344295_01790 | CDS | open | 3844-4581 | _na 245_aa | DNA alkylation repair enzyme | |
| 3579 | AOTD01000233.1 | GCA000344295_01791 | CDS | open | 4809-5384 | _na 191_aa | Lipoprotein | |
| 3580 | AOTD01000233.1 | GCA000344295_01792 | CDS | open | 5374-6789 | _na 471_aa | beta-lactamase | |
| 3581 | AOTD01000233.1 | GCA000344295_01793 | CDS | open | 7262-8365 | _na 367_aa | ychF | redox-regulated ATPase YchF |
| 3582 | AOTD01000233.1 | GCA000344295_01794 | CDS | open | 8365-9816 | _na 483_aa | leucyl aminopeptidase | |
| 3583 | AOTD01000233.1 | GCA000344295_01795 | CDS | open | 9794-10399 | _na 201_aa | dedA | DedA family protein |
| 3584 | AOTD01000233.1 | GCA000344295_01796 | CDS | open | 10399-10947 | _na 182_aa | apt | adenine phosphoribosyltransferase |
| 3585 | AOTD01000233.1 | GCA000344295_01797 | CDS | open | 10968-11297 | _na 109_aa | Periplasmic protein | |
| 3586 | AOTD01000233.1 | GCA000344295_01798 | CDS | open | 11294-11734 | _na 146_aa | rpiB | ribose 5-phosphate isomerase B |
| 3587 | AOTD01000233.1 | GCA000344295_01799 | CDS | open | 11845-12498 | _na 217_aa | Peptidase%2C M50 family | |
| 3588 | AOTD01000233.1 | GCA000344295_01800 | CDS | open | 12495-13361 | _na 288_aa | lepB | signal peptidase I |
| 3589 | AOTD01000233.1 | GCA000344295_01801 | CDS | open | 13365-14216 | _na 283_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 3590 | AOTD01000233.1 | GCA000344295_01802 | CDS | open | 14299-14655 | _na 118_aa | Cytochrome c domain-containing protein | |
| 3591 | AOTD01000233.1 | GCA000344295_01803 | CDS | open | 14652-16067 | _na 471_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 3592 | AOTD01000233.1 | GCA000344295_01804 | CDS | open | 16067-16345 | _na 92_aa | argJ | Arginine biosynthesis bifunctional protein ArgJ |
| 3593 | AOTD01000233.1 | GCA000344295_01805 | CDS | open | 16342-17058 | _na 238_aa | Integral membrane protein | |
| 3594 | AOTD01000233.1 | GCA000344295_01806 | CDS | open | 17048-18244 | _na 398_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3595 | AOTD01000233.1 | GCA000344295_01807 | CDS | open | 18275-19972 | _na 565_aa | Flagellar hook-length control protein-like C-terminal domain-containing protein | |
| 3596 | AOTD01000233.1 | GCA000344295_01808 | CDS | open | 19975-20244 | _na 89_aa | flhB | FlhB C-terminus-related protein |
| 3597 | AOTD01000233.1 | GCA000344295_01809 | CDS | open | 20252-20533 | _na 93_aa | Plasmid stabilization system protein | |
| 3598 | AOTD01000233.1 | GCA000344295_01810 | CDS | open | 20530-20772 | _na 80_aa | hypothetical protein | |
| 3599 | AOTD01000233.1 | GCA000344295_01811 | CDS | open | 20901-21464 | _na 187_aa | protein-glutamate methylesterase | |
| 3600 | AOTD01000233.1 | GCA000344295_01812 | CDS | open | 21457-22263 | _na 268_aa | protein-glutamate O-methyltransferase | |
| 3601 | AOTD01000233.1 | GCA000344295_01813 | CDS | open | 22401-23603 | _na 400_aa | Putative integral membrane protein | |
| 3602 | AOTD01000233.1 | GCA000344295_01814 | CDS | open | 23643-23951 | _na 102_aa | hypothetical protein | |
| 3603 | AOTD01000233.1 | GCA000344295_01786 | gene | open | 429-845 | ybeY | ||
| 3604 | AOTD01000233.1 | GCA000344295_01787 | gene | open | 1156-2283 | |||
| 3605 | AOTD01000233.1 | GCA000344295_01788 | gene | open | 2280-3080 | |||
| 3606 | AOTD01000233.1 | GCA000344295_01789 | gene | open | 3090-3452 | |||
| 3607 | AOTD01000233.1 | GCA000344295_01790 | gene | open | 3844-4581 | |||
| 3608 | AOTD01000233.1 | GCA000344295_01791 | gene | open | 4809-5384 | |||
| 3609 | AOTD01000233.1 | GCA000344295_01792 | gene | open | 5374-6789 | |||
| 3610 | AOTD01000233.1 | GCA000344295_01793 | gene | open | 7262-8365 | ychF | ||
| 3611 | AOTD01000233.1 | GCA000344295_01794 | gene | open | 8365-9816 | |||
| 3612 | AOTD01000233.1 | GCA000344295_01795 | gene | open | 9794-10399 | dedA | ||
| 3613 | AOTD01000233.1 | GCA000344295_01796 | gene | open | 10399-10947 | apt | ||
| 3614 | AOTD01000233.1 | GCA000344295_01797 | gene | open | 10968-11297 | |||
| 3615 | AOTD01000233.1 | GCA000344295_01798 | gene | open | 11294-11734 | rpiB | ||
| 3616 | AOTD01000233.1 | GCA000344295_01799 | gene | open | 11845-12498 | |||
| 3617 | AOTD01000233.1 | GCA000344295_01800 | gene | open | 12495-13361 | lepB | ||
| 3618 | AOTD01000233.1 | GCA000344295_01801 | gene | open | 13365-14216 | folD | ||
| 3619 | AOTD01000233.1 | GCA000344295_01802 | gene | open | 14299-14655 | |||
| 3620 | AOTD01000233.1 | GCA000344295_01803 | gene | open | 14652-16067 | hemL | ||
| 3621 | AOTD01000233.1 | GCA000344295_01804 | gene | open | 16067-16345 | argJ | ||
| 3622 | AOTD01000233.1 | GCA000344295_01805 | gene | open | 16342-17058 | |||
| 3623 | AOTD01000233.1 | GCA000344295_01806 | gene | open | 17048-18244 | |||
| 3624 | AOTD01000233.1 | GCA000344295_01807 | gene | open | 18275-19972 | |||
| 3625 | AOTD01000233.1 | GCA000344295_01808 | gene | open | 19975-20244 | flhB | ||
| 3626 | AOTD01000233.1 | GCA000344295_01809 | gene | open | 20252-20533 | |||
| 3627 | AOTD01000233.1 | GCA000344295_01810 | gene | open | 20530-20772 | |||
| 3628 | AOTD01000233.1 | GCA000344295_01811 | gene | open | 20901-21464 | |||
| 3629 | AOTD01000233.1 | GCA000344295_01812 | gene | open | 21457-22263 | |||
| 3630 | AOTD01000233.1 | GCA000344295_01813 | gene | open | 22401-23603 | |||
| 3631 | AOTD01000233.1 | GCA000344295_01814 | gene | open | 23643-23951 | |||
| 3632 | AOTD01000234.1 | GCA000344295_01815 | CDS | open | 333-515 | _na 60_aa | Lipoprotein | |
| 3633 | AOTD01000234.1 | GCA000344295_01816 | CDS | open | 521-1102 | _na 193_aa | 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase | |
| 3634 | AOTD01000234.1 | GCA000344295_01817 | CDS | open | 1163-1927 | _na 254_aa | 7-carboxy-7-deazaguanine synthase | |
| 3635 | AOTD01000234.1 | GCA000344295_01818 | CDS | open | 1980-2075 | _na 31_aa | hypothetical protein | |
| 3636 | AOTD01000234.1 | GCA000344295_01819 | CDS | open | 2144-3112 | _na 322_aa | moaA | GTP 3'%2C8-cyclase MoaA |
| 3637 | AOTD01000234.1 | GCA000344295_01820 | CDS | open | 3253-3768 | _na 171_aa | Periplasmic protein | |
| 3638 | AOTD01000234.1 | GCA000344295_01821 | CDS | open | 3761-4279 | _na 172_aa | hypothetical protein | |
| 3639 | AOTD01000234.1 | GCA000344295_01822 | CDS | open | 4276-5142 | _na 288_aa | 4-hydroxybenzoate octaprenyltransferase | |
| 3640 | AOTD01000234.1 | GCA000344295_01815 | gene | open | 333-515 | |||
| 3641 | AOTD01000234.1 | GCA000344295_01816 | gene | open | 521-1102 | |||
| 3642 | AOTD01000234.1 | GCA000344295_01817 | gene | open | 1163-1927 | |||
| 3643 | AOTD01000234.1 | GCA000344295_01818 | gene | open | 1980-2075 | |||
| 3644 | AOTD01000234.1 | GCA000344295_01819 | gene | open | 2144-3112 | moaA | ||
| 3645 | AOTD01000234.1 | GCA000344295_01820 | gene | open | 3253-3768 | |||
| 3646 | AOTD01000234.1 | GCA000344295_01821 | gene | open | 3761-4279 | |||
| 3647 | AOTD01000234.1 | GCA000344295_01822 | gene | open | 4276-5142 | |||
| 3648 | AOTD01000235.1 | GCA000344295_01823 | CDS | open | 720-2111 | _na 463_aa | nhaD | sodium:proton antiporter NhaD |
| 3649 | AOTD01000235.1 | GCA000344295_01824 | CDS | open | 2249-2731 | _na 160_aa | DUF721 domain-containing protein | |
| 3650 | AOTD01000235.1 | GCA000344295_01825 | CDS | open | 2796-4610 | _na 604_aa | uvrC | excinuclease ABC subunit UvrC |
| 3651 | AOTD01000235.1 | GCA000344295_01826 | CDS | open | 4867-5460 | _na 197_aa | beta-lactamase | |
| 3652 | AOTD01000235.1 | GCA000344295_01827 | CDS | open | 5581-6753 | _na 390_aa | dnaJ | molecular chaperone DnaJ |
| 3653 | AOTD01000235.1 | GCA000344295_01828 | CDS | open | 6915-7586 | _na 223_aa | Two-component system response regulator | |
| 3654 | AOTD01000235.1 | GCA000344295_01829 | CDS | open | 7583-8836 | _na 417_aa | arsS | ArsS family sensor histidine kinase |
| 3655 | AOTD01000235.1 | GCA000344295_01830 | CDS | open | 8820-9392 | _na 190_aa | recR | recombination mediator RecR |
| 3656 | AOTD01000235.1 | GCA000344295_01831 | CDS | open | 9666-10721 | _na 351_aa | TRAP transporter solute receptor | |
| 3657 | AOTD01000235.1 | GCA000344295_01832 | CDS | open | 10801-12255 | _na 484_aa | pyk | pyruvate kinase |
| 3658 | AOTD01000235.1 | GCA000344295_01833 | CDS | open | 12231-13046 | _na 271_aa | shikimate dehydrogenase | |
| 3659 | AOTD01000235.1 | GCA000344295_01834 | CDS | open | 13043-13969 | _na 308_aa | SPOR domain-containing protein | |
| 3660 | AOTD01000235.1 | GCA000344295_01835 | CDS | open | 13979-14521 | _na 180_aa | DUF1882 domain-containing protein | |
| 3661 | AOTD01000235.1 | GCA000344295_01836 | CDS | open | 14521-15765 | _na 414_aa | glyA | Serine hydroxymethyltransferase |
| 3662 | AOTD01000235.1 | GCA000344295_01837 | CDS | open | 15765-17270 | _na 501_aa | lysS | lysine--tRNA ligase |
| 3663 | AOTD01000235.1 | GCA000344295_01838 | CDS | open | 17267-17737 | _na 156_aa | Ferric uptake regulation protein | |
| 3664 | AOTD01000235.1 | GCA000344295_01839 | CDS | open | 17737-18330 | _na 197_aa | cvpA | CvpA family protein |
| 3665 | AOTD01000235.1 | GCA000344295_01840 | CDS | open | 18330-19412 | _na 360_aa | Twitching motility protein | |
| 3666 | AOTD01000235.1 | GCA000344295_01841 | CDS | open | 19417-19704 | _na 95_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 3667 | AOTD01000235.1 | GCA000344295_01842 | CDS | open | 19828-20394 | _na 188_aa | Tetratricopeptide repeat-like domain-containing protein | |
| 3668 | AOTD01000235.1 | GCA000344295_01843 | CDS | open | 20391-21401 | _na 336_aa | pgbB | Plasminogen-binding protein PgbB |
| 3669 | AOTD01000235.1 | GCA000344295_01844 | CDS | open | 21398-21730 | _na 110_aa | hypothetical protein | |
| 3670 | AOTD01000235.1 | GCA000344295_01845 | CDS | open | 21717-22346 | _na 209_aa | type III pantothenate kinase | |
| 3671 | AOTD01000235.1 | GCA000344295_01846 | CDS | open | 22340-22948 | _na 202_aa | hisG | ATP phosphoribosyltransferase |
| 3672 | AOTD01000235.1 | GCA000344295_01847 | CDS | open | 23350-25269 | _na 639_aa | Cyclic diguanylate phosphodiesterase domain-containing protein | |
| 3673 | AOTD01000235.1 | GCA000344295_01848 | CDS | open | 25337-25930 | _na 197_aa | lysE | Translocator protein%2C LysE family |
| 3674 | AOTD01000235.1 | GCA000344295_01823 | gene | open | 720-2111 | nhaD | ||
| 3675 | AOTD01000235.1 | GCA000344295_01824 | gene | open | 2249-2731 | |||
| 3676 | AOTD01000235.1 | GCA000344295_01825 | gene | open | 2796-4610 | uvrC | ||
| 3677 | AOTD01000235.1 | GCA000344295_01826 | gene | open | 4867-5460 | |||
| 3678 | AOTD01000235.1 | GCA000344295_01827 | gene | open | 5581-6753 | dnaJ | ||
| 3679 | AOTD01000235.1 | GCA000344295_01828 | gene | open | 6915-7586 | |||
| 3680 | AOTD01000235.1 | GCA000344295_01829 | gene | open | 7583-8836 | arsS | ||
| 3681 | AOTD01000235.1 | GCA000344295_01830 | gene | open | 8820-9392 | recR | ||
| 3682 | AOTD01000235.1 | GCA000344295_01831 | gene | open | 9666-10721 | |||
| 3683 | AOTD01000235.1 | GCA000344295_01832 | gene | open | 10801-12255 | pyk | ||
| 3684 | AOTD01000235.1 | GCA000344295_01833 | gene | open | 12231-13046 | |||
| 3685 | AOTD01000235.1 | GCA000344295_01834 | gene | open | 13043-13969 | |||
| 3686 | AOTD01000235.1 | GCA000344295_01835 | gene | open | 13979-14521 | |||
| 3687 | AOTD01000235.1 | GCA000344295_01836 | gene | open | 14521-15765 | glyA | ||
| 3688 | AOTD01000235.1 | GCA000344295_01837 | gene | open | 15765-17270 | lysS | ||
| 3689 | AOTD01000235.1 | GCA000344295_01838 | gene | open | 17267-17737 | |||
| 3690 | AOTD01000235.1 | GCA000344295_01839 | gene | open | 17737-18330 | cvpA | ||
| 3691 | AOTD01000235.1 | GCA000344295_01840 | gene | open | 18330-19412 | |||
| 3692 | AOTD01000235.1 | GCA000344295_01841 | gene | open | 19417-19704 | gatC | ||
| 3693 | AOTD01000235.1 | GCA000344295_01842 | gene | open | 19828-20394 | |||
| 3694 | AOTD01000235.1 | GCA000344295_01843 | gene | open | 20391-21401 | pgbB | ||
| 3695 | AOTD01000235.1 | GCA000344295_01844 | gene | open | 21398-21730 | |||
| 3696 | AOTD01000235.1 | GCA000344295_01845 | gene | open | 21717-22346 | |||
| 3697 | AOTD01000235.1 | GCA000344295_01846 | gene | open | 22340-22948 | hisG | ||
| 3698 | AOTD01000235.1 | GCA000344295_01847 | gene | open | 23350-25269 | |||
| 3699 | AOTD01000235.1 | GCA000344295_01848 | gene | open | 25337-25930 | lysE | ||
| 3700 | AOTD01000236.1 | GCA000344295_01849 | CDS | open | 216-1157 | _na 313_aa | accA | acetyl-CoA carboxylase carboxyl transferase subunit alpha |
| 3701 | AOTD01000236.1 | GCA000344295_01850 | CDS | open | 1157-2365 | _na 402_aa | beta-ketoacyl-ACP synthase II | |
| 3702 | AOTD01000236.1 | GCA000344295_01851 | CDS | open | 2385-2618 | _na 77_aa | acpP | acyl carrier protein |
| 3703 | AOTD01000236.1 | GCA000344295_01852 | CDS | open | 2699-3442 | _na 247_aa | fabG | 3-oxoacyl-ACP reductase FabG |
| 3704 | AOTD01000236.1 | GCA000344295_01853 | CDS | open | 3539-3898 | _na 119_aa | 30S ribosomal protein S8 | |
| 3705 | AOTD01000236.1 | GCA000344295_01854 | CDS | open | 3895-4497 | _na 200_aa | DNA-3-methyladenine glycosylase I | |
| 3706 | AOTD01000236.1 | GCA000344295_01849 | gene | open | 216-1157 | accA | ||
| 3707 | AOTD01000236.1 | GCA000344295_01850 | gene | open | 1157-2365 | |||
| 3708 | AOTD01000236.1 | GCA000344295_01851 | gene | open | 2385-2618 | acpP | ||
| 3709 | AOTD01000236.1 | GCA000344295_01852 | gene | open | 2699-3442 | fabG | ||
| 3710 | AOTD01000236.1 | GCA000344295_01853 | gene | open | 3539-3898 | |||
| 3711 | AOTD01000236.1 | GCA000344295_01854 | gene | open | 3895-4497 | |||
| 3712 | AOTD01000237.1 | GCA000344295_01855 | CDS | open | 225-965 | _na 246_aa | DUF2314 domain-containing protein | |
| 3713 | AOTD01000237.1 | GCA000344295_01856 | CDS | open | 1001-2317 | _na 438_aa | ABC transporter permease | |
| 3714 | AOTD01000237.1 | GCA000344295_01857 | CDS | open | 2502-3866 | _na 454_aa | coproporphyrinogen III oxidase family protein | |
| 3715 | AOTD01000237.1 | GCA000344295_01858 | CDS | open | 4034-6298 | _na 754_aa | Dynamin family | |
| 3716 | AOTD01000237.1 | GCA000344295_01859 | CDS | open | 6291-8126 | _na 611_aa | GTP-binding protein | |
| 3717 | AOTD01000237.1 | GCA000344295_01860 | CDS | open | 8237-8401 | _na 54_aa | hypothetical protein | |
| 3718 | AOTD01000237.1 | GCA000344295_01861 | CDS | open | 8613-10340 | _na 575_aa | ftsH | Cell division protein FtsH |
| 3719 | AOTD01000237.1 | GCA000344295_01862 | CDS | open | 10340-11884 | _na 514_aa | Long-chain-fatty-acid--CoA ligase | |
| 3720 | AOTD01000237.1 | GCA000344295_01863 | CDS | open | 11894-12985 | _na 363_aa | Outer membrane protein transport protein%2C Ompp1/FadL/TodX family | |
| 3721 | AOTD01000237.1 | GCA000344295_01855 | gene | open | 225-965 | |||
| 3722 | AOTD01000237.1 | GCA000344295_01856 | gene | open | 1001-2317 | |||
| 3723 | AOTD01000237.1 | GCA000344295_01857 | gene | open | 2502-3866 | |||
| 3724 | AOTD01000237.1 | GCA000344295_01858 | gene | open | 4034-6298 | |||
| 3725 | AOTD01000237.1 | GCA000344295_01859 | gene | open | 6291-8126 | |||
| 3726 | AOTD01000237.1 | GCA000344295_01860 | gene | open | 8237-8401 | |||
| 3727 | AOTD01000237.1 | GCA000344295_01861 | gene | open | 8613-10340 | ftsH | ||
| 3728 | AOTD01000237.1 | GCA000344295_01862 | gene | open | 10340-11884 | |||
| 3729 | AOTD01000237.1 | GCA000344295_01863 | gene | open | 11894-12985 | |||
| 3730 | AOTD01000238.1 | GCA000344295_01864 | CDS | open | 418-1329 | _na 303_aa | Transporter%2C auxin efflux carrier (AEC) family protein | |
| 3731 | AOTD01000238.1 | GCA000344295_01865 | CDS | open | 1394-1639 | _na 81_aa | Pentapeptide MXKDX repeat protein | |
| 3732 | AOTD01000238.1 | GCA000344295_01866 | CDS | open | 1639-2301 | _na 220_aa | Response regulator receiver domain protein | |
| 3733 | AOTD01000238.1 | GCA000344295_01867 | CDS | open | 2294-2620 | _na 108_aa | hypothetical protein | |
| 3734 | AOTD01000238.1 | GCA000344295_01868 | CDS | open | 2617-3465 | _na 282_aa | HAMP domain-containing sensor histidine kinase | |
| 3735 | AOTD01000238.1 | GCA000344295_01869 | CDS | open | 3552-4550 | _na 332_aa | hypothetical protein | |
| 3736 | AOTD01000238.1 | GCA000344295_01864 | gene | open | 418-1329 | |||
| 3737 | AOTD01000238.1 | GCA000344295_01865 | gene | open | 1394-1639 | |||
| 3738 | AOTD01000238.1 | GCA000344295_01866 | gene | open | 1639-2301 | |||
| 3739 | AOTD01000238.1 | GCA000344295_01867 | gene | open | 2294-2620 | |||
| 3740 | AOTD01000238.1 | GCA000344295_01868 | gene | open | 2617-3465 | |||
| 3741 | AOTD01000238.1 | GCA000344295_01869 | gene | open | 3552-4550 | |||
| 3742 | AOTD01000239.1 | GCA000344295_01870 | CDS | open | 54-1031 | _na 325_aa | creD | cell envelope integrity protein CreD |
| 3743 | AOTD01000239.1 | GCA000344295_01871 | CDS | open | 1049-1201 | _na 50_aa | hypothetical protein | |
| 3744 | AOTD01000239.1 | GCA000344295_01870 | gene | open | 54-1031 | creD | ||
| 3745 | AOTD01000239.1 | GCA000344295_01871 | gene | open | 1049-1201 | |||
| 3746 | AOTD01000240.1 | GCA000344295_01872 | CDS | open | 7-810 | _na 267_aa | SPFH/Band 7/PHB domain protein | |
| 3747 | AOTD01000240.1 | GCA000344295_01873 | CDS | open | 807-1205 | _na 132_aa | NfeD-like C-terminal domain-containing protein | |
| 3748 | AOTD01000240.1 | GCA000344295_01874 | CDS | open | 1257-1547 | _na 96_aa | YCII-related domain-containing protein | |
| 3749 | AOTD01000240.1 | GCA000344295_01875 | CDS | open | 2291-2662 | _na 123_aa | Lipoprotein | |
| 3750 | AOTD01000240.1 | GCA000344295_01876 | CDS | open | 3001-4050 | _na 349_aa | dehypoxanthine futalosine cyclase | |
| 3751 | AOTD01000240.1 | GCA000344295_01877 | CDS | open | 4050-5273 | _na 407_aa | Peptidase M16 inactive domain protein | |
| 3752 | AOTD01000240.1 | GCA000344295_01878 | CDS | open | 5263-7185 | _na 640_aa | recG | ATP-dependent DNA helicase RecG |
| 3753 | AOTD01000240.1 | GCA000344295_01872 | gene | open | 7-810 | |||
| 3754 | AOTD01000240.1 | GCA000344295_01873 | gene | open | 807-1205 | |||
| 3755 | AOTD01000240.1 | GCA000344295_01874 | gene | open | 1257-1547 | |||
| 3756 | AOTD01000240.1 | GCA000344295_01875 | gene | open | 2291-2662 | |||
| 3757 | AOTD01000240.1 | GCA000344295_01876 | gene | open | 3001-4050 | |||
| 3758 | AOTD01000240.1 | GCA000344295_01877 | gene | open | 4050-5273 | |||
| 3759 | AOTD01000240.1 | GCA000344295_01878 | gene | open | 5263-7185 | recG | ||
| 3760 | AOTD01000240.1 | GCA000344295_01879 | gene | open | 7550-7624 | trnE | ||
| 3761 | AOTD01000240.1 | GCA000344295_01880 | gene | open | 7645-7720 | trnK | ||
| 3762 | AOTD01000240.1 | GCA000344295_01879 | tRNA | open | 7550-7624 | trnE | tRNA-Glu(ctc) | |
| 3763 | AOTD01000240.1 | GCA000344295_01880 | tRNA | open | 7645-7720 | trnK | tRNA-Lys(ctt) | |
| 3764 | AOTD01000241.1 | GCA000344295_01881 | CDS | open | 193-936 | _na 247_aa | AMIN domain-containing protein | |
| 3765 | AOTD01000241.1 | GCA000344295_01882 | CDS | open | 968-1237 | _na 89_aa | Septum formation initiator | |
| 3766 | AOTD01000241.1 | GCA000344295_01883 | CDS | open | 1234-2484 | _na 416_aa | eno | phosphopyruvate hydratase |
| 3767 | AOTD01000241.1 | GCA000344295_01884 | CDS | open | 2489-3589 | _na 366_aa | recA | recombinase RecA |
| 3768 | AOTD01000241.1 | GCA000344295_01885 | CDS | open | 3702-4796 | _na 364_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3769 | AOTD01000241.1 | GCA000344295_01886 | CDS | open | 4905-5777 | _na 290_aa | 1%2C4-dihydroxy-6-naphtoate synthase | |
| 3770 | AOTD01000241.1 | GCA000344295_01887 | CDS | open | 5777-6043 | _na 88_aa | fliQ | flagellar biosynthesis protein FliQ |
| 3771 | AOTD01000241.1 | GCA000344295_01881 | gene | open | 193-936 | |||
| 3772 | AOTD01000241.1 | GCA000344295_01882 | gene | open | 968-1237 | |||
| 3773 | AOTD01000241.1 | GCA000344295_01883 | gene | open | 1234-2484 | eno | ||
| 3774 | AOTD01000241.1 | GCA000344295_01884 | gene | open | 2489-3589 | recA | ||
| 3775 | AOTD01000241.1 | GCA000344295_01885 | gene | open | 3702-4796 | |||
| 3776 | AOTD01000241.1 | GCA000344295_01886 | gene | open | 4905-5777 | |||
| 3777 | AOTD01000241.1 | GCA000344295_01887 | gene | open | 5777-6043 | fliQ | ||
| 3778 | AOTD01000242.1 | GCA000344295_01888 | CDS | open | 59-214 | _na 51_aa | hypothetical protein | |
| 3779 | AOTD01000242.1 | GCA000344295_01889 | CDS | open | 159-719 | _na 186_aa | DNA-binding protein | |
| 3780 | AOTD01000242.1 | GCA000344295_01890 | CDS | open | 840-1058 | _na 72_aa | yozG | Transcriptional regulator%2C XRE family |
| 3781 | AOTD01000242.1 | GCA000344295_01891 | CDS | open | 1058-3229 | _na 723_aa | hsdM | site-specific DNA-methyltransferase (adenine-specific) |
| 3782 | AOTD01000242.1 | GCA000344295_01892 | CDS | open | 3226-4608 | _na 460_aa | Restriction modification system DNA specificity domain-containing protein | |
| 3783 | AOTD01000242.1 | GCA000344295_01893 | CDS | open | 4598-7507 | _na 969_aa | type I site-specific deoxyribonuclease | |
| 3784 | AOTD01000242.1 | GCA000344295_01894 | CDS | open | 7522-8607 | _na 361_aa | AbiJ-NTD3 domain-containing protein | |
| 3785 | AOTD01000242.1 | GCA000344295_01895 | CDS | open | 8808-9632 | _na 274_aa | Anti-bacteriophage protein A/HamA C-terminal domain-containing protein | |
| 3786 | AOTD01000242.1 | GCA000344295_01896 | CDS | open | 9626-12724 | _na 1032_aa | DEAD/DEAH box helicase | |
| 3787 | AOTD01000242.1 | GCA000344295_01897 | CDS | open | 12889-14073 | _na 394_aa | Relaxase | |
| 3788 | AOTD01000242.1 | GCA000344295_01898 | CDS | open | 14079-14429 | _na 116_aa | nikA | Mobilization protein NikA |
| 3789 | AOTD01000242.1 | GCA000344295_01899 | CDS | open | 15308-15553 | _na 81_aa | Cytoplasmic protein | |
| 3790 | AOTD01000242.1 | GCA000344295_01900 | CDS | open | 15529-15822 | _na 97_aa | hypothetical protein | |
| 3791 | AOTD01000242.1 | GCA000344295_01906 | CDS | open | 16679-17824 | _na 381_aa | Multidrug-efflux transporter | |
| 3792 | AOTD01000242.1 | GCA000344295_01907 | CDS | open | 18002-18670 | _na 222_aa | DNA alkylation repair enzyme | |
| 3793 | AOTD01000242.1 | GCA000344295_01908 | CDS | open | 18794-19531 | _na 245_aa | terC | Integral membrane protein TerC |
| 3794 | AOTD01000242.1 | GCA000344295_01910 | CDS | open | 19972-20451 | _na 159_aa | Lipoprotein | |
| 3795 | AOTD01000242.1 | GCA000344295_01888 | gene | open | 59-214 | |||
| 3796 | AOTD01000242.1 | GCA000344295_01889 | gene | open | 159-719 | |||
| 3797 | AOTD01000242.1 | GCA000344295_01890 | gene | open | 840-1058 | yozG | ||
| 3798 | AOTD01000242.1 | GCA000344295_01891 | gene | open | 1058-3229 | hsdM | ||
| 3799 | AOTD01000242.1 | GCA000344295_01892 | gene | open | 3226-4608 | |||
| 3800 | AOTD01000242.1 | GCA000344295_01893 | gene | open | 4598-7507 | |||
| 3801 | AOTD01000242.1 | GCA000344295_01894 | gene | open | 7522-8607 | |||
| 3802 | AOTD01000242.1 | GCA000344295_01895 | gene | open | 8808-9632 | |||
| 3803 | AOTD01000242.1 | GCA000344295_01896 | gene | open | 9626-12724 | |||
| 3804 | AOTD01000242.1 | GCA000344295_01897 | gene | open | 12889-14073 | |||
| 3805 | AOTD01000242.1 | GCA000344295_01898 | gene | open | 14079-14429 | nikA | ||
| 3806 | AOTD01000242.1 | GCA000344295_01899 | gene | open | 15308-15553 | |||
| 3807 | AOTD01000242.1 | GCA000344295_01900 | gene | open | 15529-15822 | |||
| 3808 | AOTD01000242.1 | GCA000344295_01906 | gene | open | 16679-17824 | |||
| 3809 | AOTD01000242.1 | GCA000344295_01907 | gene | open | 18002-18670 | |||
| 3810 | AOTD01000242.1 | GCA000344295_01908 | gene | open | 18794-19531 | terC | ||
| 3811 | AOTD01000242.1 | GCA000344295_01910 | gene | open | 19972-20451 | |||
| 3812 | AOTD01000242.1 | GCA000344295_01901 | gene | open | 16134-16218 | trnL | ||
| 3813 | AOTD01000242.1 | GCA000344295_01902 | gene | open | 16234-16310 | trnR | ||
| 3814 | AOTD01000242.1 | GCA000344295_01903 | gene | open | 16323-16399 | trnR | ||
| 3815 | AOTD01000242.1 | GCA000344295_01904 | gene | open | 16405-16481 | trnH | ||
| 3816 | AOTD01000242.1 | GCA000344295_01905 | gene | open | 16493-16570 | trnP | ||
| 3817 | AOTD01000242.1 | GCA000344295_01909 | gene | open | 19828-19902 | trnE | ||
| 3818 | AOTD01000242.1 | GCA000344295_01901 | tRNA | open | 16134-16218 | trnL | tRNA-Leu(tag) | |
| 3819 | AOTD01000242.1 | GCA000344295_01902 | tRNA | open | 16234-16310 | trnR | tRNA-Arg(tct) | |
| 3820 | AOTD01000242.1 | GCA000344295_01903 | tRNA | open | 16323-16399 | trnR | tRNA-Arg(tcg) | |
| 3821 | AOTD01000242.1 | GCA000344295_01904 | tRNA | open | 16405-16481 | trnH | tRNA-His(gtg) | |
| 3822 | AOTD01000242.1 | GCA000344295_01905 | tRNA | open | 16493-16570 | trnP | tRNA-Pro(tgg) | |
| 3823 | AOTD01000242.1 | GCA000344295_01909 | tRNA | open | 19828-19902 | trnE | tRNA-Glu(ttc) | |
| 3824 | AOTD01000243.1 | GCA000344295_01911 | CDS | open | 75-287 | _na 70_aa | hypothetical protein | |
| 3825 | AOTD01000243.1 | GCA000344295_01911 | gene | open | 75-287 | |||
| 3826 | AOTD01000245.1 | GCA000344295_01912 | CDS | open | 43-999 | _na 318_aa | hypothetical protein | |
| 3827 | AOTD01000245.1 | GCA000344295_01913 | CDS | open | 1128-1892 | _na 254_aa | hypothetical protein | |
| 3828 | AOTD01000245.1 | GCA000344295_01914 | CDS | open | 1885-2082 | _na 65_aa | hypothetical protein | |
| 3829 | AOTD01000245.1 | GCA000344295_01915 | CDS | open | 2086-2718 | _na 210_aa | hypothetical protein | |
| 3830 | AOTD01000245.1 | GCA000344295_01916 | CDS | open | 2733-3089 | _na 118_aa | hypothetical protein | |
| 3831 | AOTD01000245.1 | GCA000344295_01917 | CDS | open | 3536-3886 | _na 116_aa | Phage tail protein | |
| 3832 | AOTD01000245.1 | GCA000344295_01918 | CDS | open | 3901-4245 | _na 114_aa | Phage tail protein | |
| 3833 | AOTD01000245.1 | GCA000344295_01919 | CDS | open | 4249-4470 | _na 73_aa | hypothetical protein | |
| 3834 | AOTD01000245.1 | GCA000344295_01920 | CDS | open | 4467-4805 | _na 112_aa | L-alanyl-D-glutamate peptidase | |
| 3835 | AOTD01000245.1 | GCA000344295_01921 | CDS | open | 4979-5950 | _na 323_aa | nrfD | Polysulfide reductase NrfD |
| 3836 | AOTD01000245.1 | GCA000344295_01922 | CDS | open | 5943-6512 | _na 189_aa | Polysulfide reductase%2C subunit B | |
| 3837 | AOTD01000245.1 | GCA000344295_01923 | CDS | open | 6523-8811 | _na 762_aa | phsA | thiosulfate reductase PhsA |
| 3838 | AOTD01000245.1 | GCA000344295_01924 | CDS | open | 9112-9675 | _na 187_aa | Serine hydrolase family protein | |
| 3839 | AOTD01000245.1 | GCA000344295_01925 | CDS | open | 9761-12838 | _na 1025_aa | Cytochrome c biogenesis protein | |
| 3840 | AOTD01000245.1 | GCA000344295_01926 | CDS | open | 12838-13269 | _na 143_aa | fdhC | FdhC protein |
| 3841 | AOTD01000245.1 | GCA000344295_01927 | CDS | open | 13407-13904 | _na 165_aa | Phosphatidylglycerophosphatase A | |
| 3842 | AOTD01000245.1 | GCA000344295_01928 | CDS | open | 14601-14993 | _na 130_aa | Sulfate adenylyltransferase | |
| 3843 | AOTD01000245.1 | GCA000344295_01929 | CDS | open | 15130-15786 | _na 218_aa | hypothetical protein | |
| 3844 | AOTD01000245.1 | GCA000344295_01930 | CDS | open | 15764-16690 | _na 308_aa | Cation-efflux system membrane protein | |
| 3845 | AOTD01000245.1 | GCA000344295_01931 | CDS | open | 16709-17839 | _na 376_aa | bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase | |
| 3846 | AOTD01000245.1 | GCA000344295_01932 | CDS | open | 17940-19274 | _na 444_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 3847 | AOTD01000245.1 | GCA000344295_01933 | CDS | open | 19264-20364 | _na 366_aa | Iron-sulfur cluster carrier protein | |
| 3848 | AOTD01000245.1 | GCA000344295_01934 | CDS | open | 20441-20707 | _na 88_aa | ACT domain-containing protein | |
| 3849 | AOTD01000245.1 | GCA000344295_01912 | gene | open | 43-999 | |||
| 3850 | AOTD01000245.1 | GCA000344295_01913 | gene | open | 1128-1892 | |||
| 3851 | AOTD01000245.1 | GCA000344295_01914 | gene | open | 1885-2082 | |||
| 3852 | AOTD01000245.1 | GCA000344295_01915 | gene | open | 2086-2718 | |||
| 3853 | AOTD01000245.1 | GCA000344295_01916 | gene | open | 2733-3089 | |||
| 3854 | AOTD01000245.1 | GCA000344295_01917 | gene | open | 3536-3886 | |||
| 3855 | AOTD01000245.1 | GCA000344295_01918 | gene | open | 3901-4245 | |||
| 3856 | AOTD01000245.1 | GCA000344295_01919 | gene | open | 4249-4470 | |||
| 3857 | AOTD01000245.1 | GCA000344295_01920 | gene | open | 4467-4805 | |||
| 3858 | AOTD01000245.1 | GCA000344295_01921 | gene | open | 4979-5950 | nrfD | ||
| 3859 | AOTD01000245.1 | GCA000344295_01922 | gene | open | 5943-6512 | |||
| 3860 | AOTD01000245.1 | GCA000344295_01923 | gene | open | 6523-8811 | phsA | ||
| 3861 | AOTD01000245.1 | GCA000344295_01924 | gene | open | 9112-9675 | |||
| 3862 | AOTD01000245.1 | GCA000344295_01925 | gene | open | 9761-12838 | |||
| 3863 | AOTD01000245.1 | GCA000344295_01926 | gene | open | 12838-13269 | fdhC | ||
| 3864 | AOTD01000245.1 | GCA000344295_01927 | gene | open | 13407-13904 | |||
| 3865 | AOTD01000245.1 | GCA000344295_01928 | gene | open | 14601-14993 | |||
| 3866 | AOTD01000245.1 | GCA000344295_01929 | gene | open | 15130-15786 | |||
| 3867 | AOTD01000245.1 | GCA000344295_01930 | gene | open | 15764-16690 | |||
| 3868 | AOTD01000245.1 | GCA000344295_01931 | gene | open | 16709-17839 | |||
| 3869 | AOTD01000245.1 | GCA000344295_01932 | gene | open | 17940-19274 | thiC | ||
| 3870 | AOTD01000245.1 | GCA000344295_01933 | gene | open | 19264-20364 | |||
| 3871 | AOTD01000245.1 | GCA000344295_01934 | gene | open | 20441-20707 | |||
| 3872 | AOTD01000246.1 | GCA000344295_01935 | CDS | open | 599-1363 | _na 254_aa | exbB | Biopolymer transport ExbB protein |
| 3873 | AOTD01000246.1 | GCA000344295_01936 | CDS | open | 1367-2254 | _na 295_aa | Malate dehydrogenase%2C NAD-dependent | |
| 3874 | AOTD01000246.1 | GCA000344295_01935 | gene | open | 599-1363 | exbB | ||
| 3875 | AOTD01000246.1 | GCA000344295_01936 | gene | open | 1367-2254 | |||
| 3876 | AOTD01000247.1 | GCA000344295_01937 | CDS | open | 20-394 | _na 124_aa | Methyl-accepting transducer domain-containing protein | |
| 3877 | AOTD01000247.1 | GCA000344295_01937 | gene | open | 20-394 | |||
| 3878 | AOTD01000248.1 | GCA000344295_01938 | CDS | open | 307-771 | _na 154_aa | hypothetical protein | |
| 3879 | AOTD01000248.1 | GCA000344295_01939 | CDS | open | 771-1421 | _na 216_aa | dsbA | Thiol:disulfide interchange protein DsbA |
| 3880 | AOTD01000248.1 | GCA000344295_01940 | CDS | open | 1674-3446 | _na 590_aa | Putative arylsulfate sulfotransferase | |
| 3881 | AOTD01000248.1 | GCA000344295_01941 | CDS | open | 3648-3851 | _na 67_aa | Tautomerase | |
| 3882 | AOTD01000248.1 | GCA000344295_01942 | CDS | open | 3848-4345 | _na 165_aa | bcp | thioredoxin-dependent thiol peroxidase |
| 3883 | AOTD01000248.1 | GCA000344295_01938 | gene | open | 307-771 | |||
| 3884 | AOTD01000248.1 | GCA000344295_01939 | gene | open | 771-1421 | dsbA | ||
| 3885 | AOTD01000248.1 | GCA000344295_01940 | gene | open | 1674-3446 | |||
| 3886 | AOTD01000248.1 | GCA000344295_01941 | gene | open | 3648-3851 | |||
| 3887 | AOTD01000248.1 | GCA000344295_01942 | gene | open | 3848-4345 | bcp | ||
| 3888 | AOTD01000249.1 | GCA000344295_01943 | CDS | open | 232-948 | _na 238_aa | efflux RND transporter periplasmic adaptor subunit | |
| 3889 | AOTD01000249.1 | GCA000344295_01943 | gene | open | 232-948 | |||
| 3890 | AOTD01000250.1 | repeat_region | open | 1-199 | CRISPR array with 3 repeats of length 33%2C consensus sequence GTTAAAATTTACTCCGTTGGAGTTTGAAACAAA and spacer length 35 | |||
| 3891 | AOTD01000250.1 | GCA000344295_01944 | CDS | open | 336-1556 | _na 406_aa | aroC | chorismate synthase |
| 3892 | AOTD01000250.1 | GCA000344295_01945 | CDS | open | 1553-2221 | _na 222_aa | rnc | ribonuclease III |
| 3893 | AOTD01000250.1 | GCA000344295_01946 | CDS | open | 2232-2657 | _na 141_aa | rnhA | ribonuclease HI |
| 3894 | AOTD01000250.1 | GCA000344295_01947 | CDS | open | 2635-3681 | _na 348_aa | Tetratricopeptide repeat protein | |
| 3895 | AOTD01000250.1 | GCA000344295_01948 | CDS | open | 3724-5382 | _na 552_aa | DNA primase | |
| 3896 | AOTD01000250.1 | GCA000344295_01949 | CDS | open | 5379-6365 | _na 328_aa | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase | |
| 3897 | AOTD01000250.1 | GCA000344295_01950 | CDS | open | 6889-7470 | _na 193_aa | Mrr restriction system protein | |
| 3898 | AOTD01000250.1 | GCA000344295_01951 | CDS | open | 7609-8205 | _na 198_aa | Ribonuclease HII | |
| 3899 | AOTD01000250.1 | GCA000344295_01952 | CDS | open | 8270-9151 | _na 293_aa | Periplasmic protein | |
| 3900 | AOTD01000250.1 | GCA000344295_01953 | CDS | open | 9163-10257 | _na 364_aa | AAA domain-containing protein | |
| 3901 | AOTD01000250.1 | GCA000344295_01954 | CDS | open | 10664-10975 | _na 103_aa | rpsJ | 30S ribosomal protein S10 |
| 3902 | AOTD01000250.1 | GCA000344295_01955 | CDS | open | 10990-11568 | _na 192_aa | rplC | 50S ribosomal protein L3 |
| 3903 | AOTD01000250.1 | GCA000344295_01956 | CDS | open | 11565-12179 | _na 204_aa | rplD | 50S ribosomal protein L4 |
| 3904 | AOTD01000250.1 | GCA000344295_01957 | CDS | open | 12181-12462 | _na 93_aa | 50S ribosomal protein L23 | |
| 3905 | AOTD01000250.1 | GCA000344295_01958 | CDS | open | 12464-13294 | _na 276_aa | rplB | 50S ribosomal protein L2 |
| 3906 | AOTD01000250.1 | GCA000344295_01959 | CDS | open | 13297-13578 | _na 93_aa | rpsS | 30S ribosomal protein S19 |
| 3907 | AOTD01000250.1 | GCA000344295_01960 | CDS | open | 13588-13920 | _na 110_aa | rplV | 50S ribosomal protein L22 |
| 3908 | AOTD01000250.1 | GCA000344295_01961 | CDS | open | 13922-14623 | _na 233_aa | rpsC | 30S ribosomal protein S3 |
| 3909 | AOTD01000250.1 | GCA000344295_01962 | CDS | open | 14626-14787 | _na 53_aa | Large ribosomal subunit protein uL16 | |
| 3910 | AOTD01000250.1 | GCA000344295_01963 | CDS | open | 14871-15050 | _na 59_aa | rplP | 50S ribosomal protein L16 |
| 3911 | AOTD01000250.1 | GCA000344295_01964 | CDS | open | 15037-15222 | _na 61_aa | rpmC | 50S ribosomal protein L29 |
| 3912 | AOTD01000250.1 | GCA000344295_01965 | CDS | open | 15233-15484 | _na 83_aa | rpsQ | 30S ribosomal protein S17 |
| 3913 | AOTD01000250.1 | GCA000344295_01966 | CDS | open | 15484-15852 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 3914 | AOTD01000250.1 | GCA000344295_01967 | CDS | open | 15852-16088 | _na 78_aa | rplX | 50S ribosomal protein L24 |
| 3915 | AOTD01000250.1 | GCA000344295_01968 | CDS | open | 16091-16636 | _na 181_aa | rplE | 50S ribosomal protein L5 |
| 3916 | AOTD01000250.1 | GCA000344295_01969 | CDS | open | 16638-16823 | _na 61_aa | rpsZ | type Z 30S ribosomal protein S14 |
| 3917 | AOTD01000250.1 | GCA000344295_01970 | CDS | open | 16833-17228 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 3918 | AOTD01000250.1 | GCA000344295_01971 | CDS | open | 17858-18394 | _na 178_aa | rplF | 50S ribosomal protein L6 |
| 3919 | AOTD01000250.1 | GCA000344295_01972 | CDS | open | 18405-18761 | _na 118_aa | rplR | 50S ribosomal protein L18 |
| 3920 | AOTD01000250.1 | GCA000344295_01973 | CDS | open | 18773-19216 | _na 147_aa | rpsE | 30S ribosomal protein S5 |
| 3921 | AOTD01000250.1 | GCA000344295_01974 | CDS | open | 19226-19627 | _na 133_aa | rplO | 50S ribosomal protein L15 |
| 3922 | AOTD01000250.1 | GCA000344295_01975 | CDS | open | 19627-20889 | _na 420_aa | secY | preprotein translocase subunit SecY |
| 3923 | AOTD01000250.1 | GCA000344295_01976 | CDS | open | 20889-21647 | _na 252_aa | map | type I methionyl aminopeptidase |
| 3924 | AOTD01000250.1 | GCA000344295_01977 | CDS | open | 21773-21991 | _na 72_aa | infA | translation initiation factor IF-1 |
| 3925 | AOTD01000250.1 | GCA000344295_01978 | CDS | open | 22148-22261 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 3926 | AOTD01000250.1 | GCA000344295_01979 | CDS | open | 22265-22633 | _na 122_aa | rpsM | 30S ribosomal protein S13 |
| 3927 | AOTD01000250.1 | GCA000344295_01980 | CDS | open | 22643-23035 | _na 130_aa | rpsK | 30S ribosomal protein S11 |
| 3928 | AOTD01000250.1 | GCA000344295_01981 | CDS | open | 23058-23684 | _na 208_aa | rpsD | 30S ribosomal protein S4 |
| 3929 | AOTD01000250.1 | GCA000344295_01982 | CDS | open | 23699-24712 | _na 337_aa | DNA-directed RNA polymerase subunit alpha | |
| 3930 | AOTD01000250.1 | GCA000344295_01983 | CDS | open | 24724-25080 | _na 118_aa | rplQ | 50S ribosomal protein L17 |
| 3931 | AOTD01000250.1 | GCA000344295_01984 | CDS | open | 25588-25857 | _na 89_aa | nifU | Iron-sulfur cluster assembly scaffold protein NifU |
| 3932 | AOTD01000250.1 | GCA000344295_01985 | CDS | open | 25850-26395 | _na 181_aa | Tetratricopeptide repeat protein | |
| 3933 | AOTD01000250.1 | GCA000344295_01986 | CDS | open | 26379-27671 | _na 430_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 3934 | AOTD01000250.1 | GCA000344295_01987 | CDS | open | 27943-28290 | _na 115_aa | panD | aspartate 1-decarboxylase |
| 3935 | AOTD01000250.1 | GCA000344295_01988 | CDS | open | 28536-29312 | _na 258_aa | Ferredoxin | |
| 3936 | AOTD01000250.1 | GCA000344295_01989 | CDS | open | 29706-30023 | _na 105_aa | YbaB/EbfC family nucleoid-associated protein | |
| 3937 | AOTD01000250.1 | GCA000344295_01990 | CDS | open | 30020-31438 | _na 472_aa | Putative periplasmic protein | |
| 3938 | AOTD01000250.1 | GCA000344295_01991 | CDS | open | 31529-32707 | _na 392_aa | Octaprenyl-diphosphate synthase | |
| 3939 | AOTD01000250.1 | GCA000344295_01992 | CDS | open | 32915-34165 | _na 416_aa | MORN repeat protein | |
| 3940 | AOTD01000250.1 | GCA000344295_01993 | CDS | open | 34316-35404 | _na 362_aa | hypothetical protein | |
| 3941 | AOTD01000250.1 | GCA000344295_01994 | CDS | open | 35440-35586 | _na 48_aa | hypothetical protein | |
| 3942 | AOTD01000250.1 | GCA000344295_01995 | CDS | open | 35676-36539 | _na 287_aa | hypothetical protein | |
| 3943 | AOTD01000250.1 | GCA000344295_01996 | CDS | open | 36588-38501 | _na 637_aa | tkt | transketolase |
| 3944 | AOTD01000250.1 | GCA000344295_01997 | CDS | open | 38808-39602 | _na 264_aa | undecaprenyl-diphosphate phosphatase | |
| 3945 | AOTD01000250.1 | GCA000344295_01998 | CDS | open | 39677-40339 | _na 220_aa | hypothetical protein | |
| 3946 | AOTD01000250.1 | GCA000344295_01944 | gene | open | 336-1556 | aroC | ||
| 3947 | AOTD01000250.1 | GCA000344295_01945 | gene | open | 1553-2221 | rnc | ||
| 3948 | AOTD01000250.1 | GCA000344295_01946 | gene | open | 2232-2657 | rnhA | ||
| 3949 | AOTD01000250.1 | GCA000344295_01947 | gene | open | 2635-3681 | |||
| 3950 | AOTD01000250.1 | GCA000344295_01948 | gene | open | 3724-5382 | |||
| 3951 | AOTD01000250.1 | GCA000344295_01949 | gene | open | 5379-6365 | |||
| 3952 | AOTD01000250.1 | GCA000344295_01950 | gene | open | 6889-7470 | |||
| 3953 | AOTD01000250.1 | GCA000344295_01951 | gene | open | 7609-8205 | |||
| 3954 | AOTD01000250.1 | GCA000344295_01952 | gene | open | 8270-9151 | |||
| 3955 | AOTD01000250.1 | GCA000344295_01953 | gene | open | 9163-10257 | |||
| 3956 | AOTD01000250.1 | GCA000344295_01954 | gene | open | 10664-10975 | rpsJ | ||
| 3957 | AOTD01000250.1 | GCA000344295_01955 | gene | open | 10990-11568 | rplC | ||
| 3958 | AOTD01000250.1 | GCA000344295_01956 | gene | open | 11565-12179 | rplD | ||
| 3959 | AOTD01000250.1 | GCA000344295_01957 | gene | open | 12181-12462 | |||
| 3960 | AOTD01000250.1 | GCA000344295_01958 | gene | open | 12464-13294 | rplB | ||
| 3961 | AOTD01000250.1 | GCA000344295_01959 | gene | open | 13297-13578 | rpsS | ||
| 3962 | AOTD01000250.1 | GCA000344295_01960 | gene | open | 13588-13920 | rplV | ||
| 3963 | AOTD01000250.1 | GCA000344295_01961 | gene | open | 13922-14623 | rpsC | ||
| 3964 | AOTD01000250.1 | GCA000344295_01962 | gene | open | 14626-14787 | |||
| 3965 | AOTD01000250.1 | GCA000344295_01963 | gene | open | 14871-15050 | rplP | ||
| 3966 | AOTD01000250.1 | GCA000344295_01964 | gene | open | 15037-15222 | rpmC | ||
| 3967 | AOTD01000250.1 | GCA000344295_01965 | gene | open | 15233-15484 | rpsQ | ||
| 3968 | AOTD01000250.1 | GCA000344295_01966 | gene | open | 15484-15852 | rplN | ||
| 3969 | AOTD01000250.1 | GCA000344295_01967 | gene | open | 15852-16088 | rplX | ||
| 3970 | AOTD01000250.1 | GCA000344295_01968 | gene | open | 16091-16636 | rplE | ||
| 3971 | AOTD01000250.1 | GCA000344295_01969 | gene | open | 16638-16823 | rpsZ | ||
| 3972 | AOTD01000250.1 | GCA000344295_01970 | gene | open | 16833-17228 | rpsH | ||
| 3973 | AOTD01000250.1 | GCA000344295_01971 | gene | open | 17858-18394 | rplF | ||
| 3974 | AOTD01000250.1 | GCA000344295_01972 | gene | open | 18405-18761 | rplR | ||
| 3975 | AOTD01000250.1 | GCA000344295_01973 | gene | open | 18773-19216 | rpsE | ||
| 3976 | AOTD01000250.1 | GCA000344295_01974 | gene | open | 19226-19627 | rplO | ||
| 3977 | AOTD01000250.1 | GCA000344295_01975 | gene | open | 19627-20889 | secY | ||
| 3978 | AOTD01000250.1 | GCA000344295_01976 | gene | open | 20889-21647 | map | ||
| 3979 | AOTD01000250.1 | GCA000344295_01977 | gene | open | 21773-21991 | infA | ||
| 3980 | AOTD01000250.1 | GCA000344295_01978 | gene | open | 22148-22261 | rpmJ | ||
| 3981 | AOTD01000250.1 | GCA000344295_01979 | gene | open | 22265-22633 | rpsM | ||
| 3982 | AOTD01000250.1 | GCA000344295_01980 | gene | open | 22643-23035 | rpsK | ||
| 3983 | AOTD01000250.1 | GCA000344295_01981 | gene | open | 23058-23684 | rpsD | ||
| 3984 | AOTD01000250.1 | GCA000344295_01982 | gene | open | 23699-24712 | |||
| 3985 | AOTD01000250.1 | GCA000344295_01983 | gene | open | 24724-25080 | rplQ | ||
| 3986 | AOTD01000250.1 | GCA000344295_01984 | gene | open | 25588-25857 | nifU | ||
| 3987 | AOTD01000250.1 | GCA000344295_01985 | gene | open | 25850-26395 | |||
| 3988 | AOTD01000250.1 | GCA000344295_01986 | gene | open | 26379-27671 | |||
| 3989 | AOTD01000250.1 | GCA000344295_01987 | gene | open | 27943-28290 | panD | ||
| 3990 | AOTD01000250.1 | GCA000344295_01988 | gene | open | 28536-29312 | |||
| 3991 | AOTD01000250.1 | GCA000344295_01989 | gene | open | 29706-30023 | |||
| 3992 | AOTD01000250.1 | GCA000344295_01990 | gene | open | 30020-31438 | |||
| 3993 | AOTD01000250.1 | GCA000344295_01991 | gene | open | 31529-32707 | |||
| 3994 | AOTD01000250.1 | GCA000344295_01992 | gene | open | 32915-34165 | |||
| 3995 | AOTD01000250.1 | GCA000344295_01993 | gene | open | 34316-35404 | |||
| 3996 | AOTD01000250.1 | GCA000344295_01994 | gene | open | 35440-35586 | |||
| 3997 | AOTD01000250.1 | GCA000344295_01995 | gene | open | 35676-36539 | |||
| 3998 | AOTD01000250.1 | GCA000344295_01996 | gene | open | 36588-38501 | tkt | ||
| 3999 | AOTD01000250.1 | GCA000344295_01997 | gene | open | 38808-39602 | |||
| 4000 | AOTD01000250.1 | GCA000344295_01998 | gene | open | 39677-40339 |

