HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_000466705.1)

Select a Genome:
BAKTA Annotations for GCA_000466705.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
69 1995701 1937 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3975 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3975 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 ANNH01000009.1 GCA000466705_00965 gene open 37591-39558
2002 ANNH01000009.1 GCA000466705_00966 gene open 39568-40488
2003 ANNH01000009.1 GCA000466705_00967 gene open 40490-41134 hyfE
2004 ANNH01000009.1 GCA000466705_00968 gene open 41137-42618
2005 ANNH01000009.1 GCA000466705_00969 gene open 42615-44351
2006 ANNH01000009.1 GCA000466705_00970 gene open 44348-44887
2007 ANNH01000009.1 GCA000466705_00971 gene open 44884-45708
2008 ANNH01000009.1 GCA000466705_00972 gene open 45705-46049
2009 ANNH01000009.1 GCA000466705_00973 gene open 46049-46495
2010 ANNH01000009.1 GCA000466705_00974 gene open 46680-47540
2011 ANNH01000009.1 GCA000466705_00975 gene open 47791-48231
2012 ANNH01000009.1 GCA000466705_00976 gene open 48281-48832
2013 ANNH01000009.1 GCA000466705_00977 gene open 48832-49950
2014 ANNH01000009.1 GCA000466705_00978 gene open 49952-50617
2015 ANNH01000009.1 GCA000466705_00979 gene open 50610-51350
2016 ANNH01000009.1 GCA000466705_00980 gene open 51343-52026
2017 ANNH01000009.1 GCA000466705_00981 gene open 52119-53609 ccoN
2018 ANNH01000009.1 GCA000466705_00982 gene open 53609-54274 ccoO
2019 ANNH01000009.1 GCA000466705_00983 gene open 54284-54496 ccoQ
2020 ANNH01000009.1 GCA000466705_00984 gene open 54484-55347
2021 ANNH01000009.1 GCA000466705_00985 gene open 55347-55559
2022 ANNH01000009.1 GCA000466705_00986 gene open 55562-55663
2023 ANNH01000009.1 GCA000466705_00987 gene open 55666-56235
2024 ANNH01000009.1 GCA000466705_00988 gene open 56228-56698
2025 ANNH01000009.1 GCA000466705_00989 gene open 57005-58165 nhaA
2026 ANNH01000009.1 GCA000466705_00990 gene open 58506-59093
2027 ANNH01000009.1 GCA000466705_00991 gene open 59244-61589 addB
2028 ANNH01000009.1 GCA000466705_00992 gene open 61586-64405
2029 ANNH01000009.1 GCA000466705_00993 gene open 64486-64914 rplM
2030 ANNH01000009.1 GCA000466705_00994 gene open 64917-65306 rpsI
2031 ANNH01000009.1 GCA000466705_00995 gene open 65462-66478
2032 ANNH01000009.1 GCA000466705_00996 gene open 66551-67189
2033 ANNH01000009.1 GCA000466705_00997 gene open 67498-67770
2034 ANNH01000009.1 GCA000466705_00998 gene open 67821-68960
2035 ANNH01000009.1 GCA000466705_00999 gene open 68957-70258
2036 ANNH01000009.1 GCA000466705_01000 gene open 70371-71012
2037 ANNH01000009.1 GCA000466705_01001 gene open 71005-71727
2038 ANNH01000009.1 GCA000466705_01002 gene open 71798-72361
2039 ANNH01000009.1 GCA000466705_01003 gene open 72351-73748
2040 ANNH01000009.1 GCA000466705_01004 gene open 73842-75053
2041 ANNH01000009.1 GCA000466705_01005 gene open 75905-76969
2042 ANNH01000009.1 GCA000466705_01006 gene open 77050-78582 rmuC
2043 ANNH01000009.1 GCA000466705_01007 gene open 78636-79235
2044 ANNH01000009.1 GCA000466705_01008 gene open 79367-80080
2045 ANNH01000009.1 GCA000466705_01009 gene open 80073-81746
2046 ANNH01000009.1 GCA000466705_01010 gene open 81901-83226 selA
2047 ANNH01000009.1 GCA000466705_01011 gene open 83223-85043 selB
2048 ANNH01000009.1 GCA000466705_01012 gene open 85097-85804
2049 ANNH01000009.1 GCA000466705_01013 gene open 86085-86291
2050 ANNH01000009.1 GCA000466705_01014 gene open 86303-86836
2051 ANNH01000009.1 GCA000466705_01015 gene open 86885-89278
2052 ANNH01000009.1 GCA000466705_01016 gene open 89289-89849 fdh3B
2053 ANNH01000009.1 GCA000466705_01017 gene open 90165-92108
2054 ANNH01000009.1 GCA000466705_01018 gene open 92129-92650
2055 ANNH01000009.1 GCA000466705_01019 gene open 92702-94081
2056 ANNH01000009.1 GCA000466705_01020 gene open 94078-95370
2057 ANNH01000009.1 GCA000466705_01021 gene open 95357-96499 ftsX
2058 ANNH01000009.1 GCA000466705_01022 gene open 96501-97190
2059 ANNH01000009.1 GCA000466705_01023 gene open 97180-97674
2060 ANNH01000009.1 GCA000466705_01024 gene open 97683-98261
2061 ANNH01000009.1 GCA000466705_01025 gene open 98309-100675
2062 ANNH01000009.1 GCA000466705_01026 gene open 100675-101919 serS
2063 ANNH01000009.1 GCA000466705_01027 gene open 101941-102381 copD
2064 ANNH01000009.1 GCA000466705_01028 gene open 102390-103355 trpS
2065 ANNH01000009.1 GCA000466705_01029 gene open 103912-104433
2066 ANNH01000009.1 GCA000466705_01030 gene open 104414-105802 der
2067 ANNH01000009.1 GCA000466705_01031 gene open 105955-106845 eamA
2068 ANNH01000009.1 GCA000466705_01032 gene open 106856-107656 kdsA
2069 ANNH01000009.1 GCA000466705_01033 gene open 107670-107780
2070 ANNH01000009.1 GCA000466705_01034 gene open 107820-108176
2071 ANNH01000009.1 GCA000466705_01035 gene open 108181-108510 sugE
2072 ANNH01000009.1 GCA000466705_01036 gene open 108507-108830 sugE
2073 ANNH01000009.1 GCA000466705_01037 gene open 108891-109361 ribH
2074 ANNH01000009.1 GCA000466705_01038 gene open 109363-109758 nusB
2075 ANNH01000009.1 GCA000466705_01039 gene open 109755-110435 pyrF
2076 ANNH01000009.1 GCA000466705_01040 gene open 110648-110890
2077 ANNH01000009.1 GCA000466705_00931 gene open 8-84 trnD
2078 ANNH01000009.1 GCA000466705_00932 gene open 203-278 trnK
2079 ANNH01000009.1 GCA000466705_00933 gene open 286-360 trnE
2080 ANNH01000009.1 GCA000466705_00931 tRNA open 8-84 trnD tRNA-Asp(gtc)
2081 ANNH01000009.1 GCA000466705_00932 tRNA open 203-278 trnK tRNA-Lys(ctt)
2082 ANNH01000009.1 GCA000466705_00933 tRNA open 286-360 trnE tRNA-Glu(ctc)
2083 ANNH01000010.1 GCA000466705_01041 CDS open 270-998 _na     242_aa HEAT repeat domain-containing protein
2084 ANNH01000010.1 GCA000466705_01042 CDS open 1005-3413 _na     802_aa Flagellar protein
2085 ANNH01000010.1 GCA000466705_01043 CDS open 3397-4887 _na     496_aa nuoN NADH-quinone oxidoreductase subunit NuoN
2086 ANNH01000010.1 GCA000466705_01044 CDS open 4884-6395 _na     503_aa NADH-quinone oxidoreductase subunit M
2087 ANNH01000010.1 GCA000466705_01045 CDS open 6395-8233 _na     612_aa nuoL NADH-quinone oxidoreductase subunit L
2088 ANNH01000010.1 GCA000466705_01046 CDS open 8237-8539 _na     100_aa nuoK NADH-quinone oxidoreductase subunit NuoK
2089 ANNH01000010.1 GCA000466705_01047 CDS open 8536-9072 _na     178_aa NADH-quinone oxidoreductase subunit J
2090 ANNH01000010.1 GCA000466705_01048 CDS open 9065-9703 _na     212_aa nuoI NADH-quinone oxidoreductase subunit NuoI
2091 ANNH01000010.1 GCA000466705_01049 CDS open 9712-10707 _na     331_aa nuoH NADH-quinone oxidoreductase subunit NuoH
2092 ANNH01000010.1 GCA000466705_01050 CDS open 10700-13012 _na     770_aa NADH-quinone oxidoreductase subunit G
2093 ANNH01000010.1 GCA000466705_01051 CDS open 13009-13719 _na     236_aa NADH dehydrogenase
2094 ANNH01000010.1 GCA000466705_01052 CDS open 13716-13946 _na     76_aa NADH-ubiquinone oxidoreductase chain E
2095 ANNH01000010.1 GCA000466705_01053 CDS open 13943-15172 _na     409_aa nuoD NADH-quinone oxidoreductase subunit D
2096 ANNH01000010.1 GCA000466705_01054 CDS open 15169-15933 _na     254_aa NADH-quinone oxidoreductase subunit C
2097 ANNH01000010.1 GCA000466705_01055 CDS open 15930-16442 _na     170_aa nuoB NADH-quinone oxidoreductase subunit B
2098 ANNH01000010.1 GCA000466705_01056 CDS open 16424-16813 _na     129_aa NAD(P)H-quinone oxidoreductase subunit 3
2099 ANNH01000010.1 GCA000466705_01057 CDS open 16921-18555 _na     544_aa multidrug ABC transporter permease/ATP-binding protein
2100 ANNH01000010.1 GCA000466705_01058 CDS open 18555-19919 _na     454_aa coproporphyrinogen III oxidase family protein
2101 ANNH01000010.1 GCA000466705_01059 CDS open 20110-21426 _na     438_aa ABC transporter permease
2102 ANNH01000010.1 GCA000466705_01060 CDS open 21430-22722 _na     430_aa Integral membrane protein
2103 ANNH01000010.1 GCA000466705_01061 CDS open 22774-23565 _na     263_aa DUF2314 domain-containing protein
2104 ANNH01000010.1 GCA000466705_01062 CDS open 23836-24333 _na     165_aa yajQ YajQ family cyclic di-GMP-binding protein
2105 ANNH01000010.1 GCA000466705_01063 CDS open 24350-25108 _na     252_aa hypothetical protein
2106 ANNH01000010.1 GCA000466705_01064 CDS open 25108-26043 _na     311_aa D-2-hydroxyacid dehydrogenase
2107 ANNH01000010.1 GCA000466705_01065 CDS open 26046-27227 _na     393_aa Glutathionylspermidine amidase / glutathionylspermidine synthetase
2108 ANNH01000010.1 GCA000466705_01066 CDS open 27230-27847 _na     205_aa Lipoprotein
2109 ANNH01000010.1 GCA000466705_01067 CDS open 27844-28476 _na     210_aa Excisionase family DNA binding domain-containing protein
2110 ANNH01000010.1 GCA000466705_01068 CDS open 28580-28792 _na     70_aa rpsU 30S ribosomal protein S21
2111 ANNH01000010.1 GCA000466705_01069 CDS open 28936-30261 _na     441_aa ccoG cytochrome c oxidase accessory protein CcoG
2112 ANNH01000010.1 GCA000466705_01070 CDS open 30292-30918 _na     208_aa cmeR Transcriptional repressor of CmeABC operon%2C CmeR
2113 ANNH01000010.1 GCA000466705_01071 CDS open 31026-32183 _na     385_aa cmeA Multidrug efflux system CmeABC%2C periplasmic fusion protein CmeA
2114 ANNH01000010.1 GCA000466705_01072 CDS open 32194-35319 _na     1041_aa cmeB Multidrug efflux system CmeABC%2C inner membrane drug transporter CmeB
2115 ANNH01000010.1 GCA000466705_01073 CDS open 35309-36691 _na     460_aa RND transporter
2116 ANNH01000010.1 GCA000466705_01074 CDS open 36713-36940 _na     75_aa ATP-binding protein
2117 ANNH01000010.1 GCA000466705_01075 CDS open 37070-37777 _na     235_aa aqpZ aquaporin Z
2118 ANNH01000010.1 GCA000466705_01076 CDS open 38020-41088 _na     1022_aa vgrG Type VI secretion system tip protein VgrG
2119 ANNH01000010.1 GCA000466705_01077 CDS open 41091-41453 _na     120_aa Lipoprotein
2120 ANNH01000010.1 GCA000466705_01078 CDS open 41453-41998 _na     181_aa Ankyrin repeat domain-containing protein
2121 ANNH01000010.1 GCA000466705_01079 CDS open 41995-42558 _na     187_aa Ankyrin repeat domain-containing protein
2122 ANNH01000010.1 GCA000466705_01080 CDS open 42555-43115 _na     186_aa Ankyrin repeat domain-containing protein
2123 ANNH01000010.1 GCA000466705_01081 CDS open 43225-43746 _na     173_aa Hcp family type VI secretion system effector
2124 ANNH01000010.1 GCA000466705_01082 CDS open 43811-44728 _na     305_aa Type VI secretion system protein
2125 ANNH01000010.1 GCA000466705_01083 CDS open 44738-48226 _na     1162_aa tssM type VI secretion system membrane subunit TssM
2126 ANNH01000010.1 GCA000466705_01084 CDS open 48304-49200 _na     298_aa Type VI secretion protein
2127 ANNH01000010.1 GCA000466705_01085 CDS open 49197-50915 _na     572_aa tssF type VI secretion system baseplate subunit TssF
2128 ANNH01000010.1 GCA000466705_01086 CDS open 50915-51304 _na     129_aa GPW/gp25 family protein
2129 ANNH01000010.1 GCA000466705_01087 CDS open 51313-52761 _na     482_aa tssC type VI secretion system contractile sheath large subunit
2130 ANNH01000010.1 GCA000466705_01088 CDS open 52764-53249 _na     161_aa tssB type VI secretion system contractile sheath small subunit
2131 ANNH01000010.1 GCA000466705_01089 CDS open 53330-54610 _na     426_aa Type VI secretion system protein
2132 ANNH01000010.1 GCA000466705_01090 CDS open 54611-55375 _na     254_aa icmH type IVB secretion system protein IcmH/DotU
2133 ANNH01000010.1 GCA000466705_01091 CDS open 55385-56779 _na     464_aa tssK type VI secretion system baseplate subunit TssK
2134 ANNH01000010.1 GCA000466705_01092 CDS open 56781-57248 _na     155_aa tssJ type VI secretion system lipoprotein TssJ
2135 ANNH01000010.1 GCA000466705_01093 CDS open 57364-58722 _na     452_aa Thioredoxin reductase
2136 ANNH01000010.1 GCA000466705_01094 CDS open 58726-62457 _na     1243_aa hypothetical protein
2137 ANNH01000010.1 GCA000466705_01095 CDS open 62482-65862 _na     1126_aa Fungal lipase-like domain-containing protein
2138 ANNH01000010.1 GCA000466705_01096 CDS open 65862-66620 _na     252_aa tRNA 2-selenouridine synthase
2139 ANNH01000010.1 GCA000466705_01097 CDS open 66710-66892 _na     60_aa diadenosine tetraphosphate hydrolase
2140 ANNH01000010.1 GCA000466705_01098 CDS open 66892-67551 _na     219_aa tRNA 2-selenouridine synthase
2141 ANNH01000010.1 GCA000466705_01099 CDS open 67868-69058 _na     396_aa nifS NifS family cysteine desulfurase
2142 ANNH01000010.1 GCA000466705_01100 CDS open 69075-70067 _na     330_aa nifU Nitrogen fixation protein NifU
2143 ANNH01000010.1 GCA000466705_01101 CDS open 70155-71030 _na     291_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
2144 ANNH01000010.1 GCA000466705_01102 CDS open 71033-72247 _na     404_aa D-amino acid dehydrogenase small subunit
2145 ANNH01000010.1 GCA000466705_01103 CDS open 72351-73211 _na     286_aa mqnP menaquinone biosynthesis prenyltransferase MqnP
2146 ANNH01000010.1 GCA000466705_01104 CDS open 73208-73729 _na     173_aa hypothetical protein
2147 ANNH01000010.1 GCA000466705_01105 CDS open 73739-74137 _na     132_aa Periplasmic protein
2148 ANNH01000010.1 GCA000466705_01106 CDS open 74378-75346 _na     322_aa moaA GTP 3'%2C8-cyclase MoaA
2149 ANNH01000010.1 GCA000466705_01107 CDS open 75346-76101 _na     251_aa 7-carboxy-7-deazaguanine synthase
2150 ANNH01000010.1 GCA000466705_01108 CDS open 76101-76682 _na     193_aa 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase
2151 ANNH01000010.1 GCA000466705_01109 CDS open 76682-76885 _na     67_aa Lipoprotein
2152 ANNH01000010.1 GCA000466705_01110 CDS open 76882-77283 _na     133_aa Integral membrane protein
2153 ANNH01000010.1 GCA000466705_01111 CDS open 77284-77940 _na     218_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
2154 ANNH01000010.1 GCA000466705_01112 CDS open 78022-78222 _na     66_aa rpmE 50S ribosomal protein L31
2155 ANNH01000010.1 GCA000466705_01113 CDS open 78226-79041 _na     271_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2156 ANNH01000010.1 GCA000466705_01114 CDS open 79142-79822 _na     226_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2157 ANNH01000010.1 GCA000466705_01115 CDS open 79815-80750 _na     311_aa Phosphatidylglycerophosphate synthase
2158 ANNH01000010.1 GCA000466705_01116 CDS open 80744-81526 _na     260_aa Periplasmic protein
2159 ANNH01000010.1 GCA000466705_01117 CDS open 81536-82744 _na     402_aa LL-diaminopimelate aminotransferase
2160 ANNH01000010.1 GCA000466705_01118 CDS open 82741-84003 _na     420_aa Homoserine dehydrogenase
2161 ANNH01000010.1 GCA000466705_01119 CDS open 84005-84346 _na     113_aa yraN YraN family protein
2162 ANNH01000010.1 GCA000466705_01120 CDS open 84420-84734 _na     104_aa trxA thioredoxin
2163 ANNH01000010.1 GCA000466705_01121 CDS open 84734-85180 _na     148_aa fliL Flagellar protein FliL
2164 ANNH01000010.1 GCA000466705_01122 CDS open 85190-86128 _na     312_aa Thioredoxin reductase
2165 ANNH01000010.1 GCA000466705_01123 CDS open 86473-87243 _na     256_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2166 ANNH01000010.1 GCA000466705_01124 CDS open 87505-88842 _na     445_aa purF amidophosphoribosyltransferase
2167 ANNH01000010.1 GCA000466705_01125 CDS open 88839-89501 _na     220_aa Lipoprotein
2168 ANNH01000010.1 GCA000466705_01041 gene open 270-998
2169 ANNH01000010.1 GCA000466705_01042 gene open 1005-3413
2170 ANNH01000010.1 GCA000466705_01043 gene open 3397-4887 nuoN
2171 ANNH01000010.1 GCA000466705_01044 gene open 4884-6395
2172 ANNH01000010.1 GCA000466705_01045 gene open 6395-8233 nuoL
2173 ANNH01000010.1 GCA000466705_01046 gene open 8237-8539 nuoK
2174 ANNH01000010.1 GCA000466705_01047 gene open 8536-9072
2175 ANNH01000010.1 GCA000466705_01048 gene open 9065-9703 nuoI
2176 ANNH01000010.1 GCA000466705_01049 gene open 9712-10707 nuoH
2177 ANNH01000010.1 GCA000466705_01050 gene open 10700-13012
2178 ANNH01000010.1 GCA000466705_01051 gene open 13009-13719
2179 ANNH01000010.1 GCA000466705_01052 gene open 13716-13946
2180 ANNH01000010.1 GCA000466705_01053 gene open 13943-15172 nuoD
2181 ANNH01000010.1 GCA000466705_01054 gene open 15169-15933
2182 ANNH01000010.1 GCA000466705_01055 gene open 15930-16442 nuoB
2183 ANNH01000010.1 GCA000466705_01056 gene open 16424-16813
2184 ANNH01000010.1 GCA000466705_01057 gene open 16921-18555
2185 ANNH01000010.1 GCA000466705_01058 gene open 18555-19919
2186 ANNH01000010.1 GCA000466705_01059 gene open 20110-21426
2187 ANNH01000010.1 GCA000466705_01060 gene open 21430-22722
2188 ANNH01000010.1 GCA000466705_01061 gene open 22774-23565
2189 ANNH01000010.1 GCA000466705_01062 gene open 23836-24333 yajQ
2190 ANNH01000010.1 GCA000466705_01063 gene open 24350-25108
2191 ANNH01000010.1 GCA000466705_01064 gene open 25108-26043
2192 ANNH01000010.1 GCA000466705_01065 gene open 26046-27227
2193 ANNH01000010.1 GCA000466705_01066 gene open 27230-27847
2194 ANNH01000010.1 GCA000466705_01067 gene open 27844-28476
2195 ANNH01000010.1 GCA000466705_01068 gene open 28580-28792 rpsU
2196 ANNH01000010.1 GCA000466705_01069 gene open 28936-30261 ccoG
2197 ANNH01000010.1 GCA000466705_01070 gene open 30292-30918 cmeR
2198 ANNH01000010.1 GCA000466705_01071 gene open 31026-32183 cmeA
2199 ANNH01000010.1 GCA000466705_01072 gene open 32194-35319 cmeB
2200 ANNH01000010.1 GCA000466705_01073 gene open 35309-36691
2201 ANNH01000010.1 GCA000466705_01074 gene open 36713-36940
2202 ANNH01000010.1 GCA000466705_01075 gene open 37070-37777 aqpZ
2203 ANNH01000010.1 GCA000466705_01076 gene open 38020-41088 vgrG
2204 ANNH01000010.1 GCA000466705_01077 gene open 41091-41453
2205 ANNH01000010.1 GCA000466705_01078 gene open 41453-41998
2206 ANNH01000010.1 GCA000466705_01079 gene open 41995-42558
2207 ANNH01000010.1 GCA000466705_01080 gene open 42555-43115
2208 ANNH01000010.1 GCA000466705_01081 gene open 43225-43746
2209 ANNH01000010.1 GCA000466705_01082 gene open 43811-44728
2210 ANNH01000010.1 GCA000466705_01083 gene open 44738-48226 tssM
2211 ANNH01000010.1 GCA000466705_01084 gene open 48304-49200
2212 ANNH01000010.1 GCA000466705_01085 gene open 49197-50915 tssF
2213 ANNH01000010.1 GCA000466705_01086 gene open 50915-51304
2214 ANNH01000010.1 GCA000466705_01087 gene open 51313-52761 tssC
2215 ANNH01000010.1 GCA000466705_01088 gene open 52764-53249 tssB
2216 ANNH01000010.1 GCA000466705_01089 gene open 53330-54610
2217 ANNH01000010.1 GCA000466705_01090 gene open 54611-55375 icmH
2218 ANNH01000010.1 GCA000466705_01091 gene open 55385-56779 tssK
2219 ANNH01000010.1 GCA000466705_01092 gene open 56781-57248 tssJ
2220 ANNH01000010.1 GCA000466705_01093 gene open 57364-58722
2221 ANNH01000010.1 GCA000466705_01094 gene open 58726-62457
2222 ANNH01000010.1 GCA000466705_01095 gene open 62482-65862
2223 ANNH01000010.1 GCA000466705_01096 gene open 65862-66620
2224 ANNH01000010.1 GCA000466705_01097 gene open 66710-66892
2225 ANNH01000010.1 GCA000466705_01098 gene open 66892-67551
2226 ANNH01000010.1 GCA000466705_01099 gene open 67868-69058 nifS
2227 ANNH01000010.1 GCA000466705_01100 gene open 69075-70067 nifU
2228 ANNH01000010.1 GCA000466705_01101 gene open 70155-71030 miaA
2229 ANNH01000010.1 GCA000466705_01102 gene open 71033-72247
2230 ANNH01000010.1 GCA000466705_01103 gene open 72351-73211 mqnP
2231 ANNH01000010.1 GCA000466705_01104 gene open 73208-73729
2232 ANNH01000010.1 GCA000466705_01105 gene open 73739-74137
2233 ANNH01000010.1 GCA000466705_01106 gene open 74378-75346 moaA
2234 ANNH01000010.1 GCA000466705_01107 gene open 75346-76101
2235 ANNH01000010.1 GCA000466705_01108 gene open 76101-76682
2236 ANNH01000010.1 GCA000466705_01109 gene open 76682-76885
2237 ANNH01000010.1 GCA000466705_01110 gene open 76882-77283
2238 ANNH01000010.1 GCA000466705_01111 gene open 77284-77940
2239 ANNH01000010.1 GCA000466705_01112 gene open 78022-78222 rpmE
2240 ANNH01000010.1 GCA000466705_01113 gene open 78226-79041 rsmI
2241 ANNH01000010.1 GCA000466705_01114 gene open 79142-79822 rlmB
2242 ANNH01000010.1 GCA000466705_01115 gene open 79815-80750
2243 ANNH01000010.1 GCA000466705_01116 gene open 80744-81526
2244 ANNH01000010.1 GCA000466705_01117 gene open 81536-82744
2245 ANNH01000010.1 GCA000466705_01118 gene open 82741-84003
2246 ANNH01000010.1 GCA000466705_01119 gene open 84005-84346 yraN
2247 ANNH01000010.1 GCA000466705_01120 gene open 84420-84734 trxA
2248 ANNH01000010.1 GCA000466705_01121 gene open 84734-85180 fliL
2249 ANNH01000010.1 GCA000466705_01122 gene open 85190-86128
2250 ANNH01000010.1 GCA000466705_01123 gene open 86473-87243 dapB
2251 ANNH01000010.1 GCA000466705_01124 gene open 87505-88842 purF
2252 ANNH01000010.1 GCA000466705_01125 gene open 88839-89501
2253 ANNH01000011.1 repeat_region open 8566-9137 CRISPR array with 9 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 36
2254 ANNH01000011.1 GCA000466705_01126 CDS open 243-926 _na     227_aa CRISPR associated protein Cas6 C-terminal domain-containing protein
2255 ANNH01000011.1 GCA000466705_01127 CDS open 990-2381 _na     463_aa TM1802 family CRISPR-associated protein
2256 ANNH01000011.1 GCA000466705_01128 CDS open 2384-2800 _na     138_aa CRISPR type III-B/RAMP module-associated protein Cmr5
2257 ANNH01000011.1 GCA000466705_01129 CDS open 2793-3668 _na     291_aa cas7b type I-B CRISPR-associated protein Cas7/Csh2
2258 ANNH01000011.1 GCA000466705_01130 CDS open 3668-4408 _na     246_aa CRISPR-associated protein%2C Cas5h family
2259 ANNH01000011.1 GCA000466705_01131 CDS open 4405-6618 _na     737_aa CRISPR-associated helicase Cas3
2260 ANNH01000011.1 GCA000466705_01132 CDS open 6618-7118 _na     166_aa cas4 CRISPR-associated protein Cas4
2261 ANNH01000011.1 GCA000466705_01133 CDS open 7127-7405 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
2262 ANNH01000011.1 GCA000466705_01134 CDS open 7415-8413 _na     332_aa cas1 CRISPR-associated endonuclease Cas1
2263 ANNH01000011.1 GCA000466705_01135 CDS open 9398-9919 _na     173_aa comE ComE family competence protein
2264 ANNH01000011.1 GCA000466705_01136 CDS open 10056-10412 _na     118_aa rplS 50S ribosomal protein L19
2265 ANNH01000011.1 GCA000466705_01137 CDS open 10421-11113 _na     230_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
2266 ANNH01000011.1 GCA000466705_01138 CDS open 11110-11640 _na     176_aa rimM ribosome maturation factor RimM
2267 ANNH01000011.1 GCA000466705_01139 CDS open 11633-11875 _na     80_aa RNA-binding protein (KH domain)
2268 ANNH01000011.1 GCA000466705_01140 CDS open 11875-12102 _na     75_aa rpsP 30S ribosomal protein S16
2269 ANNH01000011.1 GCA000466705_01141 CDS open 12174-13514 _na     446_aa ffh signal recognition particle protein
2270 ANNH01000011.1 GCA000466705_01142 CDS open 13577-14335 _na     252_aa RNA pseudouridylate synthase
2271 ANNH01000011.1 GCA000466705_01143 CDS open 14332-15468 _na     378_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
2272 ANNH01000011.1 GCA000466705_01144 CDS open 15477-16184 _na     235_aa C4-type zinc ribbon domain-containing protein
2273 ANNH01000011.1 GCA000466705_01145 CDS open 16201-16923 _na     240_aa Nif3-like dinuclear metal center hexameric protein
2274 ANNH01000011.1 GCA000466705_01146 CDS open 16930-17790 _na     286_aa glyQ glycine--tRNA ligase subunit alpha
2275 ANNH01000011.1 GCA000466705_01147 CDS open 17801-18217 _na     138_aa Bacterial transcription activator effector binding domain-containing protein
2276 ANNH01000011.1 GCA000466705_01148 CDS open 18222-18695 _na     157_aa DUF3972 domain-containing protein
2277 ANNH01000011.1 GCA000466705_01149 CDS open 18707-19201 _na     164_aa N5-carboxyaminoimidazole ribonucleotide mutase
2278 ANNH01000011.1 GCA000466705_01150 CDS open 19198-20457 _na     419_aa Peptidase family U32 C-terminal domain-containing protein
2279 ANNH01000011.1 GCA000466705_01151 CDS open 20457-21215 _na     252_aa Chemotaxis protein
2280 ANNH01000011.1 GCA000466705_01152 CDS open 21352-22131 _na     259_aa Histidinol-phosphatase
2281 ANNH01000011.1 GCA000466705_01153 CDS open 22219-23649 _na     476_aa glnA type I glutamate--ammonia ligase
2282 ANNH01000011.1 GCA000466705_01154 CDS open 24332-25993 _na     553_aa DNA polymerase III subunit gamma/tau
2283 ANNH01000011.1 GCA000466705_01155 CDS open 26111-26719 _na     202_aa lysE Transporter%2C LysE family
2284 ANNH01000011.1 GCA000466705_01156 CDS open 26654-26923 _na     89_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
2285 ANNH01000011.1 GCA000466705_01157 CDS open 26923-29301 _na     792_aa Copper-transporting ATPase
2286 ANNH01000011.1 GCA000466705_01158 CDS open 29298-29918 _na     206_aa PAC domain-containing protein
2287 ANNH01000011.1 GCA000466705_01159 CDS open 30065-30448 _na     127_aa ridA Enamine deaminase RidA
2288 ANNH01000011.1 GCA000466705_01160 CDS open 30469-31152 _na     227_aa pyridoxal-phosphate dependent enzyme
2289 ANNH01000011.1 GCA000466705_01161 CDS open 31146-31556 _na     136_aa pyridoxal-phosphate dependent enzyme
2290 ANNH01000011.1 GCA000466705_01162 CDS open 31720-33063 _na     447_aa rho transcription termination factor Rho
2291 ANNH01000011.1 GCA000466705_01163 CDS open 33209-33421 _na     70_aa Transcriptional regulator
2292 ANNH01000011.1 GCA000466705_01164 CDS open 33581-34183 _na     200_aa Outer membrane protein beta-barrel domain-containing protein
2293 ANNH01000011.1 GCA000466705_01165 CDS open 34232-34711 _na     159_aa N-acetyltransferase domain-containing protein
2294 ANNH01000011.1 GCA000466705_01166 CDS open 34711-35814 _na     367_aa nusA Transcription termination/antitermination protein NusA
2295 ANNH01000011.1 GCA000466705_01167 CDS open 35987-36229 _na     80_aa HP0268 domain-containing protein
2296 ANNH01000011.1 GCA000466705_01168 CDS open 36229-37530 _na     433_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
2297 ANNH01000011.1 GCA000466705_01169 CDS open 37511-38290 _na     259_aa DUF374 domain-containing protein
2298 ANNH01000011.1 GCA000466705_01170 CDS open 38280-38726 _na     148_aa Tetratricopeptide repeat protein
2299 ANNH01000011.1 GCA000466705_01171 CDS open 38787-39791 _na     334_aa Clan AA aspartic protease
2300 ANNH01000011.1 GCA000466705_01172 CDS open 39788-40309 _na     173_aa pilN Pilus assembly protein PilN
2301 ANNH01000011.1 GCA000466705_01173 CDS open 40302-40838 _na     178_aa Transformation system protein
2302 ANNH01000011.1 GCA000466705_01174 CDS open 41222-41332 _na     36_aa Helix-turn-helix domain-containing protein
2303 ANNH01000011.1 GCA000466705_01175 CDS open 41377-42000 _na     207_aa beta-lactamase
2304 ANNH01000011.1 GCA000466705_01176 CDS open 42013-42672 _na     219_aa beta-lactamase
2305 ANNH01000011.1 GCA000466705_01177 CDS open 42683-44023 _na     446_aa Dihydrolipoamide dehydrogenase
2306 ANNH01000011.1 GCA000466705_01178 CDS open 44020-44337 _na     105_aa Type II secretion system protein
2307 ANNH01000011.1 GCA000466705_01179 CDS open 44415-44966 _na     183_aa beta-lactamase
2308 ANNH01000011.1 GCA000466705_01180 CDS open 45063-45299 _na     78_aa hypothetical protein
2309 ANNH01000011.1 GCA000466705_01181 CDS open 45373-46473 _na     366_aa prfB peptide chain release factor 2
2310 ANNH01000011.1 GCA000466705_01182 CDS open 46594-47415 _na     273_aa panC pantoate--beta-alanine ligase
2311 ANNH01000011.1 GCA000466705_01183 CDS open 47418-48728 _na     436_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
2312 ANNH01000011.1 GCA000466705_01184 CDS open 48725-49717 _na     330_aa tRNA(Ile)-lysidine synthase
2313 ANNH01000011.1 GCA000466705_01185 CDS open 50935-51330 _na     131_aa sseB SseB protein N-terminal domain-containing protein
2314 ANNH01000011.1 GCA000466705_01186 CDS open 51332-51901 _na     189_aa gmhA D-sedoheptulose 7-phosphate isomerase
2315 ANNH01000011.1 GCA000466705_01187 CDS open 51876-53294 _na     472_aa hldE Bifunctional protein HldE
2316 ANNH01000011.1 GCA000466705_01188 CDS open 53287-54276 _na     329_aa rfaD ADP-glyceromanno-heptose 6-epimerase
2317 ANNH01000011.1 GCA000466705_01189 CDS open 54273-54788 _na     171_aa gmhB D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase
2318 ANNH01000011.1 GCA000466705_01190 CDS open 54881-55183 _na     100_aa Cytochrome C553 (Soluble cytochrome f)
2319 ANNH01000011.1 GCA000466705_01191 CDS open 55302-55898 _na     198_aa hypothetical protein
2320 ANNH01000011.1 GCA000466705_01192 CDS open 56025-56576 _na     183_aa epsC serine O-acetyltransferase EpsC
2321 ANNH01000011.1 GCA000466705_01193 CDS open 56581-57486 _na     301_aa cysK cysteine synthase A
2322 ANNH01000011.1 GCA000466705_01194 CDS open 57580-58248 _na     222_aa Endonuclease III
2323 ANNH01000011.1 GCA000466705_01195 CDS open 58245-59009 _na     254_aa AAA+ ATPase domain-containing protein
2324 ANNH01000011.1 GCA000466705_01196 CDS open 59006-61951 _na     981_aa mfd transcription-repair coupling factor
2325 ANNH01000011.1 GCA000466705_01197 CDS open 61932-63134 _na     400_aa tetrahydrofolate synthase
2326 ANNH01000011.1 GCA000466705_01198 CDS open 63131-64705 _na     524_aa GGDEF domain-containing protein
2327 ANNH01000011.1 GCA000466705_01199 CDS open 64686-65225 _na     179_aa Lipoprotein
2328 ANNH01000011.1 GCA000466705_01200 CDS open 65229-67694 _na     821_aa leuS leucine--tRNA ligase
2329 ANNH01000011.1 GCA000466705_01201 CDS open 67703-68041 _na     112_aa macA MacA
2330 ANNH01000011.1 GCA000466705_01202 CDS open 68051-69022 _na     323_aa secF Protein-export membrane protein SecF
2331 ANNH01000011.1 GCA000466705_01203 CDS open 69025-70605 _na     526_aa secD Protein translocase subunit SecD
2332 ANNH01000011.1 GCA000466705_01204 CDS open 70605-70877 _na     90_aa yajC preprotein translocase subunit YajC
2333 ANNH01000011.1 GCA000466705_01205 CDS open 70982-72145 _na     387_aa apolipoprotein N-acyltransferase
2334 ANNH01000011.1 GCA000466705_01206 CDS open 72187-73392 _na     401_aa metK methionine adenosyltransferase
2335 ANNH01000011.1 GCA000466705_01207 CDS open 73531-74898 _na     455_aa sstT serine/threonine transporter SstT
2336 ANNH01000011.1 GCA000466705_01208 CDS open 74986-76707 _na     573_aa Oligoendopeptidase F
2337 ANNH01000011.1 GCA000466705_01209 CDS open 76709-77158 _na     149_aa Stringent starvation protein B
2338 ANNH01000011.1 GCA000466705_01210 CDS open 77210-79279 _na     689_aa DNA 3'-5' helicase
2339 ANNH01000011.1 GCA000466705_01211 CDS open 79276-80097 _na     273_aa truB tRNA pseudouridine(55) synthase TruB
2340 ANNH01000011.1 GCA000466705_01212 CDS open 80091-80321 _na     76_aa csrA carbon storage regulator CsrA
2341 ANNH01000011.1 GCA000466705_01213 CDS open 80318-81061 _na     247_aa 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2342 ANNH01000011.1 GCA000466705_01214 CDS open 81073-81528 _na     151_aa smpB SsrA-binding protein SmpB
2343 ANNH01000011.1 GCA000466705_01215 CDS open 81537-82133 _na     198_aa Thioredoxin domain-containing protein
2344 ANNH01000011.1 GCA000466705_01216 CDS open 82196-82630 _na     144_aa flgB flagellar basal body rod protein FlgB
2345 ANNH01000011.1 GCA000466705_01217 CDS open 82640-83140 _na     166_aa flgC flagellar basal body rod protein FlgC
2346 ANNH01000011.1 GCA000466705_01218 CDS open 83140-83433 _na     97_aa fliE flagellar hook-basal body complex protein FliE
2347 ANNH01000011.1 GCA000466705_01219 CDS open 83442-85274 _na     610_aa ftsI Cell division protein FtsI / penicillin-binding protein
2348 ANNH01000011.1 GCA000466705_01220 CDS open 85363-85824 _na     153_aa Response regulator
2349 ANNH01000011.1 GCA000466705_01221 CDS open 85872-86825 _na     317_aa hemH ferrochelatase
2350 ANNH01000011.1 GCA000466705_01222 CDS open 86825-87694 _na     289_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
2351 ANNH01000011.1 GCA000466705_01223 CDS open 87865-90423 _na     852_aa alaS alanine--tRNA ligase
2352 ANNH01000011.1 GCA000466705_01224 CDS open 90420-90920 _na     166_aa 3-isopropylmalate dehydratase small subunit
2353 ANNH01000011.1 GCA000466705_01225 CDS open 90917-91459 _na     180_aa maf septum formation inhibitor Maf
2354 ANNH01000011.1 GCA000466705_01226 CDS open 91456-93384 _na     642_aa peptidoglycan glycosyltransferase
2355 ANNH01000011.1 GCA000466705_01227 CDS open 93393-93707 _na     104_aa Late competence protein ComEA%2C DNA receptor
2356 ANNH01000011.1 GCA000466705_01228 CDS open 93765-95336 _na     523_aa Phosphoethanolamine transferase
2357 ANNH01000011.1 GCA000466705_01229 CDS open 95381-97399 _na     672_aa Glycine--tRNA ligase beta subunit
2358 ANNH01000011.1 GCA000466705_01230 CDS open 97396-97551 _na     51_aa Small hydrophobic protein
2359 ANNH01000011.1 GCA000466705_01231 CDS open 97552-98946 _na     464_aa Endonuclease/exonuclease/phosphatase domain-containing protein
2360 ANNH01000011.1 GCA000466705_01232 CDS open 98943-99422 _na     159_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
2361 ANNH01000011.1 GCA000466705_01233 CDS open 99521-100687 _na     388_aa CCA tRNA nucleotidyltransferase
2362 ANNH01000011.1 GCA000466705_01234 CDS open 100647-101063 _na     138_aa Campylobacter invasion antigen D C-terminal domain-containing protein
2363 ANNH01000011.1 GCA000466705_01235 CDS open 101060-101305 _na     81_aa Tetratricopeptide repeat protein
2364 ANNH01000011.1 GCA000466705_01236 CDS open 101302-102369 _na     355_aa leuB 3-isopropylmalate dehydrogenase
2365 ANNH01000011.1 GCA000466705_01237 CDS open 102379-102864 _na     161_aa 3-isopropylmalate dehydratase small subunit
2366 ANNH01000011.1 GCA000466705_01238 CDS open 102989-104536 _na     515_aa Flavocytochrome c flavin subunit
2367 ANNH01000011.1 GCA000466705_01239 CDS open 104669-105562 _na     297_aa DUF4299 domain-containing protein
2368 ANNH01000011.1 GCA000466705_01240 CDS open 105731-106330 _na     199_aa Homoserine/Threonine efflux protein
2369 ANNH01000011.1 GCA000466705_01241 CDS open 106617-107030 _na     137_aa DUF1877 domain-containing protein
2370 ANNH01000011.1 GCA000466705_01242 CDS open 107190-108236 _na     348_aa Asparaginase II
2371 ANNH01000011.1 GCA000466705_01243 CDS open 108322-108657 _na     111_aa azlD Branched-chain amino acid transporter AzlD
2372 ANNH01000011.1 GCA000466705_01244 CDS open 108654-109316 _na     220_aa Branched-chain amino acid transport protein
2373 ANNH01000011.1 GCA000466705_01245 CDS open 109466-110425 _na     319_aa beta-lactamase
2374 ANNH01000011.1 GCA000466705_01246 CDS open 110435-110875 _na     146_aa Beta-lactamase
2375 ANNH01000011.1 GCA000466705_01247 CDS open 110943-111521 _na     192_aa tetratricopeptide repeat protein
2376 ANNH01000011.1 GCA000466705_01248 CDS open 111547-111687 _na     46_aa hypothetical protein
2377 ANNH01000011.1 GCA000466705_01249 CDS open 111690-111803 _na     37_aa Phosphohydrolase
2378 ANNH01000011.1 GCA000466705_01250 CDS open 111809-112594 _na     261_aa flgG flagellar basal-body rod protein FlgG
2379 ANNH01000011.1 GCA000466705_01251 CDS open 112613-113422 _na     269_aa Flagellar basal body rod protein
2380 ANNH01000011.1 GCA000466705_01252 CDS open 113573-115426 _na     617_aa rpoD RNA polymerase sigma factor RpoD
2381 ANNH01000011.1 GCA000466705_01253 CDS open 115895-116650 _na     251_aa Flagellin N-terminal domain-containing protein
2382 ANNH01000011.1 GCA000466705_01254 CDS open 116789-118081 _na     430_aa Histidinol dehydrogenase
2383 ANNH01000011.1 GCA000466705_01255 CDS open 118078-118929 _na     283_aa 1-aminocyclopropane-1-carboxylate deaminase
2384 ANNH01000011.1 GCA000466705_01256 CDS open 118922-120013 _na     363_aa OmpA-like domain-containing protein
2385 ANNH01000011.1 GCA000466705_01257 CDS open 120010-121323 _na     437_aa Membrane protein
2386 ANNH01000011.1 GCA000466705_01258 CDS open 121328-122392 _na     354_aa fbaA class II fructose-bisphosphate aldolase
2387 ANNH01000011.1 GCA000466705_01259 CDS open 122408-123226 _na     272_aa peptidylprolyl isomerase
2388 ANNH01000011.1 GCA000466705_01260 CDS open 123321-123953 _na     210_aa nth endonuclease III
2389 ANNH01000011.1 GCA000466705_01126 gene open 243-926
2390 ANNH01000011.1 GCA000466705_01127 gene open 990-2381
2391 ANNH01000011.1 GCA000466705_01128 gene open 2384-2800
2392 ANNH01000011.1 GCA000466705_01129 gene open 2793-3668 cas7b
2393 ANNH01000011.1 GCA000466705_01130 gene open 3668-4408
2394 ANNH01000011.1 GCA000466705_01131 gene open 4405-6618
2395 ANNH01000011.1 GCA000466705_01132 gene open 6618-7118 cas4
2396 ANNH01000011.1 GCA000466705_01133 gene open 7127-7405 cas2
2397 ANNH01000011.1 GCA000466705_01134 gene open 7415-8413 cas1
2398 ANNH01000011.1 GCA000466705_01135 gene open 9398-9919 comE
2399 ANNH01000011.1 GCA000466705_01136 gene open 10056-10412 rplS
2400 ANNH01000011.1 GCA000466705_01137 gene open 10421-11113 trmD
2401 ANNH01000011.1 GCA000466705_01138 gene open 11110-11640 rimM
2402 ANNH01000011.1 GCA000466705_01139 gene open 11633-11875
2403 ANNH01000011.1 GCA000466705_01140 gene open 11875-12102 rpsP
2404 ANNH01000011.1 GCA000466705_01141 gene open 12174-13514 ffh
2405 ANNH01000011.1 GCA000466705_01142 gene open 13577-14335
2406 ANNH01000011.1 GCA000466705_01143 gene open 14332-15468 waaA
2407 ANNH01000011.1 GCA000466705_01144 gene open 15477-16184
2408 ANNH01000011.1 GCA000466705_01145 gene open 16201-16923
2409 ANNH01000011.1 GCA000466705_01146 gene open 16930-17790 glyQ
2410 ANNH01000011.1 GCA000466705_01147 gene open 17801-18217
2411 ANNH01000011.1 GCA000466705_01148 gene open 18222-18695
2412 ANNH01000011.1 GCA000466705_01149 gene open 18707-19201
2413 ANNH01000011.1 GCA000466705_01150 gene open 19198-20457
2414 ANNH01000011.1 GCA000466705_01151 gene open 20457-21215
2415 ANNH01000011.1 GCA000466705_01152 gene open 21352-22131
2416 ANNH01000011.1 GCA000466705_01153 gene open 22219-23649 glnA
2417 ANNH01000011.1 GCA000466705_01154 gene open 24332-25993
2418 ANNH01000011.1 GCA000466705_01155 gene open 26111-26719 lysE
2419 ANNH01000011.1 GCA000466705_01156 gene open 26654-26923 ccoS
2420 ANNH01000011.1 GCA000466705_01157 gene open 26923-29301
2421 ANNH01000011.1 GCA000466705_01158 gene open 29298-29918
2422 ANNH01000011.1 GCA000466705_01159 gene open 30065-30448 ridA
2423 ANNH01000011.1 GCA000466705_01160 gene open 30469-31152
2424 ANNH01000011.1 GCA000466705_01161 gene open 31146-31556
2425 ANNH01000011.1 GCA000466705_01162 gene open 31720-33063 rho
2426 ANNH01000011.1 GCA000466705_01163 gene open 33209-33421
2427 ANNH01000011.1 GCA000466705_01164 gene open 33581-34183
2428 ANNH01000011.1 GCA000466705_01165 gene open 34232-34711
2429 ANNH01000011.1 GCA000466705_01166 gene open 34711-35814 nusA
2430 ANNH01000011.1 GCA000466705_01167 gene open 35987-36229
2431 ANNH01000011.1 GCA000466705_01168 gene open 36229-37530 miaB
2432 ANNH01000011.1 GCA000466705_01169 gene open 37511-38290
2433 ANNH01000011.1 GCA000466705_01170 gene open 38280-38726
2434 ANNH01000011.1 GCA000466705_01171 gene open 38787-39791
2435 ANNH01000011.1 GCA000466705_01172 gene open 39788-40309 pilN
2436 ANNH01000011.1 GCA000466705_01173 gene open 40302-40838
2437 ANNH01000011.1 GCA000466705_01174 gene open 41222-41332
2438 ANNH01000011.1 GCA000466705_01175 gene open 41377-42000
2439 ANNH01000011.1 GCA000466705_01176 gene open 42013-42672
2440 ANNH01000011.1 GCA000466705_01177 gene open 42683-44023
2441 ANNH01000011.1 GCA000466705_01178 gene open 44020-44337
2442 ANNH01000011.1 GCA000466705_01179 gene open 44415-44966
2443 ANNH01000011.1 GCA000466705_01180 gene open 45063-45299
2444 ANNH01000011.1 GCA000466705_01181 gene open 45373-46473 prfB
2445 ANNH01000011.1 GCA000466705_01182 gene open 46594-47415 panC
2446 ANNH01000011.1 GCA000466705_01183 gene open 47418-48728 rimO
2447 ANNH01000011.1 GCA000466705_01184 gene open 48725-49717
2448 ANNH01000011.1 GCA000466705_01185 gene open 50935-51330 sseB
2449 ANNH01000011.1 GCA000466705_01186 gene open 51332-51901 gmhA
2450 ANNH01000011.1 GCA000466705_01187 gene open 51876-53294 hldE
2451 ANNH01000011.1 GCA000466705_01188 gene open 53287-54276 rfaD
2452 ANNH01000011.1 GCA000466705_01189 gene open 54273-54788 gmhB
2453 ANNH01000011.1 GCA000466705_01190 gene open 54881-55183
2454 ANNH01000011.1 GCA000466705_01191 gene open 55302-55898
2455 ANNH01000011.1 GCA000466705_01192 gene open 56025-56576 epsC
2456 ANNH01000011.1 GCA000466705_01193 gene open 56581-57486 cysK
2457 ANNH01000011.1 GCA000466705_01194 gene open 57580-58248
2458 ANNH01000011.1 GCA000466705_01195 gene open 58245-59009
2459 ANNH01000011.1 GCA000466705_01196 gene open 59006-61951 mfd
2460 ANNH01000011.1 GCA000466705_01197 gene open 61932-63134
2461 ANNH01000011.1 GCA000466705_01198 gene open 63131-64705
2462 ANNH01000011.1 GCA000466705_01199 gene open 64686-65225
2463 ANNH01000011.1 GCA000466705_01200 gene open 65229-67694 leuS
2464 ANNH01000011.1 GCA000466705_01201 gene open 67703-68041 macA
2465 ANNH01000011.1 GCA000466705_01202 gene open 68051-69022 secF
2466 ANNH01000011.1 GCA000466705_01203 gene open 69025-70605 secD
2467 ANNH01000011.1 GCA000466705_01204 gene open 70605-70877 yajC
2468 ANNH01000011.1 GCA000466705_01205 gene open 70982-72145
2469 ANNH01000011.1 GCA000466705_01206 gene open 72187-73392 metK
2470 ANNH01000011.1 GCA000466705_01207 gene open 73531-74898 sstT
2471 ANNH01000011.1 GCA000466705_01208 gene open 74986-76707
2472 ANNH01000011.1 GCA000466705_01209 gene open 76709-77158
2473 ANNH01000011.1 GCA000466705_01210 gene open 77210-79279
2474 ANNH01000011.1 GCA000466705_01211 gene open 79276-80097 truB
2475 ANNH01000011.1 GCA000466705_01212 gene open 80091-80321 csrA
2476 ANNH01000011.1 GCA000466705_01213 gene open 80318-81061
2477 ANNH01000011.1 GCA000466705_01214 gene open 81073-81528 smpB
2478 ANNH01000011.1 GCA000466705_01215 gene open 81537-82133
2479 ANNH01000011.1 GCA000466705_01216 gene open 82196-82630 flgB
2480 ANNH01000011.1 GCA000466705_01217 gene open 82640-83140 flgC
2481 ANNH01000011.1 GCA000466705_01218 gene open 83140-83433 fliE
2482 ANNH01000011.1 GCA000466705_01219 gene open 83442-85274 ftsI
2483 ANNH01000011.1 GCA000466705_01220 gene open 85363-85824
2484 ANNH01000011.1 GCA000466705_01221 gene open 85872-86825 hemH
2485 ANNH01000011.1 GCA000466705_01222 gene open 86825-87694
2486 ANNH01000011.1 GCA000466705_01223 gene open 87865-90423 alaS
2487 ANNH01000011.1 GCA000466705_01224 gene open 90420-90920
2488 ANNH01000011.1 GCA000466705_01225 gene open 90917-91459 maf
2489 ANNH01000011.1 GCA000466705_01226 gene open 91456-93384
2490 ANNH01000011.1 GCA000466705_01227 gene open 93393-93707
2491 ANNH01000011.1 GCA000466705_01228 gene open 93765-95336
2492 ANNH01000011.1 GCA000466705_01229 gene open 95381-97399
2493 ANNH01000011.1 GCA000466705_01230 gene open 97396-97551
2494 ANNH01000011.1 GCA000466705_01231 gene open 97552-98946
2495 ANNH01000011.1 GCA000466705_01232 gene open 98943-99422
2496 ANNH01000011.1 GCA000466705_01233 gene open 99521-100687
2497 ANNH01000011.1 GCA000466705_01234 gene open 100647-101063
2498 ANNH01000011.1 GCA000466705_01235 gene open 101060-101305
2499 ANNH01000011.1 GCA000466705_01236 gene open 101302-102369 leuB
2500 ANNH01000011.1 GCA000466705_01237 gene open 102379-102864