BAKTAGenome Explorer: Hornefia nodatum (GCA_000510425.1)
Select a Genome:
|
BAKTA Annotations for GCA_000510425.1
|
Search & Sort all 3381 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AZKM01000001.1 | regulatory_region | open | 82454-82558 | TPP riboswitch aptamer (THI element) | |||
| 2 | AZKM01000001.1 | regulatory_region | open | 89645-89856 | Cobalamin riboswitch aptamer | |||
| 3 | AZKM01000001.1 | GCA000510425_00001 | CDS | open | 130-708 | _na 192_aa | hypothetical protein | |
| 4 | AZKM01000001.1 | GCA000510425_00002 | CDS | open | 598-1176 | _na 192_aa | PF06782 domain protein | |
| 5 | AZKM01000001.1 | GCA000510425_00003 | CDS | open | 1257-1682 | _na 141_aa | PF06782 domain protein | |
| 6 | AZKM01000001.1 | GCA000510425_00010 | CDS | open | 2764-3516 | _na 250_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 7 | AZKM01000001.1 | GCA000510425_00011 | CDS | open | 3716-4813 | _na 365_aa | ychF | redox-regulated ATPase YchF |
| 8 | AZKM01000001.1 | GCA000510425_00012 | CDS | open | 4877-5812 | _na 311_aa | Lipoprotein | |
| 9 | AZKM01000001.1 | GCA000510425_00013 | CDS | open | 5852-6256 | _na 134_aa | hypothetical protein | |
| 10 | AZKM01000001.1 | GCA000510425_00014 | CDS | open | 6417-7376 | _na 319_aa | EamA-like transporter family protein | |
| 11 | AZKM01000001.1 | GCA000510425_00015 | CDS | open | 7380-9056 | _na 558_aa | Beta-Casp domain protein | |
| 12 | AZKM01000001.1 | GCA000510425_00016 | CDS | open | 9084-9644 | _na 186_aa | Glycerol-3-phosphate responsive antiterminator | |
| 13 | AZKM01000001.1 | GCA000510425_00017 | CDS | open | 9764-10561 | _na 265_aa | PHP domain protein | |
| 14 | AZKM01000001.1 | GCA000510425_00018 | CDS | open | 10631-11206 | _na 191_aa | Phosphate propanoyltransferase | |
| 15 | AZKM01000001.1 | GCA000510425_00019 | CDS | open | 11239-11775 | _na 178_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 16 | AZKM01000001.1 | GCA000510425_00020 | CDS | open | 11847-12437 | _na 196_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 17 | AZKM01000001.1 | GCA000510425_00021 | CDS | open | 12447-14846 | _na 799_aa | lon | endopeptidase La |
| 18 | AZKM01000001.1 | GCA000510425_00022 | CDS | open | 14927-16186 | _na 419_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 19 | AZKM01000001.1 | GCA000510425_00023 | CDS | open | 16198-16779 | _na 193_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 20 | AZKM01000001.1 | GCA000510425_00024 | CDS | open | 16798-18135 | _na 445_aa | tig | trigger factor |
| 21 | AZKM01000001.1 | GCA000510425_00025 | CDS | open | 18424-19038 | _na 204_aa | Adenylate cyclase | |
| 22 | AZKM01000001.1 | GCA000510425_00026 | CDS | open | 19118-19603 | _na 161_aa | hypothetical protein | |
| 23 | AZKM01000001.1 | GCA000510425_00027 | CDS | open | 19654-20274 | _na 206_aa | Precorrin-8X methylmutase | |
| 24 | AZKM01000001.1 | GCA000510425_00028 | CDS | open | 20289-21734 | _na 481_aa | cobyric acid synthase | |
| 25 | AZKM01000001.1 | GCA000510425_00029 | CDS | open | 21738-22709 | _na 323_aa | cbiB | adenosylcobinamide-phosphate synthase CbiB |
| 26 | AZKM01000001.1 | GCA000510425_00030 | CDS | open | 22712-23095 | _na 127_aa | CobB/CobQ-like glutamine amidotransferase domain protein | |
| 27 | AZKM01000001.1 | GCA000510425_00031 | CDS | open | 23136-24071 | _na 311_aa | cobyrinate a%2Cc-diamide synthase | |
| 28 | AZKM01000001.1 | GCA000510425_00032 | CDS | open | 24085-25275 | _na 396_aa | cbiT | Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit / precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit multi-domain protein |
| 29 | AZKM01000001.1 | GCA000510425_00033 | CDS | open | 25272-26036 | _na 254_aa | cobK | precorrin-6A reductase |
| 30 | AZKM01000001.1 | GCA000510425_00034 | CDS | open | 26020-26748 | _na 242_aa | Precorrin-3B C(17)-methyltransferase | |
| 31 | AZKM01000001.1 | GCA000510425_00035 | CDS | open | 26748-27830 | _na 360_aa | Cobalamin biosynthesis protein | |
| 32 | AZKM01000001.1 | GCA000510425_00036 | CDS | open | 27830-28579 | _na 249_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 33 | AZKM01000001.1 | GCA000510425_00037 | CDS | open | 28743-29891 | _na 382_aa | cbiD | cobalt-precorrin-5B (C(1))-methyltransferase CbiD |
| 34 | AZKM01000001.1 | GCA000510425_00038 | CDS | open | 30187-31857 | _na 556_aa | gltX | glutamate--tRNA ligase |
| 35 | AZKM01000001.1 | GCA000510425_00039 | CDS | open | 31914-32483 | _na 189_aa | UPF0340 protein HMPREF0378_0295 | |
| 36 | AZKM01000001.1 | GCA000510425_00040 | CDS | open | 32522-33772 | _na 416_aa | adenosylhomocysteinase | |
| 37 | AZKM01000001.1 | GCA000510425_00041 | CDS | open | 33882-35720 | _na 612_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 38 | AZKM01000001.1 | GCA000510425_00042 | CDS | open | 35733-37088 | _na 451_aa | glmM | phosphoglucosamine mutase |
| 39 | AZKM01000001.1 | GCA000510425_00043 | CDS | open | 37188-38114 | _na 308_aa | YbbR-like protein | |
| 40 | AZKM01000001.1 | GCA000510425_00044 | CDS | open | 38101-38946 | _na 281_aa | cdaA | diadenylate cyclase CdaA |
| 41 | AZKM01000001.1 | GCA000510425_00045 | CDS | open | 39225-39752 | _na 175_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 42 | AZKM01000001.1 | GCA000510425_00046 | CDS | open | 40064-40783 | _na 239_aa | comF | ComF family protein |
| 43 | AZKM01000001.1 | GCA000510425_00047 | CDS | open | 40914-43127 | _na 737_aa | recD2 | ATP-dependent RecD2 DNA helicase |
| 44 | AZKM01000001.1 | GCA000510425_00048 | CDS | open | 43134-44102 | _na 322_aa | yhaM | Putative 3'-5' exoribonuclease YhaM |
| 45 | AZKM01000001.1 | GCA000510425_00049 | CDS | open | 44434-45210 | _na 258_aa | Iron transport-associated domain protein | |
| 46 | AZKM01000001.1 | GCA000510425_00050 | CDS | open | 45170-46138 | _na 322_aa | FMN-binding domain protein | |
| 47 | AZKM01000001.1 | GCA000510425_00051 | CDS | open | 46155-48761 | _na 868_aa | PF07550 family protein | |
| 48 | AZKM01000001.1 | GCA000510425_00052 | CDS | open | 48775-51606 | _na 943_aa | PF07550 family protein | |
| 49 | AZKM01000001.1 | GCA000510425_00053 | CDS | open | 51632-53878 | _na 748_aa | Peptidase%2C S8/S53 family | |
| 50 | AZKM01000001.1 | GCA000510425_00054 | CDS | open | 54151-54480 | _na 109_aa | hypothetical protein | |
| 51 | AZKM01000001.1 | GCA000510425_00055 | CDS | open | 54611-55000 | _na 129_aa | Iron dependent repressor%2C metal binding/dimerization domain protein | |
| 52 | AZKM01000001.1 | GCA000510425_00056 | CDS | open | 55029-55949 | _na 306_aa | Iron dependent repressor%2C metal binding/dimerization domain protein | |
| 53 | AZKM01000001.1 | GCA000510425_00057 | CDS | open | 55974-57635 | _na 553_aa | cydC | thiol reductant ABC exporter subunit CydC |
| 54 | AZKM01000001.1 | GCA000510425_00058 | CDS | open | 57632-59419 | _na 595_aa | ABC transporter%2C ATP-binding protein | |
| 55 | AZKM01000001.1 | GCA000510425_00059 | CDS | open | 59373-59846 | _na 157_aa | PF04304 family protein | |
| 56 | AZKM01000001.1 | GCA000510425_00060 | CDS | open | 59836-60660 | _na 274_aa | ABC transporter%2C ATP-binding protein | |
| 57 | AZKM01000001.1 | GCA000510425_00061 | CDS | open | 60650-61714 | _na 354_aa | isdF | putative heme-iron transport system permease protein IsdF |
| 58 | AZKM01000001.1 | GCA000510425_00062 | CDS | open | 61686-62825 | _na 379_aa | isdE | heme ABC transporter substrate-binding protein IsdE |
| 59 | AZKM01000001.1 | GCA000510425_00063 | CDS | open | 62797-63738 | _na 313_aa | Cell surface heme-binding protein Shp | |
| 60 | AZKM01000001.1 | GCA000510425_00064 | CDS | open | 63735-65324 | _na 529_aa | Iron transport-associated domain protein | |
| 61 | AZKM01000001.1 | GCA000510425_00065 | CDS | open | 65741-66892 | _na 383_aa | dnaJ | molecular chaperone DnaJ |
| 62 | AZKM01000001.1 | GCA000510425_00066 | CDS | open | 67090-68979 | _na 629_aa | dnaK | molecular chaperone DnaK |
| 63 | AZKM01000001.1 | GCA000510425_00067 | CDS | open | 68998-69705 | _na 235_aa | grpE | nucleotide exchange factor GrpE |
| 64 | AZKM01000001.1 | GCA000510425_00068 | CDS | open | 69695-70747 | _na 350_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 65 | AZKM01000001.1 | GCA000510425_00069 | CDS | open | 70903-71358 | _na 151_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 66 | AZKM01000001.1 | GCA000510425_00070 | CDS | open | 71418-72260 | _na 280_aa | folP | dihydropteroate synthase |
| 67 | AZKM01000001.1 | GCA000510425_00071 | CDS | open | 72351-73112 | _na 253_aa | folE2 | GTP cyclohydrolase FolE2 |
| 68 | AZKM01000001.1 | GCA000510425_00072 | CDS | open | 73112-73471 | _na 119_aa | queD | 6-carboxytetrahydropterin synthase QueD |
| 69 | AZKM01000001.1 | GCA000510425_00073 | CDS | open | 73652-74347 | _na 231_aa | V-type ATP synthase subunit D | |
| 70 | AZKM01000001.1 | GCA000510425_00074 | CDS | open | 74369-75742 | _na 457_aa | V-type ATP synthase beta chain | |
| 71 | AZKM01000001.1 | GCA000510425_00075 | CDS | open | 75735-77513 | _na 592_aa | V-type ATP synthase alpha chain | |
| 72 | AZKM01000001.1 | GCA000510425_00076 | CDS | open | 77513-77836 | _na 107_aa | V-type ATP synthase subunit F | |
| 73 | AZKM01000001.1 | GCA000510425_00077 | CDS | open | 77829-78836 | _na 335_aa | ATP synthase%2C subunit C | |
| 74 | AZKM01000001.1 | GCA000510425_00078 | CDS | open | 78848-79432 | _na 194_aa | V-type proton ATPase subunit E | |
| 75 | AZKM01000001.1 | GCA000510425_00079 | CDS | open | 79450-79920 | _na 156_aa | V-type ATP synthase subunit K | |
| 76 | AZKM01000001.1 | GCA000510425_00080 | CDS | open | 79917-81911 | _na 664_aa | V-type ATP synthase subunit I | |
| 77 | AZKM01000001.1 | GCA000510425_00081 | CDS | open | 81898-82224 | _na 108_aa | ATP synthase archaeal%2C H subunit | |
| 78 | AZKM01000001.1 | GCA000510425_00082 | CDS | open | 82606-83427 | _na 273_aa | thiM | hydroxyethylthiazole kinase |
| 79 | AZKM01000001.1 | GCA000510425_00083 | CDS | open | 83402-84058 | _na 218_aa | Thiamine-phosphate synthase | |
| 80 | AZKM01000001.1 | GCA000510425_00084 | CDS | open | 84180-84977 | _na 265_aa | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase | |
| 81 | AZKM01000001.1 | GCA000510425_00085 | CDS | open | 85150-87426 | _na 758_aa | Carbohydrate binding domain X2 protein | |
| 82 | AZKM01000001.1 | GCA000510425_00086 | CDS | open | 87654-89504 | _na 616_aa | Repeat%2C PF09479 | |
| 83 | AZKM01000001.1 | GCA000510425_00087 | CDS | open | 90101-92323 | _na 740_aa | Fibronectin type III domain protein | |
| 84 | AZKM01000001.1 | GCA000510425_00001 | gene | open | 130-708 | |||
| 85 | AZKM01000001.1 | GCA000510425_00002 | gene | open | 598-1176 | |||
| 86 | AZKM01000001.1 | GCA000510425_00003 | gene | open | 1257-1682 | |||
| 87 | AZKM01000001.1 | GCA000510425_00010 | gene | open | 2764-3516 | lgt | ||
| 88 | AZKM01000001.1 | GCA000510425_00011 | gene | open | 3716-4813 | ychF | ||
| 89 | AZKM01000001.1 | GCA000510425_00012 | gene | open | 4877-5812 | |||
| 90 | AZKM01000001.1 | GCA000510425_00013 | gene | open | 5852-6256 | |||
| 91 | AZKM01000001.1 | GCA000510425_00014 | gene | open | 6417-7376 | |||
| 92 | AZKM01000001.1 | GCA000510425_00015 | gene | open | 7380-9056 | |||
| 93 | AZKM01000001.1 | GCA000510425_00016 | gene | open | 9084-9644 | |||
| 94 | AZKM01000001.1 | GCA000510425_00017 | gene | open | 9764-10561 | |||
| 95 | AZKM01000001.1 | GCA000510425_00018 | gene | open | 10631-11206 | |||
| 96 | AZKM01000001.1 | GCA000510425_00019 | gene | open | 11239-11775 | hpt | ||
| 97 | AZKM01000001.1 | GCA000510425_00020 | gene | open | 11847-12437 | yihA | ||
| 98 | AZKM01000001.1 | GCA000510425_00021 | gene | open | 12447-14846 | lon | ||
| 99 | AZKM01000001.1 | GCA000510425_00022 | gene | open | 14927-16186 | clpX | ||
| 100 | AZKM01000001.1 | GCA000510425_00023 | gene | open | 16198-16779 | clpP | ||
| 101 | AZKM01000001.1 | GCA000510425_00024 | gene | open | 16798-18135 | tig | ||
| 102 | AZKM01000001.1 | GCA000510425_00025 | gene | open | 18424-19038 | |||
| 103 | AZKM01000001.1 | GCA000510425_00026 | gene | open | 19118-19603 | |||
| 104 | AZKM01000001.1 | GCA000510425_00027 | gene | open | 19654-20274 | |||
| 105 | AZKM01000001.1 | GCA000510425_00028 | gene | open | 20289-21734 | |||
| 106 | AZKM01000001.1 | GCA000510425_00029 | gene | open | 21738-22709 | cbiB | ||
| 107 | AZKM01000001.1 | GCA000510425_00030 | gene | open | 22712-23095 | |||
| 108 | AZKM01000001.1 | GCA000510425_00031 | gene | open | 23136-24071 | |||
| 109 | AZKM01000001.1 | GCA000510425_00032 | gene | open | 24085-25275 | cbiT | ||
| 110 | AZKM01000001.1 | GCA000510425_00033 | gene | open | 25272-26036 | cobK | ||
| 111 | AZKM01000001.1 | GCA000510425_00034 | gene | open | 26020-26748 | |||
| 112 | AZKM01000001.1 | GCA000510425_00035 | gene | open | 26748-27830 | |||
| 113 | AZKM01000001.1 | GCA000510425_00036 | gene | open | 27830-28579 | cobM | ||
| 114 | AZKM01000001.1 | GCA000510425_00037 | gene | open | 28743-29891 | cbiD | ||
| 115 | AZKM01000001.1 | GCA000510425_00038 | gene | open | 30187-31857 | gltX | ||
| 116 | AZKM01000001.1 | GCA000510425_00039 | gene | open | 31914-32483 | |||
| 117 | AZKM01000001.1 | GCA000510425_00040 | gene | open | 32522-33772 | |||
| 118 | AZKM01000001.1 | GCA000510425_00041 | gene | open | 33882-35720 | glmS | ||
| 119 | AZKM01000001.1 | GCA000510425_00042 | gene | open | 35733-37088 | glmM | ||
| 120 | AZKM01000001.1 | GCA000510425_00043 | gene | open | 37188-38114 | |||
| 121 | AZKM01000001.1 | GCA000510425_00044 | gene | open | 38101-38946 | cdaA | ||
| 122 | AZKM01000001.1 | GCA000510425_00045 | gene | open | 39225-39752 | hpf | ||
| 123 | AZKM01000001.1 | GCA000510425_00046 | gene | open | 40064-40783 | comF | ||
| 124 | AZKM01000001.1 | GCA000510425_00047 | gene | open | 40914-43127 | recD2 | ||
| 125 | AZKM01000001.1 | GCA000510425_00048 | gene | open | 43134-44102 | yhaM | ||
| 126 | AZKM01000001.1 | GCA000510425_00049 | gene | open | 44434-45210 | |||
| 127 | AZKM01000001.1 | GCA000510425_00050 | gene | open | 45170-46138 | |||
| 128 | AZKM01000001.1 | GCA000510425_00051 | gene | open | 46155-48761 | |||
| 129 | AZKM01000001.1 | GCA000510425_00052 | gene | open | 48775-51606 | |||
| 130 | AZKM01000001.1 | GCA000510425_00053 | gene | open | 51632-53878 | |||
| 131 | AZKM01000001.1 | GCA000510425_00054 | gene | open | 54151-54480 | |||
| 132 | AZKM01000001.1 | GCA000510425_00055 | gene | open | 54611-55000 | |||
| 133 | AZKM01000001.1 | GCA000510425_00056 | gene | open | 55029-55949 | |||
| 134 | AZKM01000001.1 | GCA000510425_00057 | gene | open | 55974-57635 | cydC | ||
| 135 | AZKM01000001.1 | GCA000510425_00058 | gene | open | 57632-59419 | |||
| 136 | AZKM01000001.1 | GCA000510425_00059 | gene | open | 59373-59846 | |||
| 137 | AZKM01000001.1 | GCA000510425_00060 | gene | open | 59836-60660 | |||
| 138 | AZKM01000001.1 | GCA000510425_00061 | gene | open | 60650-61714 | isdF | ||
| 139 | AZKM01000001.1 | GCA000510425_00062 | gene | open | 61686-62825 | isdE | ||
| 140 | AZKM01000001.1 | GCA000510425_00063 | gene | open | 62797-63738 | |||
| 141 | AZKM01000001.1 | GCA000510425_00064 | gene | open | 63735-65324 | |||
| 142 | AZKM01000001.1 | GCA000510425_00065 | gene | open | 65741-66892 | dnaJ | ||
| 143 | AZKM01000001.1 | GCA000510425_00066 | gene | open | 67090-68979 | dnaK | ||
| 144 | AZKM01000001.1 | GCA000510425_00067 | gene | open | 68998-69705 | grpE | ||
| 145 | AZKM01000001.1 | GCA000510425_00068 | gene | open | 69695-70747 | hrcA | ||
| 146 | AZKM01000001.1 | GCA000510425_00069 | gene | open | 70903-71358 | folK | ||
| 147 | AZKM01000001.1 | GCA000510425_00070 | gene | open | 71418-72260 | folP | ||
| 148 | AZKM01000001.1 | GCA000510425_00071 | gene | open | 72351-73112 | folE2 | ||
| 149 | AZKM01000001.1 | GCA000510425_00072 | gene | open | 73112-73471 | queD | ||
| 150 | AZKM01000001.1 | GCA000510425_00073 | gene | open | 73652-74347 | |||
| 151 | AZKM01000001.1 | GCA000510425_00074 | gene | open | 74369-75742 | |||
| 152 | AZKM01000001.1 | GCA000510425_00075 | gene | open | 75735-77513 | |||
| 153 | AZKM01000001.1 | GCA000510425_00076 | gene | open | 77513-77836 | |||
| 154 | AZKM01000001.1 | GCA000510425_00077 | gene | open | 77829-78836 | |||
| 155 | AZKM01000001.1 | GCA000510425_00078 | gene | open | 78848-79432 | |||
| 156 | AZKM01000001.1 | GCA000510425_00079 | gene | open | 79450-79920 | |||
| 157 | AZKM01000001.1 | GCA000510425_00080 | gene | open | 79917-81911 | |||
| 158 | AZKM01000001.1 | GCA000510425_00081 | gene | open | 81898-82224 | |||
| 159 | AZKM01000001.1 | GCA000510425_00082 | gene | open | 82606-83427 | thiM | ||
| 160 | AZKM01000001.1 | GCA000510425_00083 | gene | open | 83402-84058 | |||
| 161 | AZKM01000001.1 | GCA000510425_00084 | gene | open | 84180-84977 | |||
| 162 | AZKM01000001.1 | GCA000510425_00085 | gene | open | 85150-87426 | |||
| 163 | AZKM01000001.1 | GCA000510425_00086 | gene | open | 87654-89504 | |||
| 164 | AZKM01000001.1 | GCA000510425_00087 | gene | open | 90101-92323 | |||
| 165 | AZKM01000001.1 | GCA000510425_00004 | gene | open | 1939-2015 | trnM | ||
| 166 | AZKM01000001.1 | GCA000510425_00005 | gene | open | 2024-2099 | trnV | ||
| 167 | AZKM01000001.1 | GCA000510425_00006 | gene | open | 2112-2188 | trnD | ||
| 168 | AZKM01000001.1 | GCA000510425_00007 | gene | open | 2257-2332 | trnH | ||
| 169 | AZKM01000001.1 | GCA000510425_00008 | gene | open | 2342-2416 | trnQ | ||
| 170 | AZKM01000001.1 | GCA000510425_00009 | gene | open | 2452-2526 | trnC | ||
| 171 | AZKM01000001.1 | GCA000510425_00004 | tRNA | open | 1939-2015 | trnM | tRNA-Met(cat) | |
| 172 | AZKM01000001.1 | GCA000510425_00005 | tRNA | open | 2024-2099 | trnV | tRNA-Val(tac) | |
| 173 | AZKM01000001.1 | GCA000510425_00006 | tRNA | open | 2112-2188 | trnD | tRNA-Asp(gtc) | |
| 174 | AZKM01000001.1 | GCA000510425_00007 | tRNA | open | 2257-2332 | trnH | tRNA-His(gtg) | |
| 175 | AZKM01000001.1 | GCA000510425_00008 | tRNA | open | 2342-2416 | trnQ | tRNA-Gln(ctg) | |
| 176 | AZKM01000001.1 | GCA000510425_00009 | tRNA | open | 2452-2526 | trnC | tRNA-Cys(gca) | |
| 177 | AZKM01000002.1 | GCA000510425_00088 | gene | open | 302-3185 | rrl | ||
| 178 | AZKM01000002.1 | GCA000510425_00089 | gene | open | 3262-3378 | rrf | ||
| 179 | AZKM01000002.1 | GCA000510425_00088 | rRNA | open | 302-3185 | rrl | 23S ribosomal RNA | |
| 180 | AZKM01000002.1 | GCA000510425_00089 | rRNA | open | 3262-3378 | rrf | 5S ribosomal RNA | |
| 181 | AZKM01000003.1 | regulatory_region | open | 113744-113841 | pemK RNA | |||
| 182 | AZKM01000003.1 | repeat_region | open | 26646-26953 | CRISPR array with 5 repeats of length 30%2C consensus sequence ATTTACATTTCACTATGCTTCTATTAAAAC and spacer length 37 | |||
| 183 | AZKM01000003.1 | GCA000510425_00090 | CDS | open | 142-636 | _na 164_aa | hypothetical protein | |
| 184 | AZKM01000003.1 | GCA000510425_00091 | CDS | open | 948-1634 | _na 228_aa | DNA-binding helix-turn-helix protein | |
| 185 | AZKM01000003.1 | GCA000510425_00092 | CDS | open | 1584-1715 | _na 43_aa | hypothetical protein | |
| 186 | AZKM01000003.1 | GCA000510425_00093 | CDS | open | 1980-3647 | _na 555_aa | retron Ec67 family RNA-directed DNA polymerase/endonuclease | |
| 187 | AZKM01000003.1 | GCA000510425_00094 | CDS | open | 4289-5155 | _na 288_aa | ISNCY family transposase | |
| 188 | AZKM01000003.1 | GCA000510425_00095 | CDS | open | 5105-5203 | _na 32_aa | hypothetical protein | |
| 189 | AZKM01000003.1 | GCA000510425_00096 | CDS | open | 5562-8993 | _na 1143_aa | addB | Putative helicase-exonuclease AddAB%2C AddB subunit |
| 190 | AZKM01000003.1 | GCA000510425_00097 | CDS | open | 9015-11291 | _na 758_aa | Tex-like protein N-terminal domain protein | |
| 191 | AZKM01000003.1 | GCA000510425_00098 | CDS | open | 11399-12496 | _na 365_aa | prfB | peptide chain release factor 2 |
| 192 | AZKM01000003.1 | GCA000510425_00099 | CDS | open | 12489-15275 | _na 928_aa | secA | preprotein translocase subunit SecA |
| 193 | AZKM01000003.1 | GCA000510425_00100 | CDS | open | 15275-16570 | _na 431_aa | Membrane protein%2C PF01595 family | |
| 194 | AZKM01000003.1 | GCA000510425_00101 | CDS | open | 17167-17865 | _na 232_aa | Alpha/beta hydrolase family protein | |
| 195 | AZKM01000003.1 | GCA000510425_00102 | CDS | open | 17880-18896 | _na 338_aa | birA | Bifunctional ligase/repressor BirA |
| 196 | AZKM01000003.1 | GCA000510425_00103 | CDS | open | 19000-19641 | _na 213_aa | Histidine phosphatase superfamily (Branch 1) | |
| 197 | AZKM01000003.1 | GCA000510425_00104 | CDS | open | 19764-20165 | _na 133_aa | Adenosylcobinamide kinase/adenosylcobinamidephosphate guanylyltransferase domain protein | |
| 198 | AZKM01000003.1 | GCA000510425_00105 | CDS | open | 20175-20960 | _na 261_aa | Adenosylcobinamide-GDP ribazoletransferase | |
| 199 | AZKM01000003.1 | GCA000510425_00106 | CDS | open | 21003-21548 | _na 181_aa | Adenosylcobinamide kinase | |
| 200 | AZKM01000003.1 | GCA000510425_00107 | CDS | open | 21551-22684 | _na 377_aa | cobT | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase |
| 201 | AZKM01000003.1 | GCA000510425_00108 | CDS | open | 22847-23779 | _na 310_aa | EamA-like transporter family protein | |
| 202 | AZKM01000003.1 | GCA000510425_00109 | CDS | open | 24024-25376 | _na 450_aa | Permease family protein | |
| 203 | AZKM01000003.1 | GCA000510425_00110 | CDS | open | 25719-26270 | _na 183_aa | Phosphoribosyl transferase domain protein | |
| 204 | AZKM01000003.1 | GCA000510425_00111 | CDS | open | 27492-28478 | _na 328_aa | DUF11 domain-containing protein | |
| 205 | AZKM01000003.1 | GCA000510425_00112 | CDS | open | 28480-28629 | _na 49_aa | Lipoprotein | |
| 206 | AZKM01000003.1 | GCA000510425_00113 | CDS | open | 28626-29450 | _na 274_aa | hypothetical protein | |
| 207 | AZKM01000003.1 | GCA000510425_00114 | CDS | open | 29455-30165 | _na 236_aa | Stage 0 sporulation A-like protein | |
| 208 | AZKM01000003.1 | GCA000510425_00115 | CDS | open | 30178-30906 | _na 242_aa | srtB | class B sortase |
| 209 | AZKM01000003.1 | GCA000510425_00116 | CDS | open | 31233-32771 | _na 512_aa | Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain I | |
| 210 | AZKM01000003.1 | GCA000510425_00117 | CDS | open | 32898-33707 | _na 269_aa | Beta-lactamase-like protein | |
| 211 | AZKM01000003.1 | GCA000510425_00118 | CDS | open | 33801-34217 | _na 138_aa | hypothetical protein | |
| 212 | AZKM01000003.1 | GCA000510425_00119 | CDS | open | 34264-34722 | _na 152_aa | MATE domain protein | |
| 213 | AZKM01000003.1 | GCA000510425_00120 | CDS | open | 34753-36228 | _na 491_aa | energy-coupling factor transporter ATPase | |
| 214 | AZKM01000003.1 | GCA000510425_00121 | CDS | open | 36232-36966 | _na 244_aa | Cobalt transport protein | |
| 215 | AZKM01000003.1 | GCA000510425_00122 | CDS | open | 36966-37547 | _na 193_aa | TIGR02185 family protein | |
| 216 | AZKM01000003.1 | GCA000510425_00123 | CDS | open | 37631-39364 | _na 577_aa | ABC transporter%2C ATP-binding protein | |
| 217 | AZKM01000003.1 | GCA000510425_00124 | CDS | open | 39358-41103 | _na 581_aa | ABC transporter%2C ATP-binding protein | |
| 218 | AZKM01000003.1 | GCA000510425_00125 | CDS | open | 41198-41821 | _na 207_aa | tetR | Transcriptional regulator%2C TetR family |
| 219 | AZKM01000003.1 | GCA000510425_00126 | CDS | open | 42236-45436 | _na 1066_aa | Ig-like domain%2C group 2 | |
| 220 | AZKM01000003.1 | GCA000510425_00127 | CDS | open | 45525-46751 | _na 408_aa | Repeat%2C PF09479 | |
| 221 | AZKM01000003.1 | GCA000510425_00128 | CDS | open | 46771-48699 | _na 642_aa | Papain family cysteine protease | |
| 222 | AZKM01000003.1 | GCA000510425_00129 | CDS | open | 48830-49117 | _na 95_aa | Rubredoxin | |
| 223 | AZKM01000003.1 | GCA000510425_00130 | CDS | open | 49081-49188 | _na 35_aa | hypothetical protein | |
| 224 | AZKM01000003.1 | GCA000510425_00131 | CDS | open | 49203-49361 | _na 52_aa | Rubredoxin | |
| 225 | AZKM01000003.1 | GCA000510425_00132 | CDS | open | 49397-50065 | _na 222_aa | PAP2 family protein | |
| 226 | AZKM01000003.1 | GCA000510425_00133 | CDS | open | 50037-50351 | _na 104_aa | UPF0145 protein HMPREF0378_0708 | |
| 227 | AZKM01000003.1 | GCA000510425_00134 | CDS | open | 50553-51281 | _na 242_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 228 | AZKM01000003.1 | GCA000510425_00135 | CDS | open | 51317-51625 | _na 102_aa | trxA | thioredoxin |
| 229 | AZKM01000003.1 | GCA000510425_00136 | CDS | open | 51851-52558 | _na 235_aa | DUF218 domain-containing protein | |
| 230 | AZKM01000003.1 | GCA000510425_00137 | CDS | open | 52673-53716 | _na 347_aa | aroB | 3-dehydroquinate synthase |
| 231 | AZKM01000003.1 | GCA000510425_00138 | CDS | open | 53807-55078 | _na 423_aa | argininosuccinate synthase | |
| 232 | AZKM01000003.1 | GCA000510425_00139 | CDS | open | 55029-56393 | _na 454_aa | argH | argininosuccinate lyase |
| 233 | AZKM01000003.1 | GCA000510425_00140 | CDS | open | 56533-56916 | _na 127_aa | Reactive intermediate/imine deaminase | |
| 234 | AZKM01000003.1 | GCA000510425_00141 | CDS | open | 57035-57919 | _na 294_aa | PF05656 family protein | |
| 235 | AZKM01000003.1 | GCA000510425_00142 | CDS | open | 58210-59421 | _na 403_aa | IS110 family transposase | |
| 236 | AZKM01000003.1 | GCA000510425_00143 | CDS | open | 59594-60712 | _na 372_aa | Lipoprotein | |
| 237 | AZKM01000003.1 | GCA000510425_00144 | CDS | open | 60927-61460 | _na 177_aa | [ribosomal protein uS5]-alanine N-acetyltransferase | |
| 238 | AZKM01000003.1 | GCA000510425_00145 | CDS | open | 61586-63577 | _na 663_aa | Arylsulfatase | |
| 239 | AZKM01000003.1 | GCA000510425_00146 | CDS | open | 63578-64441 | _na 287_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 240 | AZKM01000003.1 | GCA000510425_00147 | CDS | open | 64398-64955 | _na 185_aa | rnmV | ribonuclease M5 |
| 241 | AZKM01000003.1 | GCA000510425_00148 | CDS | open | 64958-65287 | _na 109_aa | ftsL | Putative cell division protein FtsL |
| 242 | AZKM01000003.1 | GCA000510425_00149 | CDS | open | 65289-66548 | _na 419_aa | Replication initiation and membrane attachment protein%2C DnaB/DnaD family | |
| 243 | AZKM01000003.1 | GCA000510425_00150 | CDS | open | 66538-67863 | _na 441_aa | dnaB | replicative DNA helicase |
| 244 | AZKM01000003.1 | GCA000510425_00151 | CDS | open | 67863-68306 | _na 147_aa | rplI | 50S ribosomal protein L9 |
| 245 | AZKM01000003.1 | GCA000510425_00152 | CDS | open | 68312-70162 | _na 616_aa | DHHA1 domain protein | |
| 246 | AZKM01000003.1 | GCA000510425_00153 | CDS | open | 70839-71039 | _na 66_aa | hypothetical protein | |
| 247 | AZKM01000003.1 | GCA000510425_00154 | CDS | open | 71359-72018 | _na 219_aa | ABC transporter%2C ATP-binding protein | |
| 248 | AZKM01000003.1 | GCA000510425_00155 | CDS | open | 72021-73520 | _na 499_aa | Putative membrane protein | |
| 249 | AZKM01000003.1 | GCA000510425_00156 | CDS | open | 73504-74043 | _na 179_aa | ABC-2 family transporter protein | |
| 250 | AZKM01000003.1 | GCA000510425_00157 | CDS | open | 74006-74257 | _na 83_aa | hypothetical protein | |
| 251 | AZKM01000003.1 | GCA000510425_00158 | CDS | open | 74559-75029 | _na 156_aa | hypothetical protein | |
| 252 | AZKM01000003.1 | GCA000510425_00159 | CDS | open | 75893-76795 | _na 300_aa | ParB-like protein | |
| 253 | AZKM01000003.1 | GCA000510425_00160 | CDS | open | 76792-77568 | _na 258_aa | Sporulation initiation inhibitor protein Soj | |
| 254 | AZKM01000003.1 | GCA000510425_00161 | CDS | open | 77672-78379 | _na 235_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 255 | AZKM01000003.1 | GCA000510425_00162 | CDS | open | 78379-80256 | _na 625_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 256 | AZKM01000003.1 | GCA000510425_00163 | CDS | open | 80273-81640 | _na 455_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 257 | AZKM01000003.1 | GCA000510425_00164 | CDS | open | 81775-82593 | _na 272_aa | jag | RNA-binding cell elongation regulator Jag/EloR |
| 258 | AZKM01000003.1 | GCA000510425_00165 | CDS | open | 82631-83371 | _na 246_aa | 60Kd inner membrane protein | |
| 259 | AZKM01000003.1 | GCA000510425_00166 | CDS | open | 83614-83952 | _na 112_aa | Ribonuclease P protein component | |
| 260 | AZKM01000003.1 | GCA000510425_00167 | CDS | open | 83956-84090 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 261 | AZKM01000003.1 | GCA000510425_00168 | CDS | open | 84570-84812 | _na 80_aa | hypothetical protein | |
| 262 | AZKM01000003.1 | GCA000510425_00169 | CDS | open | 84982-86292 | _na 436_aa | PTS system EIIC component | |
| 263 | AZKM01000003.1 | GCA000510425_00170 | CDS | open | 86484-87926 | _na 480_aa | dnaA | chromosomal replication initiator protein DnaA |
| 264 | AZKM01000003.1 | GCA000510425_00171 | CDS | open | 88072-89178 | _na 368_aa | dnaN | DNA polymerase III subunit beta |
| 265 | AZKM01000003.1 | GCA000510425_00172 | CDS | open | 89180-89503 | _na 107_aa | recF | DNA replication and repair protein RecF domain protein |
| 266 | AZKM01000003.1 | GCA000510425_00173 | CDS | open | 89500-90270 | _na 256_aa | recF | DNA replication/repair protein RecF |
| 267 | AZKM01000003.1 | GCA000510425_00174 | CDS | open | 90295-90528 | _na 77_aa | hypothetical protein | |
| 268 | AZKM01000003.1 | GCA000510425_00175 | CDS | open | 90725-92641 | _na 638_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 269 | AZKM01000003.1 | GCA000510425_00176 | CDS | open | 92700-95174 | _na 824_aa | gyrA | DNA gyrase subunit A |
| 270 | AZKM01000003.1 | GCA000510425_00177 | CDS | open | 95263-95661 | _na 132_aa | rsbW | Serine-protein kinase RsbW family protein |
| 271 | AZKM01000003.1 | GCA000510425_00178 | CDS | open | 95658-96395 | _na 245_aa | Putative RNA polymerase sigma-B factor | |
| 272 | AZKM01000003.1 | GCA000510425_00179 | CDS | open | 96436-96675 | _na 79_aa | Glutaredoxin | |
| 273 | AZKM01000003.1 | GCA000510425_00180 | CDS | open | 96738-97256 | _na 172_aa | hypothetical protein | |
| 274 | AZKM01000003.1 | GCA000510425_00181 | CDS | open | 97458-98006 | _na 182_aa | ribonuclease H | |
| 275 | AZKM01000003.1 | GCA000510425_00182 | CDS | open | 98265-99065 | _na 266_aa | Metallo-beta-lactamase domain protein | |
| 276 | AZKM01000003.1 | GCA000510425_00183 | CDS | open | 99137-99616 | _na 159_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 277 | AZKM01000003.1 | GCA000510425_00184 | CDS | open | 99916-100377 | _na 153_aa | Polyketide cyclase/dehydrase and lipid transport | |
| 278 | AZKM01000003.1 | GCA000510425_00185 | CDS | open | 100553-100939 | _na 128_aa | hypothetical protein | |
| 279 | AZKM01000003.1 | GCA000510425_00186 | CDS | open | 100966-101637 | _na 223_aa | Transglutaminase-like superfamily protein | |
| 280 | AZKM01000003.1 | GCA000510425_00187 | CDS | open | 102105-103154 | _na 349_aa | Relaxase/mobilization nuclease domain protein | |
| 281 | AZKM01000003.1 | GCA000510425_00188 | CDS | open | 103115-103444 | _na 109_aa | mobC | Mobilization protein MobC |
| 282 | AZKM01000003.1 | GCA000510425_00189 | CDS | open | 103743-104381 | _na 212_aa | HTH tetR-type domain-containing protein | |
| 283 | AZKM01000003.1 | GCA000510425_00190 | CDS | open | 104504-105100 | _na 198_aa | TIGR02185 family protein | |
| 284 | AZKM01000003.1 | GCA000510425_00191 | CDS | open | 105090-105803 | _na 237_aa | Cobalt transport protein | |
| 285 | AZKM01000003.1 | GCA000510425_00192 | CDS | open | 105788-107257 | _na 489_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 286 | AZKM01000003.1 | GCA000510425_00193 | CDS | open | 107247-109037 | _na 596_aa | ABC transporter ATP-binding protein | |
| 287 | AZKM01000003.1 | GCA000510425_00194 | CDS | open | 109030-110775 | _na 581_aa | ABC transporter domain-containing protein | |
| 288 | AZKM01000003.1 | GCA000510425_00195 | CDS | open | 110807-112162 | _na 451_aa | mepA | Multidrug export protein MepA |
| 289 | AZKM01000003.1 | GCA000510425_00196 | CDS | open | 112837-113271 | _na 144_aa | Sigma-70%2C region 4 | |
| 290 | AZKM01000003.1 | GCA000510425_00197 | CDS | open | 113252-113503 | _na 83_aa | Helix-turn-helix conjugative transposon-like domain-containing protein | |
| 291 | AZKM01000003.1 | GCA000510425_00198 | CDS | open | 113935-114138 | _na 67_aa | Excisionase | |
| 292 | AZKM01000003.1 | GCA000510425_00199 | CDS | open | 114214-114822 | _na 202_aa | DNA binding domain of tn916 integrase | |
| 293 | AZKM01000003.1 | GCA000510425_00200 | CDS | open | 115331-116380 | _na 349_aa | Efflux ABC transporter%2C permease protein | |
| 294 | AZKM01000003.1 | GCA000510425_00201 | CDS | open | 116390-116668 | _na 92_aa | hypothetical protein | |
| 295 | AZKM01000003.1 | GCA000510425_00202 | CDS | open | 116655-117554 | _na 299_aa | MacB-like periplasmic core domain protein | |
| 296 | AZKM01000003.1 | GCA000510425_00203 | CDS | open | 117555-118217 | _na 220_aa | Putative bacteriocin ABC transporter | |
| 297 | AZKM01000003.1 | GCA000510425_00204 | CDS | open | 118492-119295 | _na 267_aa | atpB | F0F1 ATP synthase subunit A |
| 298 | AZKM01000003.1 | GCA000510425_00205 | CDS | open | 119349-119570 | _na 73_aa | atpE | ATP synthase F0 subunit C |
| 299 | AZKM01000003.1 | GCA000510425_00206 | CDS | open | 119597-120106 | _na 169_aa | atpF | F0F1 ATP synthase subunit B |
| 300 | AZKM01000003.1 | GCA000510425_00207 | CDS | open | 120097-120636 | _na 179_aa | F0F1 ATP synthase subunit delta | |
| 301 | AZKM01000003.1 | GCA000510425_00208 | CDS | open | 120653-122167 | _na 504_aa | atpA | F0F1 ATP synthase subunit alpha |
| 302 | AZKM01000003.1 | GCA000510425_00209 | CDS | open | 122160-123029 | _na 289_aa | atpG | ATP synthase F1 subunit gamma |
| 303 | AZKM01000003.1 | GCA000510425_00210 | CDS | open | 123047-124447 | _na 466_aa | atpD | F0F1 ATP synthase subunit beta |
| 304 | AZKM01000003.1 | GCA000510425_00211 | CDS | open | 124531-124797 | _na 88_aa | ATP synthase%2C delta/epsilon subunit%2C beta-sandwich domain protein | |
| 305 | AZKM01000003.1 | GCA000510425_00212 | CDS | open | 124925-125257 | _na 110_aa | DNA-binding helix-turn-helix protein | |
| 306 | AZKM01000003.1 | GCA000510425_00213 | CDS | open | 125643-125765 | _na 40_aa | hypothetical protein | |
| 307 | AZKM01000003.1 | GCA000510425_00214 | CDS | open | 125836-127068 | _na 410_aa | Amidase domain protein | |
| 308 | AZKM01000003.1 | GCA000510425_00215 | CDS | open | 127093-127722 | _na 209_aa | Lipoprotein | |
| 309 | AZKM01000003.1 | GCA000510425_00090 | gene | open | 142-636 | |||
| 310 | AZKM01000003.1 | GCA000510425_00091 | gene | open | 948-1634 | |||
| 311 | AZKM01000003.1 | GCA000510425_00092 | gene | open | 1584-1715 | |||
| 312 | AZKM01000003.1 | GCA000510425_00093 | gene | open | 1980-3647 | |||
| 313 | AZKM01000003.1 | GCA000510425_00094 | gene | open | 4289-5155 | |||
| 314 | AZKM01000003.1 | GCA000510425_00095 | gene | open | 5105-5203 | |||
| 315 | AZKM01000003.1 | GCA000510425_00096 | gene | open | 5562-8993 | addB | ||
| 316 | AZKM01000003.1 | GCA000510425_00097 | gene | open | 9015-11291 | |||
| 317 | AZKM01000003.1 | GCA000510425_00098 | gene | open | 11399-12496 | prfB | ||
| 318 | AZKM01000003.1 | GCA000510425_00099 | gene | open | 12489-15275 | secA | ||
| 319 | AZKM01000003.1 | GCA000510425_00100 | gene | open | 15275-16570 | |||
| 320 | AZKM01000003.1 | GCA000510425_00101 | gene | open | 17167-17865 | |||
| 321 | AZKM01000003.1 | GCA000510425_00102 | gene | open | 17880-18896 | birA | ||
| 322 | AZKM01000003.1 | GCA000510425_00103 | gene | open | 19000-19641 | |||
| 323 | AZKM01000003.1 | GCA000510425_00104 | gene | open | 19764-20165 | |||
| 324 | AZKM01000003.1 | GCA000510425_00105 | gene | open | 20175-20960 | |||
| 325 | AZKM01000003.1 | GCA000510425_00106 | gene | open | 21003-21548 | |||
| 326 | AZKM01000003.1 | GCA000510425_00107 | gene | open | 21551-22684 | cobT | ||
| 327 | AZKM01000003.1 | GCA000510425_00108 | gene | open | 22847-23779 | |||
| 328 | AZKM01000003.1 | GCA000510425_00109 | gene | open | 24024-25376 | |||
| 329 | AZKM01000003.1 | GCA000510425_00110 | gene | open | 25719-26270 | |||
| 330 | AZKM01000003.1 | GCA000510425_00111 | gene | open | 27492-28478 | |||
| 331 | AZKM01000003.1 | GCA000510425_00112 | gene | open | 28480-28629 | |||
| 332 | AZKM01000003.1 | GCA000510425_00113 | gene | open | 28626-29450 | |||
| 333 | AZKM01000003.1 | GCA000510425_00114 | gene | open | 29455-30165 | |||
| 334 | AZKM01000003.1 | GCA000510425_00115 | gene | open | 30178-30906 | srtB | ||
| 335 | AZKM01000003.1 | GCA000510425_00116 | gene | open | 31233-32771 | |||
| 336 | AZKM01000003.1 | GCA000510425_00117 | gene | open | 32898-33707 | |||
| 337 | AZKM01000003.1 | GCA000510425_00118 | gene | open | 33801-34217 | |||
| 338 | AZKM01000003.1 | GCA000510425_00119 | gene | open | 34264-34722 | |||
| 339 | AZKM01000003.1 | GCA000510425_00120 | gene | open | 34753-36228 | |||
| 340 | AZKM01000003.1 | GCA000510425_00121 | gene | open | 36232-36966 | |||
| 341 | AZKM01000003.1 | GCA000510425_00122 | gene | open | 36966-37547 | |||
| 342 | AZKM01000003.1 | GCA000510425_00123 | gene | open | 37631-39364 | |||
| 343 | AZKM01000003.1 | GCA000510425_00124 | gene | open | 39358-41103 | |||
| 344 | AZKM01000003.1 | GCA000510425_00125 | gene | open | 41198-41821 | tetR | ||
| 345 | AZKM01000003.1 | GCA000510425_00126 | gene | open | 42236-45436 | |||
| 346 | AZKM01000003.1 | GCA000510425_00127 | gene | open | 45525-46751 | |||
| 347 | AZKM01000003.1 | GCA000510425_00128 | gene | open | 46771-48699 | |||
| 348 | AZKM01000003.1 | GCA000510425_00129 | gene | open | 48830-49117 | |||
| 349 | AZKM01000003.1 | GCA000510425_00130 | gene | open | 49081-49188 | |||
| 350 | AZKM01000003.1 | GCA000510425_00131 | gene | open | 49203-49361 | |||
| 351 | AZKM01000003.1 | GCA000510425_00132 | gene | open | 49397-50065 | |||
| 352 | AZKM01000003.1 | GCA000510425_00133 | gene | open | 50037-50351 | |||
| 353 | AZKM01000003.1 | GCA000510425_00134 | gene | open | 50553-51281 | |||
| 354 | AZKM01000003.1 | GCA000510425_00135 | gene | open | 51317-51625 | trxA | ||
| 355 | AZKM01000003.1 | GCA000510425_00136 | gene | open | 51851-52558 | |||
| 356 | AZKM01000003.1 | GCA000510425_00137 | gene | open | 52673-53716 | aroB | ||
| 357 | AZKM01000003.1 | GCA000510425_00138 | gene | open | 53807-55078 | |||
| 358 | AZKM01000003.1 | GCA000510425_00139 | gene | open | 55029-56393 | argH | ||
| 359 | AZKM01000003.1 | GCA000510425_00140 | gene | open | 56533-56916 | |||
| 360 | AZKM01000003.1 | GCA000510425_00141 | gene | open | 57035-57919 | |||
| 361 | AZKM01000003.1 | GCA000510425_00142 | gene | open | 58210-59421 | |||
| 362 | AZKM01000003.1 | GCA000510425_00143 | gene | open | 59594-60712 | |||
| 363 | AZKM01000003.1 | GCA000510425_00144 | gene | open | 60927-61460 | |||
| 364 | AZKM01000003.1 | GCA000510425_00145 | gene | open | 61586-63577 | |||
| 365 | AZKM01000003.1 | GCA000510425_00146 | gene | open | 63578-64441 | rsmA | ||
| 366 | AZKM01000003.1 | GCA000510425_00147 | gene | open | 64398-64955 | rnmV | ||
| 367 | AZKM01000003.1 | GCA000510425_00148 | gene | open | 64958-65287 | ftsL | ||
| 368 | AZKM01000003.1 | GCA000510425_00149 | gene | open | 65289-66548 | |||
| 369 | AZKM01000003.1 | GCA000510425_00150 | gene | open | 66538-67863 | dnaB | ||
| 370 | AZKM01000003.1 | GCA000510425_00151 | gene | open | 67863-68306 | rplI | ||
| 371 | AZKM01000003.1 | GCA000510425_00152 | gene | open | 68312-70162 | |||
| 372 | AZKM01000003.1 | GCA000510425_00153 | gene | open | 70839-71039 | |||
| 373 | AZKM01000003.1 | GCA000510425_00154 | gene | open | 71359-72018 | |||
| 374 | AZKM01000003.1 | GCA000510425_00155 | gene | open | 72021-73520 | |||
| 375 | AZKM01000003.1 | GCA000510425_00156 | gene | open | 73504-74043 | |||
| 376 | AZKM01000003.1 | GCA000510425_00157 | gene | open | 74006-74257 | |||
| 377 | AZKM01000003.1 | GCA000510425_00158 | gene | open | 74559-75029 | |||
| 378 | AZKM01000003.1 | GCA000510425_00159 | gene | open | 75893-76795 | |||
| 379 | AZKM01000003.1 | GCA000510425_00160 | gene | open | 76792-77568 | |||
| 380 | AZKM01000003.1 | GCA000510425_00161 | gene | open | 77672-78379 | rsmG | ||
| 381 | AZKM01000003.1 | GCA000510425_00162 | gene | open | 78379-80256 | mnmG | ||
| 382 | AZKM01000003.1 | GCA000510425_00163 | gene | open | 80273-81640 | mnmE | ||
| 383 | AZKM01000003.1 | GCA000510425_00164 | gene | open | 81775-82593 | jag | ||
| 384 | AZKM01000003.1 | GCA000510425_00165 | gene | open | 82631-83371 | |||
| 385 | AZKM01000003.1 | GCA000510425_00166 | gene | open | 83614-83952 | |||
| 386 | AZKM01000003.1 | GCA000510425_00167 | gene | open | 83956-84090 | rpmH | ||
| 387 | AZKM01000003.1 | GCA000510425_00168 | gene | open | 84570-84812 | |||
| 388 | AZKM01000003.1 | GCA000510425_00169 | gene | open | 84982-86292 | |||
| 389 | AZKM01000003.1 | GCA000510425_00170 | gene | open | 86484-87926 | dnaA | ||
| 390 | AZKM01000003.1 | GCA000510425_00171 | gene | open | 88072-89178 | dnaN | ||
| 391 | AZKM01000003.1 | GCA000510425_00172 | gene | open | 89180-89503 | recF | ||
| 392 | AZKM01000003.1 | GCA000510425_00173 | gene | open | 89500-90270 | recF | ||
| 393 | AZKM01000003.1 | GCA000510425_00174 | gene | open | 90295-90528 | |||
| 394 | AZKM01000003.1 | GCA000510425_00175 | gene | open | 90725-92641 | gyrB | ||
| 395 | AZKM01000003.1 | GCA000510425_00176 | gene | open | 92700-95174 | gyrA | ||
| 396 | AZKM01000003.1 | GCA000510425_00177 | gene | open | 95263-95661 | rsbW | ||
| 397 | AZKM01000003.1 | GCA000510425_00178 | gene | open | 95658-96395 | |||
| 398 | AZKM01000003.1 | GCA000510425_00179 | gene | open | 96436-96675 | |||
| 399 | AZKM01000003.1 | GCA000510425_00180 | gene | open | 96738-97256 | |||
| 400 | AZKM01000003.1 | GCA000510425_00181 | gene | open | 97458-98006 | |||
| 401 | AZKM01000003.1 | GCA000510425_00182 | gene | open | 98265-99065 | |||
| 402 | AZKM01000003.1 | GCA000510425_00183 | gene | open | 99137-99616 | rlmH | ||
| 403 | AZKM01000003.1 | GCA000510425_00184 | gene | open | 99916-100377 | |||
| 404 | AZKM01000003.1 | GCA000510425_00185 | gene | open | 100553-100939 | |||
| 405 | AZKM01000003.1 | GCA000510425_00186 | gene | open | 100966-101637 | |||
| 406 | AZKM01000003.1 | GCA000510425_00187 | gene | open | 102105-103154 | |||
| 407 | AZKM01000003.1 | GCA000510425_00188 | gene | open | 103115-103444 | mobC | ||
| 408 | AZKM01000003.1 | GCA000510425_00189 | gene | open | 103743-104381 | |||
| 409 | AZKM01000003.1 | GCA000510425_00190 | gene | open | 104504-105100 | |||
| 410 | AZKM01000003.1 | GCA000510425_00191 | gene | open | 105090-105803 | |||
| 411 | AZKM01000003.1 | GCA000510425_00192 | gene | open | 105788-107257 | ccmA | ||
| 412 | AZKM01000003.1 | GCA000510425_00193 | gene | open | 107247-109037 | |||
| 413 | AZKM01000003.1 | GCA000510425_00194 | gene | open | 109030-110775 | |||
| 414 | AZKM01000003.1 | GCA000510425_00195 | gene | open | 110807-112162 | mepA | ||
| 415 | AZKM01000003.1 | GCA000510425_00196 | gene | open | 112837-113271 | |||
| 416 | AZKM01000003.1 | GCA000510425_00197 | gene | open | 113252-113503 | |||
| 417 | AZKM01000003.1 | GCA000510425_00198 | gene | open | 113935-114138 | |||
| 418 | AZKM01000003.1 | GCA000510425_00199 | gene | open | 114214-114822 | |||
| 419 | AZKM01000003.1 | GCA000510425_00200 | gene | open | 115331-116380 | |||
| 420 | AZKM01000003.1 | GCA000510425_00201 | gene | open | 116390-116668 | |||
| 421 | AZKM01000003.1 | GCA000510425_00202 | gene | open | 116655-117554 | |||
| 422 | AZKM01000003.1 | GCA000510425_00203 | gene | open | 117555-118217 | |||
| 423 | AZKM01000003.1 | GCA000510425_00204 | gene | open | 118492-119295 | atpB | ||
| 424 | AZKM01000003.1 | GCA000510425_00205 | gene | open | 119349-119570 | atpE | ||
| 425 | AZKM01000003.1 | GCA000510425_00206 | gene | open | 119597-120106 | atpF | ||
| 426 | AZKM01000003.1 | GCA000510425_00207 | gene | open | 120097-120636 | |||
| 427 | AZKM01000003.1 | GCA000510425_00208 | gene | open | 120653-122167 | atpA | ||
| 428 | AZKM01000003.1 | GCA000510425_00209 | gene | open | 122160-123029 | atpG | ||
| 429 | AZKM01000003.1 | GCA000510425_00210 | gene | open | 123047-124447 | atpD | ||
| 430 | AZKM01000003.1 | GCA000510425_00211 | gene | open | 124531-124797 | |||
| 431 | AZKM01000003.1 | GCA000510425_00212 | gene | open | 124925-125257 | |||
| 432 | AZKM01000003.1 | GCA000510425_00213 | gene | open | 125643-125765 | |||
| 433 | AZKM01000003.1 | GCA000510425_00214 | gene | open | 125836-127068 | |||
| 434 | AZKM01000003.1 | GCA000510425_00215 | gene | open | 127093-127722 | |||
| 435 | AZKM01000004.1 | GCA000510425_00216 | gene | open | 727-801 | trnE | ||
| 436 | AZKM01000004.1 | GCA000510425_00216 | tRNA | open | 727-801 | trnE | tRNA-Glu(ttc) | |
| 437 | AZKM01000005.1 | GCA000510425_00217 | CDS | open | 607-1182 | _na 191_aa | Transposase domain protein | |
| 438 | AZKM01000005.1 | GCA000510425_00218 | CDS | open | 1291-2115 | _na 274_aa | IS3 family transposase | |
| 439 | AZKM01000005.1 | GCA000510425_00219 | CDS | open | 2155-2463 | _na 102_aa | Transposase | |
| 440 | AZKM01000005.1 | GCA000510425_00220 | CDS | open | 2731-4269 | _na 512_aa | Na+/H+ antiporter family protein | |
| 441 | AZKM01000005.1 | GCA000510425_00221 | CDS | open | 4291-4722 | _na 143_aa | hypothetical protein | |
| 442 | AZKM01000005.1 | GCA000510425_00222 | CDS | open | 4726-5673 | _na 315_aa | Amidinotransferase | |
| 443 | AZKM01000005.1 | GCA000510425_00223 | CDS | open | 5872-7257 | _na 461_aa | Sigma-54 factor interaction domain-containing protein | |
| 444 | AZKM01000005.1 | GCA000510425_00224 | CDS | open | 7373-8317 | _na 314_aa | Amidinotransferase | |
| 445 | AZKM01000005.1 | GCA000510425_00225 | CDS | open | 9246-10022 | _na 258_aa | Transposase | |
| 446 | AZKM01000005.1 | GCA000510425_00226 | CDS | open | 10857-11135 | _na 92_aa | Sigma-70%2C region 4 | |
| 447 | AZKM01000005.1 | GCA000510425_00217 | gene | open | 607-1182 | |||
| 448 | AZKM01000005.1 | GCA000510425_00218 | gene | open | 1291-2115 | |||
| 449 | AZKM01000005.1 | GCA000510425_00219 | gene | open | 2155-2463 | |||
| 450 | AZKM01000005.1 | GCA000510425_00220 | gene | open | 2731-4269 | |||
| 451 | AZKM01000005.1 | GCA000510425_00221 | gene | open | 4291-4722 | |||
| 452 | AZKM01000005.1 | GCA000510425_00222 | gene | open | 4726-5673 | |||
| 453 | AZKM01000005.1 | GCA000510425_00223 | gene | open | 5872-7257 | |||
| 454 | AZKM01000005.1 | GCA000510425_00224 | gene | open | 7373-8317 | |||
| 455 | AZKM01000005.1 | GCA000510425_00225 | gene | open | 9246-10022 | |||
| 456 | AZKM01000005.1 | GCA000510425_00226 | gene | open | 10857-11135 | |||
| 457 | AZKM01000006.1 | GCA000510425_00248 | gene | open | 26844-27020 | 6S | ||
| 458 | AZKM01000006.1 | GCA000510425_00253 | gene | open | 36515-36855 | RNaseP_bact_a | ||
| 459 | AZKM01000006.1 | GCA000510425_00248 | ncRNA | open | 26844-27020 | 6S / SsrS RNA | ||
| 460 | AZKM01000006.1 | GCA000510425_00253 | ncRNA | open | 36515-36855 | Bacterial RNase P class A | ||
| 461 | AZKM01000006.1 | regulatory_region | open | 59911-60026 | FMN riboswitch aptamer (RFN element) | |||
| 462 | AZKM01000006.1 | GCA000510425_00227 | CDS | open | 1300-2526 | _na 408_aa | Peptidase%2C U32 family | |
| 463 | AZKM01000006.1 | GCA000510425_00228 | CDS | open | 2529-3188 | _na 219_aa | O-methyltransferase | |
| 464 | AZKM01000006.1 | GCA000510425_00229 | CDS | open | 3188-4282 | _na 364_aa | Endolytic murein transglycosylase | |
| 465 | AZKM01000006.1 | GCA000510425_00230 | CDS | open | 4414-4974 | _na 186_aa | efp | elongation factor P |
| 466 | AZKM01000006.1 | GCA000510425_00231 | CDS | open | 5045-5383 | _na 112_aa | UPF0342 protein HMPREF0378_1359 | |
| 467 | AZKM01000006.1 | GCA000510425_00232 | CDS | open | 5401-7329 | _na 642_aa | Ribonuclease J | |
| 468 | AZKM01000006.1 | GCA000510425_00233 | CDS | open | 7342-9813 | _na 823_aa | leuS | leucine--tRNA ligase |
| 469 | AZKM01000006.1 | GCA000510425_00234 | CDS | open | 9856-10770 | _na 304_aa | yqeK | bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK |
| 470 | AZKM01000006.1 | GCA000510425_00235 | CDS | open | 10748-11350 | _na 200_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 471 | AZKM01000006.1 | GCA000510425_00236 | CDS | open | 11363-13135 | _na 590_aa | aspS | aspartate--tRNA ligase |
| 472 | AZKM01000006.1 | GCA000510425_00237 | CDS | open | 13158-14414 | _na 418_aa | hisS | histidine--tRNA ligase |
| 473 | AZKM01000006.1 | GCA000510425_00238 | CDS | open | 14418-15785 | _na 455_aa | hemZ | coproporphyrinogen dehydrogenase HemZ |
| 474 | AZKM01000006.1 | GCA000510425_00239 | CDS | open | 15769-16395 | _na 208_aa | Metallo-beta-lactamase domain protein | |
| 475 | AZKM01000006.1 | GCA000510425_00240 | CDS | open | 16414-18618 | _na 734_aa | GTP diphosphokinase | |
| 476 | AZKM01000006.1 | GCA000510425_00241 | CDS | open | 18645-20966 | _na 773_aa | Multifunctional fusion protein | |
| 477 | AZKM01000006.1 | GCA000510425_00242 | CDS | open | 21310-22554 | _na 414_aa | PF03382 family protein | |
| 478 | AZKM01000006.1 | GCA000510425_00243 | CDS | open | 22818-23255 | _na 145_aa | yajC | preprotein translocase subunit YajC |
| 479 | AZKM01000006.1 | GCA000510425_00246 | CDS | open | 23560-24150 | _na 196_aa | coaE | dephospho-CoA kinase |
| 480 | AZKM01000006.1 | GCA000510425_00247 | CDS | open | 24153-26816 | _na 887_aa | polA | DNA polymerase I |
| 481 | AZKM01000006.1 | GCA000510425_00249 | CDS | open | 27080-27871 | _na 263_aa | YebC/PmpR family DNA-binding transcriptional regulator | |
| 482 | AZKM01000006.1 | GCA000510425_00250 | CDS | open | 27926-30439 | _na 837_aa | Cna protein B-type domain protein | |
| 483 | AZKM01000006.1 | GCA000510425_00251 | CDS | open | 30795-35018 | _na 1407_aa | 2-hydroxyglutaryl-CoA dehydratase%2C D-component | |
| 484 | AZKM01000006.1 | GCA000510425_00252 | CDS | open | 35054-36430 | _na 458_aa | norM | putative multidrug resistance protein NorM |
| 485 | AZKM01000006.1 | GCA000510425_00254 | CDS | open | 36868-37638 | _na 256_aa | Nif3-like dinuclear metal center hexameric protein | |
| 486 | AZKM01000006.1 | GCA000510425_00255 | CDS | open | 37639-38343 | _na 234_aa | PF04816 family protein | |
| 487 | AZKM01000006.1 | GCA000510425_00256 | CDS | open | 38433-39662 | _na 409_aa | rpoD | RNA polymerase sigma factor RpoD |
| 488 | AZKM01000006.1 | GCA000510425_00257 | CDS | open | 39682-41433 | _na 583_aa | DNA primase | |
| 489 | AZKM01000006.1 | GCA000510425_00258 | CDS | open | 41480-42487 | _na 335_aa | deoxyguanosinetriphosphate triphosphohydrolase | |
| 490 | AZKM01000006.1 | GCA000510425_00259 | CDS | open | 42490-42918 | _na 142_aa | dut | dUTP diphosphatase |
| 491 | AZKM01000006.1 | GCA000510425_00260 | CDS | open | 42961-44208 | _na 415_aa | Peptidase%2C M16 family | |
| 492 | AZKM01000006.1 | GCA000510425_00261 | CDS | open | 44195-44389 | _na 64_aa | hypothetical protein | |
| 493 | AZKM01000006.1 | GCA000510425_00262 | CDS | open | 44397-45470 | _na 357_aa | Putative membrane protein | |
| 494 | AZKM01000006.1 | GCA000510425_00263 | CDS | open | 45481-46029 | _na 182_aa | hypothetical protein | |
| 495 | AZKM01000006.1 | GCA000510425_00264 | CDS | open | 46040-46855 | _na 271_aa | murI | glutamate racemase |
| 496 | AZKM01000006.1 | GCA000510425_00265 | CDS | open | 46913-48712 | _na 599_aa | pepF | oligoendopeptidase F |
| 497 | AZKM01000006.1 | GCA000510425_00266 | CDS | open | 48716-49516 | _na 266_aa | NAD kinase | |
| 498 | AZKM01000006.1 | GCA000510425_00267 | CDS | open | 49523-50422 | _na 299_aa | Pseudouridine synthase | |
| 499 | AZKM01000006.1 | GCA000510425_00268 | CDS | open | 50482-52503 | _na 673_aa | bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 | |
| 500 | AZKM01000006.1 | GCA000510425_00269 | CDS | open | 52689-53222 | _na 177_aa | hypothetical protein |

