BAKTAGenome Explorer: Hornefia nodatum (GCA_000510425.1)
Select a Genome:
|
BAKTA Annotations for GCA_000510425.1
|
Search & Sort all 3381 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | AZKM01000008.1 | GCA000510425_00592 | CDS | open | 202793-204664 | _na 623_aa | C69 family dipeptidase | |
| 1002 | AZKM01000008.1 | GCA000510425_00593 | CDS | open | 204819-206027 | _na 402_aa | PF07611 family protein | |
| 1003 | AZKM01000008.1 | GCA000510425_00594 | CDS | open | 206058-207674 | _na 538_aa | Membrane-bound O-acyltransferase family MBOAT | |
| 1004 | AZKM01000008.1 | GCA000510425_00595 | CDS | open | 207705-208895 | _na 396_aa | Pyridoxal-dependent decarboxylase%2C pyridoxal-binding domain protein | |
| 1005 | AZKM01000008.1 | GCA000510425_00596 | CDS | open | 208895-209122 | _na 75_aa | Carrier domain-containing protein | |
| 1006 | AZKM01000008.1 | GCA000510425_00597 | CDS | open | 209194-210699 | _na 501_aa | AMP-binding enzyme | |
| 1007 | AZKM01000008.1 | GCA000510425_00598 | CDS | open | 211026-211226 | _na 66_aa | rpmE | 50S ribosomal protein L31 |
| 1008 | AZKM01000008.1 | GCA000510425_00599 | CDS | open | 211369-212253 | _na 294_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 1009 | AZKM01000008.1 | GCA000510425_00600 | CDS | open | 212264-213301 | _na 345_aa | PF07136 family protein | |
| 1010 | AZKM01000008.1 | GCA000510425_00601 | CDS | open | 213318-214712 | _na 464_aa | rho | transcription termination factor Rho |
| 1011 | AZKM01000008.1 | GCA000510425_00602 | CDS | open | 214966-215364 | _na 132_aa | hypothetical protein | |
| 1012 | AZKM01000008.1 | GCA000510425_00405 | gene | open | 233-952 | |||
| 1013 | AZKM01000008.1 | GCA000510425_00406 | gene | open | 1262-2620 | |||
| 1014 | AZKM01000008.1 | GCA000510425_00407 | gene | open | 2937-5000 | |||
| 1015 | AZKM01000008.1 | GCA000510425_00408 | gene | open | 4981-5070 | |||
| 1016 | AZKM01000008.1 | GCA000510425_00409 | gene | open | 5325-6266 | arcC | ||
| 1017 | AZKM01000008.1 | GCA000510425_00410 | gene | open | 6294-7514 | arcA | ||
| 1018 | AZKM01000008.1 | GCA000510425_00411 | gene | open | 7590-8585 | argF | ||
| 1019 | AZKM01000008.1 | GCA000510425_00412 | gene | open | 8735-10213 | gntR | ||
| 1020 | AZKM01000008.1 | GCA000510425_00413 | gene | open | 10216-11343 | |||
| 1021 | AZKM01000008.1 | GCA000510425_00414 | gene | open | 11408-13156 | |||
| 1022 | AZKM01000008.1 | GCA000510425_00415 | gene | open | 13210-13791 | |||
| 1023 | AZKM01000008.1 | GCA000510425_00416 | gene | open | 13793-15055 | |||
| 1024 | AZKM01000008.1 | GCA000510425_00417 | gene | open | 15396-19067 | |||
| 1025 | AZKM01000008.1 | GCA000510425_00418 | gene | open | 19300-20625 | |||
| 1026 | AZKM01000008.1 | GCA000510425_00419 | gene | open | 20622-21278 | |||
| 1027 | AZKM01000008.1 | GCA000510425_00420 | gene | open | 21643-23019 | |||
| 1028 | AZKM01000008.1 | GCA000510425_00421 | gene | open | 23031-23675 | |||
| 1029 | AZKM01000008.1 | GCA000510425_00422 | gene | open | 23763-25055 | |||
| 1030 | AZKM01000008.1 | GCA000510425_00423 | gene | open | 25445-26638 | tuf | ||
| 1031 | AZKM01000008.1 | GCA000510425_00424 | gene | open | 26750-28816 | fusA | ||
| 1032 | AZKM01000008.1 | GCA000510425_00425 | gene | open | 28831-29301 | rpsG | ||
| 1033 | AZKM01000008.1 | GCA000510425_00426 | gene | open | 29580-29996 | rpsL | ||
| 1034 | AZKM01000008.1 | GCA000510425_00427 | gene | open | 30119-33934 | rpoC | ||
| 1035 | AZKM01000008.1 | GCA000510425_00428 | gene | open | 33952-37632 | rpoB | ||
| 1036 | AZKM01000008.1 | GCA000510425_00429 | gene | open | 37852-38187 | |||
| 1037 | AZKM01000008.1 | GCA000510425_00430 | gene | open | 38375-38737 | rplL | ||
| 1038 | AZKM01000008.1 | GCA000510425_00431 | gene | open | 38775-39320 | rplJ | ||
| 1039 | AZKM01000008.1 | GCA000510425_00432 | gene | open | 39505-40203 | rplA | ||
| 1040 | AZKM01000008.1 | GCA000510425_00433 | gene | open | 40284-40709 | rplK | ||
| 1041 | AZKM01000008.1 | GCA000510425_00434 | gene | open | 40728-41315 | nusG | ||
| 1042 | AZKM01000008.1 | GCA000510425_00435 | gene | open | 41335-41631 | secE | ||
| 1043 | AZKM01000008.1 | GCA000510425_00436 | gene | open | 41644-41793 | rpmG | ||
| 1044 | AZKM01000008.1 | GCA000510425_00437 | gene | open | 42396-43766 | |||
| 1045 | AZKM01000008.1 | GCA000510425_00438 | gene | open | 43893-44744 | |||
| 1046 | AZKM01000008.1 | GCA000510425_00439 | gene | open | 44909-45490 | tetR | ||
| 1047 | AZKM01000008.1 | GCA000510425_00440 | gene | open | 45799-47337 | |||
| 1048 | AZKM01000008.1 | GCA000510425_00441 | gene | open | 47583-49274 | |||
| 1049 | AZKM01000008.1 | GCA000510425_00442 | gene | open | 49278-49595 | |||
| 1050 | AZKM01000008.1 | GCA000510425_00443 | gene | open | 49755-50456 | |||
| 1051 | AZKM01000008.1 | GCA000510425_00444 | gene | open | 50620-51258 | |||
| 1052 | AZKM01000008.1 | GCA000510425_00445 | gene | open | 51379-52368 | |||
| 1053 | AZKM01000008.1 | GCA000510425_00446 | gene | open | 52447-52686 | |||
| 1054 | AZKM01000008.1 | GCA000510425_00447 | gene | open | 52868-56395 | |||
| 1055 | AZKM01000008.1 | GCA000510425_00448 | gene | open | 56589-57335 | rlmB | ||
| 1056 | AZKM01000008.1 | GCA000510425_00449 | gene | open | 57322-57807 | |||
| 1057 | AZKM01000008.1 | GCA000510425_00450 | gene | open | 57857-58687 | thyA | ||
| 1058 | AZKM01000008.1 | GCA000510425_00451 | gene | open | 58684-59082 | |||
| 1059 | AZKM01000008.1 | GCA000510425_00452 | gene | open | 59092-60492 | cysS | ||
| 1060 | AZKM01000008.1 | GCA000510425_00453 | gene | open | 60568-61044 | |||
| 1061 | AZKM01000008.1 | GCA000510425_00454 | gene | open | 61197-62933 | |||
| 1062 | AZKM01000008.1 | GCA000510425_00455 | gene | open | 63008-63481 | |||
| 1063 | AZKM01000008.1 | GCA000510425_00456 | gene | open | 63535-64650 | |||
| 1064 | AZKM01000008.1 | GCA000510425_00457 | gene | open | 64912-66366 | |||
| 1065 | AZKM01000008.1 | GCA000510425_00458 | gene | open | 66381-66746 | |||
| 1066 | AZKM01000008.1 | GCA000510425_00459 | gene | open | 66760-67107 | pqqD | ||
| 1067 | AZKM01000008.1 | GCA000510425_00460 | gene | open | 67100-69025 | |||
| 1068 | AZKM01000008.1 | GCA000510425_00461 | gene | open | 69450-70355 | |||
| 1069 | AZKM01000008.1 | GCA000510425_00462 | gene | open | 70316-71089 | |||
| 1070 | AZKM01000008.1 | GCA000510425_00463 | gene | open | 71410-71703 | |||
| 1071 | AZKM01000008.1 | GCA000510425_00464 | gene | open | 71866-74334 | |||
| 1072 | AZKM01000008.1 | GCA000510425_00465 | gene | open | 74336-76618 | |||
| 1073 | AZKM01000008.1 | GCA000510425_00466 | gene | open | 76621-77637 | |||
| 1074 | AZKM01000008.1 | GCA000510425_00467 | gene | open | 77660-78028 | |||
| 1075 | AZKM01000008.1 | GCA000510425_00468 | gene | open | 78009-78626 | |||
| 1076 | AZKM01000008.1 | GCA000510425_00469 | gene | open | 78623-80380 | |||
| 1077 | AZKM01000008.1 | GCA000510425_00470 | gene | open | 80496-81113 | lysE | ||
| 1078 | AZKM01000008.1 | GCA000510425_00471 | gene | open | 81462-82181 | sfsA | ||
| 1079 | AZKM01000008.1 | GCA000510425_00472 | gene | open | 82178-83053 | |||
| 1080 | AZKM01000008.1 | GCA000510425_00473 | gene | open | 83131-84243 | |||
| 1081 | AZKM01000008.1 | GCA000510425_00474 | gene | open | 84417-85784 | |||
| 1082 | AZKM01000008.1 | GCA000510425_00475 | gene | open | 85747-88104 | |||
| 1083 | AZKM01000008.1 | GCA000510425_00476 | gene | open | 88157-88870 | |||
| 1084 | AZKM01000008.1 | GCA000510425_00477 | gene | open | 89129-90850 | |||
| 1085 | AZKM01000008.1 | GCA000510425_00478 | gene | open | 90852-92615 | |||
| 1086 | AZKM01000008.1 | GCA000510425_00479 | gene | open | 92843-93829 | |||
| 1087 | AZKM01000008.1 | GCA000510425_00480 | gene | open | 93982-94437 | bcp | ||
| 1088 | AZKM01000008.1 | GCA000510425_00481 | gene | open | 94453-95211 | yaaA | ||
| 1089 | AZKM01000008.1 | GCA000510425_00482 | gene | open | 95226-95897 | |||
| 1090 | AZKM01000008.1 | GCA000510425_00483 | gene | open | 96065-97426 | |||
| 1091 | AZKM01000008.1 | GCA000510425_00484 | gene | open | 97398-98327 | eamA | ||
| 1092 | AZKM01000008.1 | GCA000510425_00485 | gene | open | 98352-99662 | |||
| 1093 | AZKM01000008.1 | GCA000510425_00486 | gene | open | 99848-100456 | |||
| 1094 | AZKM01000008.1 | GCA000510425_00487 | gene | open | 100453-102456 | |||
| 1095 | AZKM01000008.1 | GCA000510425_00488 | gene | open | 102502-103311 | thiF | ||
| 1096 | AZKM01000008.1 | GCA000510425_00489 | gene | open | 103308-104081 | cbiK | ||
| 1097 | AZKM01000008.1 | GCA000510425_00490 | gene | open | 104133-104864 | |||
| 1098 | AZKM01000008.1 | GCA000510425_00491 | gene | open | 104874-105716 | |||
| 1099 | AZKM01000008.1 | GCA000510425_00492 | gene | open | 105794-106888 | |||
| 1100 | AZKM01000008.1 | GCA000510425_00493 | gene | open | 107134-107511 | gntR | ||
| 1101 | AZKM01000008.1 | GCA000510425_00494 | gene | open | 107508-108386 | |||
| 1102 | AZKM01000008.1 | GCA000510425_00495 | gene | open | 108397-109035 | |||
| 1103 | AZKM01000008.1 | GCA000510425_00496 | gene | open | 109140-109796 | |||
| 1104 | AZKM01000008.1 | GCA000510425_00497 | gene | open | 109816-110508 | cobI | ||
| 1105 | AZKM01000008.1 | GCA000510425_00498 | gene | open | 110695-112152 | |||
| 1106 | AZKM01000008.1 | GCA000510425_00499 | gene | open | 112155-113009 | hemC | ||
| 1107 | AZKM01000008.1 | GCA000510425_00500 | gene | open | 113006-113602 | |||
| 1108 | AZKM01000008.1 | GCA000510425_00501 | gene | open | 113610-114566 | dusB | ||
| 1109 | AZKM01000008.1 | GCA000510425_00502 | gene | open | 114553-115401 | |||
| 1110 | AZKM01000008.1 | GCA000510425_00503 | gene | open | 115417-116973 | |||
| 1111 | AZKM01000008.1 | GCA000510425_00504 | gene | open | 117001-119160 | ftsH | ||
| 1112 | AZKM01000008.1 | GCA000510425_00505 | gene | open | 119237-120724 | |||
| 1113 | AZKM01000008.1 | GCA000510425_00506 | gene | open | 120789-121004 | |||
| 1114 | AZKM01000008.1 | GCA000510425_00507 | gene | open | 121390-121908 | |||
| 1115 | AZKM01000008.1 | GCA000510425_00508 | gene | open | 121926-122615 | |||
| 1116 | AZKM01000008.1 | GCA000510425_00509 | gene | open | 122811-123002 | |||
| 1117 | AZKM01000008.1 | GCA000510425_00510 | gene | open | 123006-123476 | |||
| 1118 | AZKM01000008.1 | GCA000510425_00511 | gene | open | 123554-125032 | mobQ | ||
| 1119 | AZKM01000008.1 | GCA000510425_00512 | gene | open | 125440-127476 | |||
| 1120 | AZKM01000008.1 | GCA000510425_00513 | gene | open | 127566-127733 | |||
| 1121 | AZKM01000008.1 | GCA000510425_00514 | gene | open | 127733-128434 | |||
| 1122 | AZKM01000008.1 | GCA000510425_00515 | gene | open | 129622-130440 | yktD | ||
| 1123 | AZKM01000008.1 | GCA000510425_00516 | gene | open | 130604-130816 | |||
| 1124 | AZKM01000008.1 | GCA000510425_00517 | gene | open | 130847-131167 | |||
| 1125 | AZKM01000008.1 | GCA000510425_00518 | gene | open | 131264-132142 | |||
| 1126 | AZKM01000008.1 | GCA000510425_00519 | gene | open | 132161-132703 | dfsB | ||
| 1127 | AZKM01000008.1 | GCA000510425_00520 | gene | open | 132710-132973 | |||
| 1128 | AZKM01000008.1 | GCA000510425_00521 | gene | open | 133035-133934 | yobV | ||
| 1129 | AZKM01000008.1 | GCA000510425_00522 | gene | open | 134179-135021 | ydeE | ||
| 1130 | AZKM01000008.1 | GCA000510425_00523 | gene | open | 135164-135478 | tfoX | ||
| 1131 | AZKM01000008.1 | GCA000510425_00524 | gene | open | 135536-135964 | |||
| 1132 | AZKM01000008.1 | GCA000510425_00525 | gene | open | 136023-136802 | menH | ||
| 1133 | AZKM01000008.1 | GCA000510425_00526 | gene | open | 136822-137265 | |||
| 1134 | AZKM01000008.1 | GCA000510425_00527 | gene | open | 137407-137586 | |||
| 1135 | AZKM01000008.1 | GCA000510425_00528 | gene | open | 137651-138019 | |||
| 1136 | AZKM01000008.1 | GCA000510425_00529 | gene | open | 138363-138641 | |||
| 1137 | AZKM01000008.1 | GCA000510425_00530 | gene | open | 138683-139564 | lysR | ||
| 1138 | AZKM01000008.1 | GCA000510425_00531 | gene | open | 139990-140742 | |||
| 1139 | AZKM01000008.1 | GCA000510425_00532 | gene | open | 140735-141592 | |||
| 1140 | AZKM01000008.1 | GCA000510425_00533 | gene | open | 141585-143150 | |||
| 1141 | AZKM01000008.1 | GCA000510425_00534 | gene | open | 143134-143814 | |||
| 1142 | AZKM01000008.1 | GCA000510425_00535 | gene | open | 144082-144570 | |||
| 1143 | AZKM01000008.1 | GCA000510425_00536 | gene | open | 144921-146048 | msrA | ||
| 1144 | AZKM01000008.1 | GCA000510425_00537 | gene | open | 146371-147177 | |||
| 1145 | AZKM01000008.1 | GCA000510425_00538 | gene | open | 147499-148539 | |||
| 1146 | AZKM01000008.1 | GCA000510425_00539 | gene | open | 148536-149564 | |||
| 1147 | AZKM01000008.1 | GCA000510425_00540 | gene | open | 149581-151014 | |||
| 1148 | AZKM01000008.1 | GCA000510425_00541 | gene | open | 151053-151802 | |||
| 1149 | AZKM01000008.1 | GCA000510425_00542 | gene | open | 151867-153339 | |||
| 1150 | AZKM01000008.1 | GCA000510425_00543 | gene | open | 153352-154707 | trkA | ||
| 1151 | AZKM01000008.1 | GCA000510425_00544 | gene | open | 154875-155729 | |||
| 1152 | AZKM01000008.1 | GCA000510425_00546 | gene | open | 156185-156484 | |||
| 1153 | AZKM01000008.1 | GCA000510425_00547 | gene | open | 157703-159061 | |||
| 1154 | AZKM01000008.1 | GCA000510425_00548 | gene | open | 159422-160858 | purB | ||
| 1155 | AZKM01000008.1 | GCA000510425_00549 | gene | open | 160870-162159 | |||
| 1156 | AZKM01000008.1 | GCA000510425_00550 | gene | open | 162183-163322 | alr | ||
| 1157 | AZKM01000008.1 | GCA000510425_00551 | gene | open | 163625-164047 | |||
| 1158 | AZKM01000008.1 | GCA000510425_00552 | gene | open | 164146-164850 | |||
| 1159 | AZKM01000008.1 | GCA000510425_00553 | gene | open | 164863-165642 | ecsC | ||
| 1160 | AZKM01000008.1 | GCA000510425_00554 | gene | open | 165790-166698 | ftcD | ||
| 1161 | AZKM01000008.1 | GCA000510425_00555 | gene | open | 166848-167474 | |||
| 1162 | AZKM01000008.1 | GCA000510425_00556 | gene | open | 167474-168709 | hutI | ||
| 1163 | AZKM01000008.1 | GCA000510425_00557 | gene | open | 168713-170737 | |||
| 1164 | AZKM01000008.1 | GCA000510425_00558 | gene | open | 170879-172420 | hutH | ||
| 1165 | AZKM01000008.1 | GCA000510425_00559 | gene | open | 172949-173425 | |||
| 1166 | AZKM01000008.1 | GCA000510425_00560 | gene | open | 174043-174666 | |||
| 1167 | AZKM01000008.1 | GCA000510425_00561 | gene | open | 174695-175702 | |||
| 1168 | AZKM01000008.1 | GCA000510425_00562 | gene | open | 175989-177287 | |||
| 1169 | AZKM01000008.1 | GCA000510425_00563 | gene | open | 177284-177832 | |||
| 1170 | AZKM01000008.1 | GCA000510425_00564 | gene | open | 177965-178198 | rpsR | ||
| 1171 | AZKM01000008.1 | GCA000510425_00565 | gene | open | 178217-178654 | |||
| 1172 | AZKM01000008.1 | GCA000510425_00566 | gene | open | 178673-178963 | rpsF | ||
| 1173 | AZKM01000008.1 | GCA000510425_00567 | gene | open | 179072-179992 | |||
| 1174 | AZKM01000008.1 | GCA000510425_00568 | gene | open | 180201-181088 | |||
| 1175 | AZKM01000008.1 | GCA000510425_00569 | gene | open | 181328-182809 | |||
| 1176 | AZKM01000008.1 | GCA000510425_00570 | gene | open | 182872-183663 | |||
| 1177 | AZKM01000008.1 | GCA000510425_00571 | gene | open | 183744-184874 | |||
| 1178 | AZKM01000008.1 | GCA000510425_00573 | gene | open | 185283-185468 | |||
| 1179 | AZKM01000008.1 | GCA000510425_00574 | gene | open | 185499-186635 | |||
| 1180 | AZKM01000008.1 | GCA000510425_00575 | gene | open | 186999-187751 | |||
| 1181 | AZKM01000008.1 | GCA000510425_00576 | gene | open | 187835-188563 | |||
| 1182 | AZKM01000008.1 | GCA000510425_00577 | gene | open | 188523-189995 | |||
| 1183 | AZKM01000008.1 | GCA000510425_00578 | gene | open | 189988-190695 | |||
| 1184 | AZKM01000008.1 | GCA000510425_00579 | gene | open | 190944-191603 | |||
| 1185 | AZKM01000008.1 | GCA000510425_00580 | gene | open | 191648-192196 | yfcE | ||
| 1186 | AZKM01000008.1 | GCA000510425_00581 | gene | open | 192441-192833 | rpsI | ||
| 1187 | AZKM01000008.1 | GCA000510425_00582 | gene | open | 192853-193281 | rplM | ||
| 1188 | AZKM01000008.1 | GCA000510425_00583 | gene | open | 193526-193966 | |||
| 1189 | AZKM01000008.1 | GCA000510425_00584 | gene | open | 193976-195499 | nhaC | ||
| 1190 | AZKM01000008.1 | GCA000510425_00585 | gene | open | 196019-197209 | |||
| 1191 | AZKM01000008.1 | GCA000510425_00586 | gene | open | 197259-197807 | tetR | ||
| 1192 | AZKM01000008.1 | GCA000510425_00587 | gene | open | 197931-199265 | tyrS | ||
| 1193 | AZKM01000008.1 | GCA000510425_00588 | gene | open | 199443-200072 | upp | ||
| 1194 | AZKM01000008.1 | GCA000510425_00589 | gene | open | 200165-200596 | rpiB | ||
| 1195 | AZKM01000008.1 | GCA000510425_00590 | gene | open | 200574-201602 | |||
| 1196 | AZKM01000008.1 | GCA000510425_00591 | gene | open | 201602-202666 | prfA | ||
| 1197 | AZKM01000008.1 | GCA000510425_00592 | gene | open | 202793-204664 | |||
| 1198 | AZKM01000008.1 | GCA000510425_00593 | gene | open | 204819-206027 | |||
| 1199 | AZKM01000008.1 | GCA000510425_00594 | gene | open | 206058-207674 | |||
| 1200 | AZKM01000008.1 | GCA000510425_00595 | gene | open | 207705-208895 | |||
| 1201 | AZKM01000008.1 | GCA000510425_00596 | gene | open | 208895-209122 | |||
| 1202 | AZKM01000008.1 | GCA000510425_00597 | gene | open | 209194-210699 | |||
| 1203 | AZKM01000008.1 | GCA000510425_00598 | gene | open | 211026-211226 | rpmE | ||
| 1204 | AZKM01000008.1 | GCA000510425_00599 | gene | open | 211369-212253 | prmC | ||
| 1205 | AZKM01000008.1 | GCA000510425_00600 | gene | open | 212264-213301 | |||
| 1206 | AZKM01000008.1 | GCA000510425_00601 | gene | open | 213318-214712 | rho | ||
| 1207 | AZKM01000008.1 | GCA000510425_00602 | gene | open | 214966-215364 | |||
| 1208 | AZKM01000008.1 | GCA000510425_00545 | gene | open | 155990-156065 | trnR | ||
| 1209 | AZKM01000008.1 | GCA000510425_00572 | gene | open | 184923-184998 | trnK | ||
| 1210 | AZKM01000008.1 | GCA000510425_00545 | tRNA | open | 155990-156065 | trnR | tRNA-Arg(cct) | |
| 1211 | AZKM01000008.1 | GCA000510425_00572 | tRNA | open | 184923-184998 | trnK | tRNA-Lys(ctt) | |
| 1212 | AZKM01000009.1 | regulatory_region | open | 9320-9500 | Cobalamin riboswitch aptamer | |||
| 1213 | AZKM01000009.1 | GCA000510425_00603 | CDS | open | 92-1729 | _na 545_aa | groL | chaperonin GroEL |
| 1214 | AZKM01000009.1 | GCA000510425_00604 | CDS | open | 1744-2022 | _na 92_aa | Co-chaperonin GroES | |
| 1215 | AZKM01000009.1 | GCA000510425_00605 | CDS | open | 2187-3008 | _na 273_aa | DNA-(apurinic or apyrimidinic site) lyase | |
| 1216 | AZKM01000009.1 | GCA000510425_00606 | CDS | open | 3024-4049 | _na 341_aa | AIR synthase | |
| 1217 | AZKM01000009.1 | GCA000510425_00607 | CDS | open | 4046-6013 | _na 655_aa | ligA | NAD-dependent DNA ligase LigA |
| 1218 | AZKM01000009.1 | GCA000510425_00608 | CDS | open | 6043-8256 | _na 737_aa | DNA 3'-5' helicase | |
| 1219 | AZKM01000009.1 | GCA000510425_00609 | CDS | open | 8389-8940 | _na 183_aa | PF14478 domain protein | |
| 1220 | AZKM01000009.1 | GCA000510425_00603 | gene | open | 92-1729 | groL | ||
| 1221 | AZKM01000009.1 | GCA000510425_00604 | gene | open | 1744-2022 | |||
| 1222 | AZKM01000009.1 | GCA000510425_00605 | gene | open | 2187-3008 | |||
| 1223 | AZKM01000009.1 | GCA000510425_00606 | gene | open | 3024-4049 | |||
| 1224 | AZKM01000009.1 | GCA000510425_00607 | gene | open | 4046-6013 | ligA | ||
| 1225 | AZKM01000009.1 | GCA000510425_00608 | gene | open | 6043-8256 | |||
| 1226 | AZKM01000009.1 | GCA000510425_00609 | gene | open | 8389-8940 | |||
| 1227 | AZKM01000010.1 | GCA000510425_00610 | gene | open | 335-1852 | rrs | ||
| 1228 | AZKM01000010.1 | GCA000510425_00610 | rRNA | open | 335-1852 | rrs | 16S ribosomal RNA | |
| 1229 | AZKM01000011.1 | regulatory_region | open | 6896-6961 | pemK RNA | |||
| 1230 | AZKM01000011.1 | repeat_region | open | 37-608 | CRISPR array with 9 repeats of length 30%2C consensus sequence ATTTACATTTCATTATGCTTCTATTAAAAC and spacer length 36 | |||
| 1231 | AZKM01000011.1 | GCA000510425_00611 | CDS | open | 798-1271 | _na 157_aa | cptIN | type III toxin-antitoxin system CptIN family toxin |
| 1232 | AZKM01000011.1 | GCA000510425_00612 | CDS | open | 1561-3105 | _na 514_aa | Resolvase protein | |
| 1233 | AZKM01000011.1 | GCA000510425_00613 | CDS | open | 3110-4789 | _na 559_aa | Recombinase | |
| 1234 | AZKM01000011.1 | GCA000510425_00614 | CDS | open | 4790-6451 | _na 553_aa | Site-specific recombinase | |
| 1235 | AZKM01000011.1 | GCA000510425_00615 | CDS | open | 6596-6826 | _na 76_aa | DUF6870 domain-containing protein | |
| 1236 | AZKM01000011.1 | GCA000510425_00616 | CDS | open | 7290-7700 | _na 136_aa | Sigma-70 family RNA polymerase sigma factor | |
| 1237 | AZKM01000011.1 | GCA000510425_00617 | CDS | open | 8099-9823 | _na 574_aa | ABC transporter ATP-binding protein | |
| 1238 | AZKM01000011.1 | GCA000510425_00618 | CDS | open | 9823-11565 | _na 580_aa | irtA | Iron import ATP-binding/permease protein IrtA |
| 1239 | AZKM01000011.1 | GCA000510425_00619 | CDS | open | 11582-12193 | _na 203_aa | HTH tetR-type domain-containing protein | |
| 1240 | AZKM01000011.1 | GCA000510425_00620 | CDS | open | 12361-13845 | _na 494_aa | ABC transporter domain-containing protein | |
| 1241 | AZKM01000011.1 | GCA000510425_00621 | CDS | open | 13842-14585 | _na 247_aa | ykoC | HMP/thiamine permease protein YkoC |
| 1242 | AZKM01000011.1 | GCA000510425_00622 | CDS | open | 14585-15196 | _na 203_aa | TIGR02185 family protein | |
| 1243 | AZKM01000011.1 | GCA000510425_00623 | CDS | open | 15473-16465 | _na 330_aa | Bacillibactin transport regulator | |
| 1244 | AZKM01000011.1 | GCA000510425_00624 | CDS | open | 16738-17094 | _na 118_aa | mobC | Mobilization protein MobC domain protein |
| 1245 | AZKM01000011.1 | GCA000510425_00625 | CDS | open | 17097-18428 | _na 443_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 1246 | AZKM01000011.1 | GCA000510425_00626 | CDS | open | 18444-18836 | _na 130_aa | SnoaL-like domain-containing protein | |
| 1247 | AZKM01000011.1 | GCA000510425_00627 | CDS | open | 19371-20189 | _na 272_aa | Single-strand binding family protein | |
| 1248 | AZKM01000011.1 | GCA000510425_00628 | CDS | open | 20234-21166 | _na 310_aa | Helicase | |
| 1249 | AZKM01000011.1 | GCA000510425_00611 | gene | open | 798-1271 | cptIN | ||
| 1250 | AZKM01000011.1 | GCA000510425_00612 | gene | open | 1561-3105 | |||
| 1251 | AZKM01000011.1 | GCA000510425_00613 | gene | open | 3110-4789 | |||
| 1252 | AZKM01000011.1 | GCA000510425_00614 | gene | open | 4790-6451 | |||
| 1253 | AZKM01000011.1 | GCA000510425_00615 | gene | open | 6596-6826 | |||
| 1254 | AZKM01000011.1 | GCA000510425_00616 | gene | open | 7290-7700 | |||
| 1255 | AZKM01000011.1 | GCA000510425_00617 | gene | open | 8099-9823 | |||
| 1256 | AZKM01000011.1 | GCA000510425_00618 | gene | open | 9823-11565 | irtA | ||
| 1257 | AZKM01000011.1 | GCA000510425_00619 | gene | open | 11582-12193 | |||
| 1258 | AZKM01000011.1 | GCA000510425_00620 | gene | open | 12361-13845 | |||
| 1259 | AZKM01000011.1 | GCA000510425_00621 | gene | open | 13842-14585 | ykoC | ||
| 1260 | AZKM01000011.1 | GCA000510425_00622 | gene | open | 14585-15196 | |||
| 1261 | AZKM01000011.1 | GCA000510425_00623 | gene | open | 15473-16465 | |||
| 1262 | AZKM01000011.1 | GCA000510425_00624 | gene | open | 16738-17094 | mobC | ||
| 1263 | AZKM01000011.1 | GCA000510425_00625 | gene | open | 17097-18428 | |||
| 1264 | AZKM01000011.1 | GCA000510425_00626 | gene | open | 18444-18836 | |||
| 1265 | AZKM01000011.1 | GCA000510425_00627 | gene | open | 19371-20189 | |||
| 1266 | AZKM01000011.1 | GCA000510425_00628 | gene | open | 20234-21166 | |||
| 1267 | AZKM01000012.1 | regulatory_region | open | 2713-2809 | pemK RNA | |||
| 1268 | AZKM01000012.1 | GCA000510425_00629 | CDS | open | 661-1251 | _na 196_aa | arpU | Phage transcriptional regulator%2C ArpU family |
| 1269 | AZKM01000012.1 | GCA000510425_00630 | CDS | open | 1260-1439 | _na 59_aa | hypothetical protein | |
| 1270 | AZKM01000012.1 | GCA000510425_00631 | CDS | open | 1467-1703 | _na 78_aa | hypothetical protein | |
| 1271 | AZKM01000012.1 | GCA000510425_00632 | CDS | open | 2024-2179 | _na 51_aa | hypothetical protein | |
| 1272 | AZKM01000012.1 | GCA000510425_00633 | CDS | open | 2223-2444 | _na 73_aa | RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein | |
| 1273 | AZKM01000012.1 | GCA000510425_00634 | CDS | open | 3102-3422 | _na 106_aa | Sigma-70%2C region 4 | |
| 1274 | AZKM01000012.1 | GCA000510425_00635 | CDS | open | 3415-3783 | _na 122_aa | Type II toxin-antitoxin system PemK/MazF family toxin | |
| 1275 | AZKM01000012.1 | GCA000510425_00636 | CDS | open | 3879-4124 | _na 81_aa | DNA-binding helix-turn-helix protein | |
| 1276 | AZKM01000012.1 | GCA000510425_00637 | CDS | open | 4121-5284 | _na 387_aa | Site-specific recombinase%2C phage integrase family | |
| 1277 | AZKM01000012.1 | GCA000510425_00638 | CDS | open | 5409-6497 | _na 362_aa | Site-specific recombinase%2C phage integrase family | |
| 1278 | AZKM01000012.1 | GCA000510425_00639 | CDS | open | 6526-6621 | _na 31_aa | hypothetical protein | |
| 1279 | AZKM01000012.1 | GCA000510425_00640 | CDS | open | 6708-7208 | _na 166_aa | hypothetical protein | |
| 1280 | AZKM01000012.1 | GCA000510425_00641 | CDS | open | 7299-7892 | _na 197_aa | Cytidylate kinase-like family protein | |
| 1281 | AZKM01000012.1 | GCA000510425_00642 | CDS | open | 7982-9340 | _na 452_aa | Citrate transporter | |
| 1282 | AZKM01000012.1 | GCA000510425_00643 | CDS | open | 9482-11221 | _na 579_aa | ABC transporter%2C ATP-binding protein | |
| 1283 | AZKM01000012.1 | GCA000510425_00644 | CDS | open | 11214-12989 | _na 591_aa | ABC transporter%2C ATP-binding protein | |
| 1284 | AZKM01000012.1 | GCA000510425_00645 | CDS | open | 13184-13807 | _na 207_aa | tetR | Transcriptional regulator%2C TetR family |
| 1285 | AZKM01000012.1 | GCA000510425_00646 | CDS | open | 14071-15549 | _na 492_aa | thrC | threonine synthase |
| 1286 | AZKM01000012.1 | GCA000510425_00648 | CDS | open | 15962-17455 | _na 497_aa | Na+/H+ antiporter family protein | |
| 1287 | AZKM01000012.1 | GCA000510425_00649 | CDS | open | 17691-18512 | _na 273_aa | N-acetylmuramoyl-L-alanine amidase | |
| 1288 | AZKM01000012.1 | GCA000510425_00650 | CDS | open | 18538-19845 | _na 435_aa | Na+/H+ antiporter family protein | |
| 1289 | AZKM01000012.1 | GCA000510425_00651 | CDS | open | 20038-20709 | _na 223_aa | lexA | transcriptional repressor LexA |
| 1290 | AZKM01000012.1 | GCA000510425_00652 | CDS | open | 20848-21840 | _na 330_aa | Membrane protein%2C PF03956 family | |
| 1291 | AZKM01000012.1 | GCA000510425_00653 | CDS | open | 21915-23012 | _na 365_aa | Alanine racemase%2C N-terminal domain protein | |
| 1292 | AZKM01000012.1 | GCA000510425_00654 | CDS | open | 23206-25842 | _na 878_aa | ppdK | pyruvate%2C phosphate dikinase |
| 1293 | AZKM01000012.1 | GCA000510425_00655 | CDS | open | 25874-27283 | _na 469_aa | glycine--tRNA ligase | |
| 1294 | AZKM01000012.1 | GCA000510425_00656 | CDS | open | 27395-28129 | _na 244_aa | PF14242 domain protein | |
| 1295 | AZKM01000012.1 | GCA000510425_00657 | CDS | open | 28157-28915 | _na 252_aa | recO | DNA repair protein RecO |
| 1296 | AZKM01000012.1 | GCA000510425_00658 | CDS | open | 28915-29817 | _na 300_aa | era | GTPase Era |
| 1297 | AZKM01000012.1 | GCA000510425_00659 | CDS | open | 29845-30222 | _na 125_aa | cdd | cytidine deaminase |
| 1298 | AZKM01000012.1 | GCA000510425_00660 | CDS | open | 30226-30675 | _na 149_aa | ybeY | rRNA maturation RNase YbeY |
| 1299 | AZKM01000012.1 | GCA000510425_00661 | CDS | open | 30681-31640 | _na 319_aa | PhoH-like protein | |
| 1300 | AZKM01000012.1 | GCA000510425_00662 | CDS | open | 32001-35138 | _na 1045_aa | Fibro-slime domain protein | |
| 1301 | AZKM01000012.1 | GCA000510425_00663 | CDS | open | 35197-35937 | _na 246_aa | Gram-positive pilin subunit D1 N-terminal domain-containing protein | |
| 1302 | AZKM01000012.1 | GCA000510425_00664 | CDS | open | 35894-36742 | _na 282_aa | Sortase | |
| 1303 | AZKM01000012.1 | GCA000510425_00665 | CDS | open | 36799-37656 | _na 285_aa | Sortase | |
| 1304 | AZKM01000012.1 | GCA000510425_00666 | CDS | open | 37713-39281 | _na 522_aa | Fimbrial isopeptide formation D2 domain protein | |
| 1305 | AZKM01000012.1 | GCA000510425_00667 | CDS | open | 39681-40133 | _na 150_aa | YqeY-like protein | |
| 1306 | AZKM01000012.1 | GCA000510425_00668 | CDS | open | 40170-40349 | _na 59_aa | rpsU | 30S ribosomal protein S21 |
| 1307 | AZKM01000012.1 | GCA000510425_00669 | CDS | open | 40444-41442 | _na 332_aa | Polysaccharide deacetylase | |
| 1308 | AZKM01000012.1 | GCA000510425_00670 | CDS | open | 41463-41804 | _na 113_aa | Scavenger mRNA decapping enzyme | |
| 1309 | AZKM01000012.1 | GCA000510425_00671 | CDS | open | 41819-43120 | _na 433_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 1310 | AZKM01000012.1 | GCA000510425_00672 | CDS | open | 43117-44085 | _na 322_aa | prmA | 50S ribosomal protein L11 methyltransferase |
| 1311 | AZKM01000012.1 | GCA000510425_00673 | CDS | open | 44191-45618 | _na 475_aa | Transporter%2C major facilitator family protein | |
| 1312 | AZKM01000012.1 | GCA000510425_00674 | CDS | open | 45748-46269 | _na 173_aa | CarD-like protein | |
| 1313 | AZKM01000012.1 | GCA000510425_00675 | CDS | open | 46385-47314 | _na 309_aa | Transketolase%2C pyridine binding domain protein | |
| 1314 | AZKM01000012.1 | GCA000510425_00676 | CDS | open | 47314-48162 | _na 282_aa | Transketolase%2C thiamine pyrophosphate-binding domain protein | |
| 1315 | AZKM01000012.1 | GCA000510425_00677 | CDS | open | 48173-49048 | _na 291_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 1316 | AZKM01000012.1 | GCA000510425_00678 | CDS | open | 49087-50475 | _na 462_aa | mgtE | magnesium transporter |
| 1317 | AZKM01000012.1 | GCA000510425_00679 | CDS | open | 50852-52195 | _na 447_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 1318 | AZKM01000012.1 | GCA000510425_00680 | CDS | open | 52351-53511 | _na 386_aa | D-3-phosphoglycerate dehydrogenase | |
| 1319 | AZKM01000012.1 | GCA000510425_00681 | CDS | open | 53721-55166 | _na 481_aa | Xaa-His dipeptidase | |
| 1320 | AZKM01000012.1 | GCA000510425_00682 | CDS | open | 55336-56715 | _na 459_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 1321 | AZKM01000012.1 | GCA000510425_00683 | CDS | open | 56888-58231 | _na 447_aa | mgsA | MgsA AAA+ ATPase family protein |
| 1322 | AZKM01000012.1 | GCA000510425_00684 | CDS | open | 58315-58785 | _na 156_aa | Thioesterase domain-containing protein | |
| 1323 | AZKM01000012.1 | GCA000510425_00685 | CDS | open | 58880-59821 | _na 313_aa | whiA | DNA-binding protein WhiA |
| 1324 | AZKM01000012.1 | GCA000510425_00686 | CDS | open | 59931-60761 | _na 276_aa | PF05853 family protein | |
| 1325 | AZKM01000012.1 | GCA000510425_00629 | gene | open | 661-1251 | arpU | ||
| 1326 | AZKM01000012.1 | GCA000510425_00630 | gene | open | 1260-1439 | |||
| 1327 | AZKM01000012.1 | GCA000510425_00631 | gene | open | 1467-1703 | |||
| 1328 | AZKM01000012.1 | GCA000510425_00632 | gene | open | 2024-2179 | |||
| 1329 | AZKM01000012.1 | GCA000510425_00633 | gene | open | 2223-2444 | |||
| 1330 | AZKM01000012.1 | GCA000510425_00634 | gene | open | 3102-3422 | |||
| 1331 | AZKM01000012.1 | GCA000510425_00635 | gene | open | 3415-3783 | |||
| 1332 | AZKM01000012.1 | GCA000510425_00636 | gene | open | 3879-4124 | |||
| 1333 | AZKM01000012.1 | GCA000510425_00637 | gene | open | 4121-5284 | |||
| 1334 | AZKM01000012.1 | GCA000510425_00638 | gene | open | 5409-6497 | |||
| 1335 | AZKM01000012.1 | GCA000510425_00639 | gene | open | 6526-6621 | |||
| 1336 | AZKM01000012.1 | GCA000510425_00640 | gene | open | 6708-7208 | |||
| 1337 | AZKM01000012.1 | GCA000510425_00641 | gene | open | 7299-7892 | |||
| 1338 | AZKM01000012.1 | GCA000510425_00642 | gene | open | 7982-9340 | |||
| 1339 | AZKM01000012.1 | GCA000510425_00643 | gene | open | 9482-11221 | |||
| 1340 | AZKM01000012.1 | GCA000510425_00644 | gene | open | 11214-12989 | |||
| 1341 | AZKM01000012.1 | GCA000510425_00645 | gene | open | 13184-13807 | tetR | ||
| 1342 | AZKM01000012.1 | GCA000510425_00646 | gene | open | 14071-15549 | thrC | ||
| 1343 | AZKM01000012.1 | GCA000510425_00648 | gene | open | 15962-17455 | |||
| 1344 | AZKM01000012.1 | GCA000510425_00649 | gene | open | 17691-18512 | |||
| 1345 | AZKM01000012.1 | GCA000510425_00650 | gene | open | 18538-19845 | |||
| 1346 | AZKM01000012.1 | GCA000510425_00651 | gene | open | 20038-20709 | lexA | ||
| 1347 | AZKM01000012.1 | GCA000510425_00652 | gene | open | 20848-21840 | |||
| 1348 | AZKM01000012.1 | GCA000510425_00653 | gene | open | 21915-23012 | |||
| 1349 | AZKM01000012.1 | GCA000510425_00654 | gene | open | 23206-25842 | ppdK | ||
| 1350 | AZKM01000012.1 | GCA000510425_00655 | gene | open | 25874-27283 | |||
| 1351 | AZKM01000012.1 | GCA000510425_00656 | gene | open | 27395-28129 | |||
| 1352 | AZKM01000012.1 | GCA000510425_00657 | gene | open | 28157-28915 | recO | ||
| 1353 | AZKM01000012.1 | GCA000510425_00658 | gene | open | 28915-29817 | era | ||
| 1354 | AZKM01000012.1 | GCA000510425_00659 | gene | open | 29845-30222 | cdd | ||
| 1355 | AZKM01000012.1 | GCA000510425_00660 | gene | open | 30226-30675 | ybeY | ||
| 1356 | AZKM01000012.1 | GCA000510425_00661 | gene | open | 30681-31640 | |||
| 1357 | AZKM01000012.1 | GCA000510425_00662 | gene | open | 32001-35138 | |||
| 1358 | AZKM01000012.1 | GCA000510425_00663 | gene | open | 35197-35937 | |||
| 1359 | AZKM01000012.1 | GCA000510425_00664 | gene | open | 35894-36742 | |||
| 1360 | AZKM01000012.1 | GCA000510425_00665 | gene | open | 36799-37656 | |||
| 1361 | AZKM01000012.1 | GCA000510425_00666 | gene | open | 37713-39281 | |||
| 1362 | AZKM01000012.1 | GCA000510425_00667 | gene | open | 39681-40133 | |||
| 1363 | AZKM01000012.1 | GCA000510425_00668 | gene | open | 40170-40349 | rpsU | ||
| 1364 | AZKM01000012.1 | GCA000510425_00669 | gene | open | 40444-41442 | |||
| 1365 | AZKM01000012.1 | GCA000510425_00670 | gene | open | 41463-41804 | |||
| 1366 | AZKM01000012.1 | GCA000510425_00671 | gene | open | 41819-43120 | mtaB | ||
| 1367 | AZKM01000012.1 | GCA000510425_00672 | gene | open | 43117-44085 | prmA | ||
| 1368 | AZKM01000012.1 | GCA000510425_00673 | gene | open | 44191-45618 | |||
| 1369 | AZKM01000012.1 | GCA000510425_00674 | gene | open | 45748-46269 | |||
| 1370 | AZKM01000012.1 | GCA000510425_00675 | gene | open | 46385-47314 | |||
| 1371 | AZKM01000012.1 | GCA000510425_00676 | gene | open | 47314-48162 | |||
| 1372 | AZKM01000012.1 | GCA000510425_00677 | gene | open | 48173-49048 | |||
| 1373 | AZKM01000012.1 | GCA000510425_00678 | gene | open | 49087-50475 | mgtE | ||
| 1374 | AZKM01000012.1 | GCA000510425_00679 | gene | open | 50852-52195 | gdhA | ||
| 1375 | AZKM01000012.1 | GCA000510425_00680 | gene | open | 52351-53511 | |||
| 1376 | AZKM01000012.1 | GCA000510425_00681 | gene | open | 53721-55166 | |||
| 1377 | AZKM01000012.1 | GCA000510425_00682 | gene | open | 55336-56715 | brnQ | ||
| 1378 | AZKM01000012.1 | GCA000510425_00683 | gene | open | 56888-58231 | mgsA | ||
| 1379 | AZKM01000012.1 | GCA000510425_00684 | gene | open | 58315-58785 | |||
| 1380 | AZKM01000012.1 | GCA000510425_00685 | gene | open | 58880-59821 | whiA | ||
| 1381 | AZKM01000012.1 | GCA000510425_00686 | gene | open | 59931-60761 | |||
| 1382 | AZKM01000012.1 | GCA000510425_00647 | gene | open | 15644-15718 | trnE | ||
| 1383 | AZKM01000012.1 | GCA000510425_00647 | tRNA | open | 15644-15718 | trnE | tRNA-Glu(ctc) | |
| 1384 | AZKM01000015.1 | GCA000510425_00687 | CDS | open | 67-579 | _na 170_aa | DNA-binding helix-turn-helix protein | |
| 1385 | AZKM01000015.1 | GCA000510425_00687 | gene | open | 67-579 | |||
| 1386 | AZKM01000016.1 | GCA000510425_00713 | gene | open | 30128-30321 | Bacteria_large_SRP | ||
| 1387 | AZKM01000016.1 | GCA000510425_00714 | gene | open | 30160-30259 | Bacteria_small_SRP | ||
| 1388 | AZKM01000016.1 | GCA000510425_00713 | ncRNA | open | 30128-30321 | Bacterial large signal recognition particle RNA | ||
| 1389 | AZKM01000016.1 | GCA000510425_00714 | ncRNA | open | 30160-30259 | Bacterial small signal recognition particle RNA | ||
| 1390 | AZKM01000016.1 | regulatory_region | open | 15236-15452 | Cobalamin riboswitch aptamer | |||
| 1391 | AZKM01000016.1 | GCA000510425_00688 | CDS | open | 806-4897 | _na 1363_aa | PF14478 domain protein | |
| 1392 | AZKM01000016.1 | GCA000510425_00689 | CDS | open | 4954-7749 | _na 931_aa | Ig-like domain%2C group 2 | |
| 1393 | AZKM01000016.1 | GCA000510425_00690 | CDS | open | 7819-9000 | _na 393_aa | DUF4430 domain-containing protein | |
| 1394 | AZKM01000016.1 | GCA000510425_00691 | CDS | open | 9379-10152 | _na 257_aa | Lipoprotein | |
| 1395 | AZKM01000016.1 | GCA000510425_00692 | CDS | open | 10194-10973 | _na 259_aa | Xylose isomerase-like TIM barrel domain protein | |
| 1396 | AZKM01000016.1 | GCA000510425_00693 | CDS | open | 10977-11960 | _na 327_aa | ECF-type riboflavin transporter%2C S component | |
| 1397 | AZKM01000016.1 | GCA000510425_00694 | CDS | open | 11921-13756 | _na 611_aa | energy-coupling factor transporter ATPase | |
| 1398 | AZKM01000016.1 | GCA000510425_00695 | CDS | open | 13729-14631 | _na 300_aa | Cobalt transport domain protein | |
| 1399 | AZKM01000016.1 | GCA000510425_00696 | CDS | open | 14854-15144 | _na 96_aa | hypothetical protein | |
| 1400 | AZKM01000016.1 | GCA000510425_00697 | CDS | open | 15544-15825 | _na 93_aa | Cysteine-rich small domain protein | |
| 1401 | AZKM01000016.1 | GCA000510425_00698 | CDS | open | 15907-16881 | _na 324_aa | CobW/P47K family protein | |
| 1402 | AZKM01000016.1 | GCA000510425_00699 | CDS | open | 17024-18106 | _na 360_aa | CobW/P47K family protein | |
| 1403 | AZKM01000016.1 | GCA000510425_00700 | CDS | open | 18268-19173 | _na 301_aa | PF04286 domain protein | |
| 1404 | AZKM01000016.1 | GCA000510425_00701 | CDS | open | 19175-19663 | _na 162_aa | recX | Regulatory protein RecX |
| 1405 | AZKM01000016.1 | GCA000510425_00702 | CDS | open | 19683-20219 | _na 178_aa | 4'-phosphopantetheinyl transferase family protein | |
| 1406 | AZKM01000016.1 | GCA000510425_00703 | CDS | open | 20349-20642 | _na 97_aa | trpR | TrpR family protein YerC/YecD |
| 1407 | AZKM01000016.1 | GCA000510425_00704 | CDS | open | 20784-21968 | _na 394_aa | Peptidase%2C S41 family | |
| 1408 | AZKM01000016.1 | GCA000510425_00705 | CDS | open | 22033-23676 | _na 547_aa | recJ | single-stranded-DNA-specific exonuclease RecJ |
| 1409 | AZKM01000016.1 | GCA000510425_00706 | CDS | open | 23785-24831 | _na 348_aa | Peptidase%2C M23 family | |
| 1410 | AZKM01000016.1 | GCA000510425_00707 | CDS | open | 24889-25779 | _na 296_aa | ftsX | permease-like cell division protein FtsX |
| 1411 | AZKM01000016.1 | GCA000510425_00708 | CDS | open | 25772-26488 | _na 238_aa | ftsE | cell division ATP-binding protein FtsE |
| 1412 | AZKM01000016.1 | GCA000510425_00709 | CDS | open | 26711-27289 | _na 192_aa | PF11667 family protein | |
| 1413 | AZKM01000016.1 | GCA000510425_00710 | CDS | open | 27429-28031 | _na 200_aa | recR | recombination mediator RecR |
| 1414 | AZKM01000016.1 | GCA000510425_00711 | CDS | open | 28049-28411 | _na 120_aa | YbaB/EbfC family nucleoid-associated protein | |
| 1415 | AZKM01000016.1 | GCA000510425_00712 | CDS | open | 28436-30094 | _na 552_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 1416 | AZKM01000016.1 | GCA000510425_00715 | CDS | open | 30450-31532 | _na 360_aa | Acyltransferase 3 domain-containing protein | |
| 1417 | AZKM01000016.1 | GCA000510425_00716 | CDS | open | 31546-33489 | _na 647_aa | Metallo-beta-lactamase domain protein | |
| 1418 | AZKM01000016.1 | GCA000510425_00717 | CDS | open | 33579-34904 | _na 441_aa | DUF1254 domain-containing protein | |
| 1419 | AZKM01000016.1 | GCA000510425_00718 | CDS | open | 34926-35573 | _na 215_aa | tetR | Transcriptional regulator%2C TetR family |
| 1420 | AZKM01000016.1 | GCA000510425_00719 | CDS | open | 35749-36558 | _na 269_aa | Asp23/Gls24 family envelope stress response protein | |
| 1421 | AZKM01000016.1 | GCA000510425_00720 | CDS | open | 36635-36805 | _na 56_aa | Ferredoxin | |
| 1422 | AZKM01000016.1 | GCA000510425_00721 | CDS | open | 36887-37543 | _na 218_aa | redox-sensing transcriptional repressor Rex | |
| 1423 | AZKM01000016.1 | GCA000510425_00722 | CDS | open | 37760-37993 | _na 77_aa | acpP | acyl carrier protein |
| 1424 | AZKM01000016.1 | GCA000510425_00723 | CDS | open | 38067-40043 | _na 658_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 1425 | AZKM01000016.1 | GCA000510425_00724 | CDS | open | 40046-41062 | _na 338_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 1426 | AZKM01000016.1 | GCA000510425_00725 | CDS | open | 41063-41539 | _na 158_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 1427 | AZKM01000016.1 | GCA000510425_00726 | CDS | open | 41524-42282 | _na 252_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 1428 | AZKM01000016.1 | GCA000510425_00727 | CDS | open | 42270-42689 | _na 139_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 1429 | AZKM01000016.1 | GCA000510425_00728 | CDS | open | 42686-43237 | _na 183_aa | Riboflavin transporter | |
| 1430 | AZKM01000016.1 | GCA000510425_00729 | CDS | open | 43234-44667 | _na 477_aa | pepV | dipeptidase PepV |
| 1431 | AZKM01000016.1 | GCA000510425_00730 | CDS | open | 44694-44918 | _na 74_aa | NifU-like protein | |
| 1432 | AZKM01000016.1 | GCA000510425_00731 | CDS | open | 45045-48488 | _na 1147_aa | pyruvate carboxylase | |
| 1433 | AZKM01000016.1 | GCA000510425_00732 | CDS | open | 48581-49402 | _na 273_aa | mscS | Transporter%2C small conductance mechanosensitive ion channel MscS family protein |
| 1434 | AZKM01000016.1 | GCA000510425_00733 | CDS | open | 49418-51289 | _na 623_aa | typA | translational GTPase TypA |
| 1435 | AZKM01000016.1 | GCA000510425_00734 | CDS | open | 51417-53342 | _na 641_aa | Membrane protein%2C PF09972 family | |
| 1436 | AZKM01000016.1 | GCA000510425_00735 | CDS | open | 53342-53899 | _na 185_aa | lemA | LemA family protein |
| 1437 | AZKM01000016.1 | GCA000510425_00736 | CDS | open | 54421-59880 | _na 1819_aa | MBG domain-containing protein | |
| 1438 | AZKM01000016.1 | GCA000510425_00737 | CDS | open | 60798-62915 | _na 705_aa | Leucine rich repeat domain protein | |
| 1439 | AZKM01000016.1 | GCA000510425_00738 | CDS | open | 63167-64408 | _na 413_aa | IS256 family transposase | |
| 1440 | AZKM01000016.1 | GCA000510425_00739 | CDS | open | 64511-66616 | _na 701_aa | Ig-like domain%2C group 2 | |
| 1441 | AZKM01000016.1 | GCA000510425_00740 | CDS | open | 67143-67355 | _na 70_aa | hypothetical protein | |
| 1442 | AZKM01000016.1 | GCA000510425_00741 | CDS | open | 67475-67885 | _na 136_aa | hypothetical protein | |
| 1443 | AZKM01000016.1 | GCA000510425_00742 | CDS | open | 68014-68667 | _na 217_aa | dnaJ | DnaJ domain protein |
| 1444 | AZKM01000016.1 | GCA000510425_00743 | CDS | open | 68657-69535 | _na 292_aa | DUF5685 domain-containing protein | |
| 1445 | AZKM01000016.1 | GCA000510425_00744 | CDS | open | 69762-70847 | _na 361_aa | ABC transporter%2C solute-binding protein | |
| 1446 | AZKM01000016.1 | GCA000510425_00745 | CDS | open | 70828-71628 | _na 266_aa | ABC transporter%2C permease protein | |
| 1447 | AZKM01000016.1 | GCA000510425_00746 | CDS | open | 71625-72437 | _na 270_aa | ABC transporter%2C permease protein | |
| 1448 | AZKM01000016.1 | GCA000510425_00747 | CDS | open | 72430-73500 | _na 356_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 1449 | AZKM01000016.1 | GCA000510425_00748 | CDS | open | 73537-74070 | _na 177_aa | DNA-binding helix-turn-helix protein | |
| 1450 | AZKM01000016.1 | GCA000510425_00749 | CDS | open | 74308-79437 | _na 1709_aa | Putative collagen adhesin | |
| 1451 | AZKM01000016.1 | GCA000510425_00750 | CDS | open | 79655-80521 | _na 288_aa | EamA-like transporter family protein | |
| 1452 | AZKM01000016.1 | GCA000510425_00751 | CDS | open | 80854-81975 | _na 373_aa | hemW | radical SAM family heme chaperone HemW |
| 1453 | AZKM01000016.1 | GCA000510425_00752 | CDS | open | 82035-83843 | _na 602_aa | lepA | translation elongation factor 4 |
| 1454 | AZKM01000016.1 | GCA000510425_00753 | CDS | open | 84197-84469 | _na 90_aa | rpsT | 30S ribosomal protein S20 |
| 1455 | AZKM01000016.1 | GCA000510425_00754 | CDS | open | 84657-85364 | _na 235_aa | deoD | purine-nucleoside phosphorylase |
| 1456 | AZKM01000016.1 | GCA000510425_00755 | CDS | open | 85547-89065 | _na 1172_aa | Fibronectin type III domain protein | |
| 1457 | AZKM01000016.1 | GCA000510425_00756 | CDS | open | 89573-90310 | _na 245_aa | minD | septum site-determining protein MinD |
| 1458 | AZKM01000016.1 | GCA000510425_00757 | CDS | open | 90342-91019 | _na 225_aa | radC | DNA repair protein RadC |
| 1459 | AZKM01000016.1 | GCA000510425_00758 | CDS | open | 91166-91816 | _na 216_aa | cmk | (d)CMP kinase |
| 1460 | AZKM01000016.1 | GCA000510425_00759 | CDS | open | 91840-92298 | _na 152_aa | nrdR | transcriptional regulator NrdR |
| 1461 | AZKM01000016.1 | GCA000510425_00760 | CDS | open | 92675-93808 | _na 377_aa | tig | trigger factor |
| 1462 | AZKM01000016.1 | GCA000510425_00761 | CDS | open | 94164-94361 | _na 65_aa | FeoB-associated Cys-rich membrane protein | |
| 1463 | AZKM01000016.1 | GCA000510425_00762 | CDS | open | 94363-94845 | _na 160_aa | PF14018 domain protein | |
| 1464 | AZKM01000016.1 | GCA000510425_00763 | CDS | open | 94966-95964 | _na 332_aa | GGGtGRT protein | |
| 1465 | AZKM01000016.1 | GCA000510425_00764 | CDS | open | 95975-96670 | _na 231_aa | NifU-like N-terminal domain protein | |
| 1466 | AZKM01000016.1 | GCA000510425_00765 | CDS | open | 96705-97907 | _na 400_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 1467 | AZKM01000016.1 | GCA000510425_00766 | CDS | open | 98131-98490 | _na 119_aa | rplT | 50S ribosomal protein L20 |
| 1468 | AZKM01000016.1 | GCA000510425_00767 | CDS | open | 98508-98708 | _na 66_aa | rpmI | 50S ribosomal protein L35 |
| 1469 | AZKM01000016.1 | GCA000510425_00768 | CDS | open | 98748-99203 | _na 151_aa | infC | translation initiation factor IF-3 |
| 1470 | AZKM01000016.1 | GCA000510425_00769 | CDS | open | 99755-100486 | _na 243_aa | traX | Protein TraX |
| 1471 | AZKM01000016.1 | GCA000510425_00770 | CDS | open | 100977-102485 | _na 502_aa | IMP dehydrogenase | |
| 1472 | AZKM01000016.1 | GCA000510425_00771 | CDS | open | 102555-103901 | _na 448_aa | Class A beta-lactamase | |
| 1473 | AZKM01000016.1 | GCA000510425_00772 | CDS | open | 104631-106013 | _na 460_aa | TrpB-like pyridoxal phosphate-dependent enzyme | |
| 1474 | AZKM01000016.1 | GCA000510425_00773 | CDS | open | 106178-108424 | _na 748_aa | metA | homoserine O-succinyltransferase |
| 1475 | AZKM01000016.1 | GCA000510425_00774 | CDS | open | 108455-109057 | _na 200_aa | Putative lipoprotein | |
| 1476 | AZKM01000016.1 | GCA000510425_00775 | CDS | open | 109057-109908 | _na 283_aa | ABC 3 transport family protein | |
| 1477 | AZKM01000016.1 | GCA000510425_00776 | CDS | open | 109877-110587 | _na 236_aa | ABC transporter%2C ATP-binding protein | |
| 1478 | AZKM01000016.1 | GCA000510425_00777 | CDS | open | 110611-111702 | _na 363_aa | Periplasmic solute-binding family protein | |
| 1479 | AZKM01000016.1 | GCA000510425_00778 | CDS | open | 111746-112150 | _na 134_aa | Ferric uptake regulator family protein | |
| 1480 | AZKM01000016.1 | GCA000510425_00779 | CDS | open | 112377-114518 | _na 713_aa | FMN-binding domain protein | |
| 1481 | AZKM01000016.1 | GCA000510425_00780 | CDS | open | 114914-116128 | _na 404_aa | Metallo-beta-lactamase domain protein | |
| 1482 | AZKM01000016.1 | GCA000510425_00781 | CDS | open | 116128-118059 | _na 643_aa | Rubredoxin | |
| 1483 | AZKM01000016.1 | GCA000510425_00782 | CDS | open | 118325-118978 | _na 217_aa | Cyclic nucleotide-binding domain protein | |
| 1484 | AZKM01000016.1 | GCA000510425_00783 | CDS | open | 119127-120746 | _na 539_aa | Repeat%2C PF09479 | |
| 1485 | AZKM01000016.1 | GCA000510425_00785 | CDS | open | 121577-123526 | _na 649_aa | Fructose-1%2C6-bisphosphatase class 3 | |
| 1486 | AZKM01000016.1 | GCA000510425_00786 | CDS | open | 123567-124835 | _na 422_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 1487 | AZKM01000016.1 | GCA000510425_00787 | CDS | open | 124947-125189 | _na 80_aa | abrB | Putative transition state transcriptional regulatory protein AbrB |
| 1488 | AZKM01000016.1 | GCA000510425_00788 | CDS | open | 125223-125597 | _na 124_aa | PF06103 family protein | |
| 1489 | AZKM01000016.1 | GCA000510425_00789 | CDS | open | 125758-126510 | _na 250_aa | Ribosomal protein L11 methyltransferase-like protein | |
| 1490 | AZKM01000016.1 | GCA000510425_00790 | CDS | open | 126494-127231 | _na 245_aa | PSP1 C-terminal domain protein | |
| 1491 | AZKM01000016.1 | GCA000510425_00791 | CDS | open | 127207-127485 | _na 92_aa | Stage 0 sporulation protein | |
| 1492 | AZKM01000016.1 | GCA000510425_00792 | CDS | open | 127486-128310 | _na 274_aa | DNA polymerase III%2C delta' subunit domain protein | |
| 1493 | AZKM01000016.1 | GCA000510425_00793 | CDS | open | 128307-128939 | _na 210_aa | tmk | dTMP kinase |
| 1494 | AZKM01000016.1 | GCA000510425_00794 | CDS | open | 128971-129072 | _na 33_aa | hypothetical protein | |
| 1495 | AZKM01000016.1 | GCA000510425_00688 | gene | open | 806-4897 | |||
| 1496 | AZKM01000016.1 | GCA000510425_00689 | gene | open | 4954-7749 | |||
| 1497 | AZKM01000016.1 | GCA000510425_00690 | gene | open | 7819-9000 | |||
| 1498 | AZKM01000016.1 | GCA000510425_00691 | gene | open | 9379-10152 | |||
| 1499 | AZKM01000016.1 | GCA000510425_00692 | gene | open | 10194-10973 | |||
| 1500 | AZKM01000016.1 | GCA000510425_00693 | gene | open | 10977-11960 |

