BAKTAGenome Explorer: Hornefia nodatum (GCA_000510425.1)
Select a Genome:
|
BAKTA Annotations for GCA_000510425.1
|
Search & Sort all 3381 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | AZKM01000019.1 | GCA000510425_01030 | CDS | open | 86631-88352 | _na 573_aa | ABC transporter%2C ATP-binding protein | |
| 2002 | AZKM01000019.1 | GCA000510425_01031 | CDS | open | 88336-90147 | _na 603_aa | DNA topoisomerase | |
| 2003 | AZKM01000019.1 | GCA000510425_01032 | CDS | open | 90604-91437 | _na 277_aa | Nucleotidyl transferase%2C PF08843 family | |
| 2004 | AZKM01000019.1 | GCA000510425_01033 | CDS | open | 91430-92023 | _na 197_aa | PF13338 domain protein | |
| 2005 | AZKM01000019.1 | GCA000510425_01034 | CDS | open | 92115-93719 | _na 534_aa | Mobile element protein CD1107-like domain-containing protein | |
| 2006 | AZKM01000019.1 | GCA000510425_01035 | CDS | open | 93694-93984 | _na 96_aa | PF12958 family protein | |
| 2007 | AZKM01000019.1 | GCA000510425_01036 | CDS | open | 93996-96296 | _na 766_aa | NlpC/P60 domain-containing protein | |
| 2008 | AZKM01000019.1 | GCA000510425_01037 | CDS | open | 96259-97284 | _na 341_aa | Methyltransferase | |
| 2009 | AZKM01000019.1 | GCA000510425_01038 | CDS | open | 97287-99764 | _na 825_aa | virB4 | VirB4-like conjugal transfer ATPase%2C CD1110 family |
| 2010 | AZKM01000019.1 | GCA000510425_01039 | CDS | open | 99724-100134 | _na 136_aa | prgI | PrgI family protein |
| 2011 | AZKM01000019.1 | GCA000510425_01040 | CDS | open | 100138-100587 | _na 149_aa | Stress response protein NST1 | |
| 2012 | AZKM01000019.1 | GCA000510425_01041 | CDS | open | 100661-101524 | _na 287_aa | Conjugative transposon membrane protein | |
| 2013 | AZKM01000019.1 | GCA000510425_01042 | CDS | open | 101524-101739 | _na 71_aa | Maff2 family protein | |
| 2014 | AZKM01000019.1 | GCA000510425_01043 | CDS | open | 101743-102087 | _na 114_aa | ssb | Single-strand binding family protein |
| 2015 | AZKM01000019.1 | GCA000510425_01044 | CDS | open | 102196-103161 | _na 321_aa | DNA (cytosine-5-)-methyltransferase | |
| 2016 | AZKM01000019.1 | GCA000510425_01045 | CDS | open | 103484-104737 | _na 417_aa | ltrA | group II intron reverse transcriptase/maturase |
| 2017 | AZKM01000019.1 | GCA000510425_01046 | CDS | open | 105280-105429 | _na 49_aa | Transposase | |
| 2018 | AZKM01000019.1 | GCA000510425_01047 | CDS | open | 105491-107344 | _na 617_aa | VirD4-like conjugal transfer protein%2C CD1115 family | |
| 2019 | AZKM01000019.1 | GCA000510425_01048 | CDS | open | 107354-107560 | _na 68_aa | 30S ribosomal protein S6 | |
| 2020 | AZKM01000019.1 | GCA000510425_01049 | CDS | open | 107532-108125 | _na 197_aa | DNA methyltransferase | |
| 2021 | AZKM01000019.1 | GCA000510425_01050 | CDS | open | 108145-108630 | _na 161_aa | PF12687 domain protein | |
| 2022 | AZKM01000019.1 | GCA000510425_01051 | CDS | open | 108654-109526 | _na 290_aa | IstB-like ATP-binding protein | |
| 2023 | AZKM01000019.1 | GCA000510425_01052 | CDS | open | 109622-110635 | _na 337_aa | Replication initiator protein A%2C N-terminal domain protein | |
| 2024 | AZKM01000019.1 | GCA000510425_01053 | CDS | open | 110734-111603 | _na 289_aa | BRO family%2C N-terminal domain protein | |
| 2025 | AZKM01000019.1 | GCA000510425_01054 | CDS | open | 111702-112670 | _na 322_aa | spo0J | ParB/Sulfiredoxin domain-containing protein |
| 2026 | AZKM01000019.1 | GCA000510425_01055 | CDS | open | 112663-113442 | _na 259_aa | parA | Sporulation initiation inhibitor protein |
| 2027 | AZKM01000019.1 | GCA000510425_01056 | CDS | open | 113587-114102 | _na 171_aa | traG | Conjugal transfer protein TraG |
| 2028 | AZKM01000019.1 | GCA000510425_01057 | CDS | open | 114099-114584 | _na 161_aa | Conjugal transfer protein | |
| 2029 | AZKM01000019.1 | GCA000510425_01058 | CDS | open | 114581-115429 | _na 282_aa | ATP-binding protein | |
| 2030 | AZKM01000019.1 | GCA000510425_01059 | CDS | open | 115429-116208 | _na 259_aa | Replication initiator A N-terminal domain-containing protein | |
| 2031 | AZKM01000019.1 | GCA000510425_01060 | CDS | open | 116296-116580 | _na 94_aa | Phage membrane protein | |
| 2032 | AZKM01000019.1 | GCA000510425_01061 | CDS | open | 116584-116772 | _na 62_aa | hypothetical protein | |
| 2033 | AZKM01000019.1 | GCA000510425_01062 | CDS | open | 116864-117343 | _na 159_aa | Relaxase/mobilization nuclease domain protein | |
| 2034 | AZKM01000019.1 | GCA000510425_01063 | CDS | open | 117343-117723 | _na 126_aa | Bacterial mobilisation domain-containing protein | |
| 2035 | AZKM01000019.1 | GCA000510425_01064 | CDS | open | 118027-118284 | _na 85_aa | hypothetical protein | |
| 2036 | AZKM01000019.1 | GCA000510425_00958 | gene | open | 6573-6983 | tnpV | ||
| 2037 | AZKM01000019.1 | GCA000510425_00959 | gene | open | 7811-8362 | |||
| 2038 | AZKM01000019.1 | GCA000510425_00960 | gene | open | 8366-10075 | topA | ||
| 2039 | AZKM01000019.1 | GCA000510425_00961 | gene | open | 10166-11023 | |||
| 2040 | AZKM01000019.1 | GCA000510425_00962 | gene | open | 11001-11237 | |||
| 2041 | AZKM01000019.1 | GCA000510425_00963 | gene | open | 11255-13588 | nlpC | ||
| 2042 | AZKM01000019.1 | GCA000510425_00964 | gene | open | 13595-15928 | virB4 | ||
| 2043 | AZKM01000019.1 | GCA000510425_00965 | gene | open | 15936-16325 | |||
| 2044 | AZKM01000019.1 | GCA000510425_00966 | gene | open | 16329-16532 | |||
| 2045 | AZKM01000019.1 | GCA000510425_00967 | gene | open | 16608-17471 | |||
| 2046 | AZKM01000019.1 | GCA000510425_00968 | gene | open | 17491-17706 | |||
| 2047 | AZKM01000019.1 | GCA000510425_00969 | gene | open | 17708-18004 | |||
| 2048 | AZKM01000019.1 | GCA000510425_00970 | gene | open | 18192-18629 | |||
| 2049 | AZKM01000019.1 | GCA000510425_00971 | gene | open | 18693-20474 | virD4 | ||
| 2050 | AZKM01000019.1 | GCA000510425_00972 | gene | open | 20464-21195 | |||
| 2051 | AZKM01000019.1 | GCA000510425_00973 | gene | open | 21192-21677 | |||
| 2052 | AZKM01000019.1 | GCA000510425_00974 | gene | open | 21674-22501 | |||
| 2053 | AZKM01000019.1 | GCA000510425_00975 | gene | open | 22521-23285 | |||
| 2054 | AZKM01000019.1 | GCA000510425_00976 | gene | open | 23374-23658 | |||
| 2055 | AZKM01000019.1 | GCA000510425_00977 | gene | open | 24443-24721 | cas2 | ||
| 2056 | AZKM01000019.1 | GCA000510425_00978 | gene | open | 24727-25155 | cas1 | ||
| 2057 | AZKM01000019.1 | GCA000510425_00979 | gene | open | 25328-25726 | |||
| 2058 | AZKM01000019.1 | GCA000510425_00980 | gene | open | 25734-26456 | cas6 | ||
| 2059 | AZKM01000019.1 | GCA000510425_00981 | gene | open | 26806-27759 | |||
| 2060 | AZKM01000019.1 | GCA000510425_00982 | gene | open | 27779-29551 | |||
| 2061 | AZKM01000019.1 | GCA000510425_00983 | gene | open | 29861-31027 | |||
| 2062 | AZKM01000019.1 | GCA000510425_00984 | gene | open | 31039-31167 | |||
| 2063 | AZKM01000019.1 | GCA000510425_00985 | gene | open | 31319-31690 | |||
| 2064 | AZKM01000019.1 | GCA000510425_00986 | gene | open | 31812-32288 | nimB | ||
| 2065 | AZKM01000019.1 | GCA000510425_00987 | gene | open | 32313-32912 | |||
| 2066 | AZKM01000019.1 | GCA000510425_00988 | gene | open | 32969-33463 | |||
| 2067 | AZKM01000019.1 | GCA000510425_00989 | gene | open | 33906-34766 | dinD | ||
| 2068 | AZKM01000019.1 | GCA000510425_00990 | gene | open | 34811-36607 | |||
| 2069 | AZKM01000019.1 | GCA000510425_00991 | gene | open | 36618-37709 | |||
| 2070 | AZKM01000019.1 | GCA000510425_00992 | gene | open | 37709-38878 | |||
| 2071 | AZKM01000019.1 | GCA000510425_00993 | gene | open | 38871-41897 | |||
| 2072 | AZKM01000019.1 | GCA000510425_00994 | gene | open | 41918-42133 | |||
| 2073 | AZKM01000019.1 | GCA000510425_00995 | gene | open | 42232-42534 | |||
| 2074 | AZKM01000019.1 | GCA000510425_00996 | gene | open | 42500-44296 | spoIVCA | ||
| 2075 | AZKM01000019.1 | GCA000510425_00997 | gene | open | 44358-44504 | |||
| 2076 | AZKM01000019.1 | GCA000510425_00998 | gene | open | 44968-45381 | |||
| 2077 | AZKM01000019.1 | GCA000510425_00999 | gene | open | 45610-47352 | mdlB | ||
| 2078 | AZKM01000019.1 | GCA000510425_01000 | gene | open | 47354-49066 | mdlB | ||
| 2079 | AZKM01000019.1 | GCA000510425_01001 | gene | open | 49070-50485 | ccmA | ||
| 2080 | AZKM01000019.1 | GCA000510425_01002 | gene | open | 50499-51188 | ecfT | ||
| 2081 | AZKM01000019.1 | GCA000510425_01003 | gene | open | 51188-51781 | |||
| 2082 | AZKM01000019.1 | GCA000510425_01004 | gene | open | 51902-52513 | acrR | ||
| 2083 | AZKM01000019.1 | GCA000510425_01005 | gene | open | 52822-53172 | mobC | ||
| 2084 | AZKM01000019.1 | GCA000510425_01006 | gene | open | 53178-54509 | |||
| 2085 | AZKM01000019.1 | GCA000510425_01007 | gene | open | 54578-55237 | |||
| 2086 | AZKM01000019.1 | GCA000510425_01008 | gene | open | 55280-64000 | |||
| 2087 | AZKM01000019.1 | GCA000510425_01009 | gene | open | 64083-64886 | |||
| 2088 | AZKM01000019.1 | GCA000510425_01010 | gene | open | 64971-66677 | topA | ||
| 2089 | AZKM01000019.1 | GCA000510425_01011 | gene | open | 66772-68253 | |||
| 2090 | AZKM01000019.1 | GCA000510425_01012 | gene | open | 68228-68467 | |||
| 2091 | AZKM01000019.1 | GCA000510425_01013 | gene | open | 68479-70611 | |||
| 2092 | AZKM01000019.1 | GCA000510425_01014 | gene | open | 70615-73008 | |||
| 2093 | AZKM01000019.1 | GCA000510425_01015 | gene | open | 72956-73345 | prgI | ||
| 2094 | AZKM01000019.1 | GCA000510425_01016 | gene | open | 73349-73612 | |||
| 2095 | AZKM01000019.1 | GCA000510425_01017 | gene | open | 73630-74493 | |||
| 2096 | AZKM01000019.1 | GCA000510425_01018 | gene | open | 74513-74728 | |||
| 2097 | AZKM01000019.1 | GCA000510425_01019 | gene | open | 74732-75043 | |||
| 2098 | AZKM01000019.1 | GCA000510425_01020 | gene | open | 75040-75159 | |||
| 2099 | AZKM01000019.1 | GCA000510425_01021 | gene | open | 75206-76474 | |||
| 2100 | AZKM01000019.1 | GCA000510425_01022 | gene | open | 76575-77723 | |||
| 2101 | AZKM01000019.1 | GCA000510425_01023 | gene | open | 78060-79574 | |||
| 2102 | AZKM01000019.1 | GCA000510425_01024 | gene | open | 79567-81270 | |||
| 2103 | AZKM01000019.1 | GCA000510425_01025 | gene | open | 81263-82936 | |||
| 2104 | AZKM01000019.1 | GCA000510425_01026 | gene | open | 83098-83286 | tnpW | ||
| 2105 | AZKM01000019.1 | GCA000510425_01027 | gene | open | 83784-84185 | |||
| 2106 | AZKM01000019.1 | GCA000510425_01028 | gene | open | 84826-85068 | tetR | ||
| 2107 | AZKM01000019.1 | GCA000510425_01029 | gene | open | 85276-86619 | mepA | ||
| 2108 | AZKM01000019.1 | GCA000510425_01030 | gene | open | 86631-88352 | |||
| 2109 | AZKM01000019.1 | GCA000510425_01031 | gene | open | 88336-90147 | |||
| 2110 | AZKM01000019.1 | GCA000510425_01032 | gene | open | 90604-91437 | |||
| 2111 | AZKM01000019.1 | GCA000510425_01033 | gene | open | 91430-92023 | |||
| 2112 | AZKM01000019.1 | GCA000510425_01034 | gene | open | 92115-93719 | |||
| 2113 | AZKM01000019.1 | GCA000510425_01035 | gene | open | 93694-93984 | |||
| 2114 | AZKM01000019.1 | GCA000510425_01036 | gene | open | 93996-96296 | |||
| 2115 | AZKM01000019.1 | GCA000510425_01037 | gene | open | 96259-97284 | |||
| 2116 | AZKM01000019.1 | GCA000510425_01038 | gene | open | 97287-99764 | virB4 | ||
| 2117 | AZKM01000019.1 | GCA000510425_01039 | gene | open | 99724-100134 | prgI | ||
| 2118 | AZKM01000019.1 | GCA000510425_01040 | gene | open | 100138-100587 | |||
| 2119 | AZKM01000019.1 | GCA000510425_01041 | gene | open | 100661-101524 | |||
| 2120 | AZKM01000019.1 | GCA000510425_01042 | gene | open | 101524-101739 | |||
| 2121 | AZKM01000019.1 | GCA000510425_01043 | gene | open | 101743-102087 | ssb | ||
| 2122 | AZKM01000019.1 | GCA000510425_01044 | gene | open | 102196-103161 | |||
| 2123 | AZKM01000019.1 | GCA000510425_01045 | gene | open | 103484-104737 | ltrA | ||
| 2124 | AZKM01000019.1 | GCA000510425_01046 | gene | open | 105280-105429 | |||
| 2125 | AZKM01000019.1 | GCA000510425_01047 | gene | open | 105491-107344 | |||
| 2126 | AZKM01000019.1 | GCA000510425_01048 | gene | open | 107354-107560 | |||
| 2127 | AZKM01000019.1 | GCA000510425_01049 | gene | open | 107532-108125 | |||
| 2128 | AZKM01000019.1 | GCA000510425_01050 | gene | open | 108145-108630 | |||
| 2129 | AZKM01000019.1 | GCA000510425_01051 | gene | open | 108654-109526 | |||
| 2130 | AZKM01000019.1 | GCA000510425_01052 | gene | open | 109622-110635 | |||
| 2131 | AZKM01000019.1 | GCA000510425_01053 | gene | open | 110734-111603 | |||
| 2132 | AZKM01000019.1 | GCA000510425_01054 | gene | open | 111702-112670 | spo0J | ||
| 2133 | AZKM01000019.1 | GCA000510425_01055 | gene | open | 112663-113442 | parA | ||
| 2134 | AZKM01000019.1 | GCA000510425_01056 | gene | open | 113587-114102 | traG | ||
| 2135 | AZKM01000019.1 | GCA000510425_01057 | gene | open | 114099-114584 | |||
| 2136 | AZKM01000019.1 | GCA000510425_01058 | gene | open | 114581-115429 | |||
| 2137 | AZKM01000019.1 | GCA000510425_01059 | gene | open | 115429-116208 | |||
| 2138 | AZKM01000019.1 | GCA000510425_01060 | gene | open | 116296-116580 | |||
| 2139 | AZKM01000019.1 | GCA000510425_01061 | gene | open | 116584-116772 | |||
| 2140 | AZKM01000019.1 | GCA000510425_01062 | gene | open | 116864-117343 | |||
| 2141 | AZKM01000019.1 | GCA000510425_01063 | gene | open | 117343-117723 | |||
| 2142 | AZKM01000019.1 | GCA000510425_01064 | gene | open | 118027-118284 | |||
| 2143 | AZKM01000020.1 | regulatory_region | open | 18686-18776 | pan motif | |||
| 2144 | AZKM01000020.1 | repeat_region | open | 61765-63404 | CRISPR array with 25 repeats of length 30%2C consensus sequence ATTTACATTTCATTATGCTTCTATTAAAAC and spacer length 36 | |||
| 2145 | AZKM01000020.1 | GCA000510425_01065 | CDS | open | 220-501 | _na 93_aa | ISSag9%2C transposase | |
| 2146 | AZKM01000020.1 | GCA000510425_01066 | CDS | open | 913-1155 | _na 80_aa | S4 domain protein | |
| 2147 | AZKM01000020.1 | GCA000510425_01067 | CDS | open | 1338-1616 | _na 92_aa | hupA | DNA-binding protein HU |
| 2148 | AZKM01000020.1 | GCA000510425_01068 | CDS | open | 1790-3433 | _na 547_aa | Polysaccharide biosynthesis protein | |
| 2149 | AZKM01000020.1 | GCA000510425_01069 | CDS | open | 3463-4758 | _na 431_aa | Amidohydrolase family protein | |
| 2150 | AZKM01000020.1 | GCA000510425_01070 | CDS | open | 4748-8068 | _na 1106_aa | mfd | transcription-repair coupling factor |
| 2151 | AZKM01000020.1 | GCA000510425_01071 | CDS | open | 8074-8172 | _na 32_aa | hypothetical protein | |
| 2152 | AZKM01000020.1 | GCA000510425_01072 | CDS | open | 8165-8758 | _na 197_aa | pth | aminoacyl-tRNA hydrolase |
| 2153 | AZKM01000020.1 | GCA000510425_01073 | CDS | open | 8799-9749 | _na 316_aa | Ribose-phosphate pyrophosphokinase | |
| 2154 | AZKM01000020.1 | GCA000510425_01074 | CDS | open | 9779-10474 | _na 231_aa | Transferase hexapeptide repeat protein | |
| 2155 | AZKM01000020.1 | GCA000510425_01075 | CDS | open | 10475-11854 | _na 459_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 2156 | AZKM01000020.1 | GCA000510425_01076 | CDS | open | 11946-12506 | _na 186_aa | 3H domain protein | |
| 2157 | AZKM01000020.1 | GCA000510425_01077 | CDS | open | 12689-12964 | _na 91_aa | spoVG | septation regulator SpoVG |
| 2158 | AZKM01000020.1 | GCA000510425_01078 | CDS | open | 13117-13923 | _na 268_aa | purR | pur operon repressor |
| 2159 | AZKM01000020.1 | GCA000510425_01079 | CDS | open | 13961-15394 | _na 477_aa | pyk | pyruvate kinase |
| 2160 | AZKM01000020.1 | GCA000510425_01080 | CDS | open | 15376-15909 | _na 177_aa | Aminoacyl-tRNA editing domain protein | |
| 2161 | AZKM01000020.1 | GCA000510425_01081 | CDS | open | 16080-16286 | _na 68_aa | 2Fe-2S iron-sulfur cluster-binding domain protein | |
| 2162 | AZKM01000020.1 | GCA000510425_01082 | CDS | open | 16817-17620 | _na 267_aa | Glycoside-hydrolase family GH114 | |
| 2163 | AZKM01000020.1 | GCA000510425_01083 | CDS | open | 17863-18543 | _na 226_aa | TIGR00266 family protein | |
| 2164 | AZKM01000020.1 | GCA000510425_01084 | CDS | open | 18862-19275 | _na 137_aa | panD | aspartate 1-decarboxylase |
| 2165 | AZKM01000020.1 | GCA000510425_01085 | CDS | open | 19373-20212 | _na 279_aa | panC | pantoate--beta-alanine ligase |
| 2166 | AZKM01000020.1 | GCA000510425_01086 | CDS | open | 20293-20985 | _na 230_aa | deoC | deoxyribose-phosphate aldolase |
| 2167 | AZKM01000020.1 | GCA000510425_01087 | CDS | open | 21162-22406 | _na 414_aa | PF05684 family protein | |
| 2168 | AZKM01000020.1 | GCA000510425_01088 | CDS | open | 22480-23187 | _na 235_aa | D-alanyl-D-alanine dipeptidase | |
| 2169 | AZKM01000020.1 | GCA000510425_01089 | CDS | open | 23300-24601 | _na 433_aa | pyrimidine-nucleoside phosphorylase | |
| 2170 | AZKM01000020.1 | GCA000510425_01090 | CDS | open | 24598-25776 | _na 392_aa | phosphopentomutase | |
| 2171 | AZKM01000020.1 | GCA000510425_01091 | CDS | open | 25812-26513 | _na 233_aa | Calcineurin-like phosphoesterase family protein | |
| 2172 | AZKM01000020.1 | GCA000510425_01092 | CDS | open | 26528-27676 | _na 382_aa | rmuC | RmuC domain protein |
| 2173 | AZKM01000020.1 | GCA000510425_01093 | CDS | open | 27724-28998 | _na 424_aa | O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase | |
| 2174 | AZKM01000020.1 | GCA000510425_01094 | CDS | open | 29161-30234 | _na 357_aa | YibE/F-like protein | |
| 2175 | AZKM01000020.1 | GCA000510425_01095 | CDS | open | 30276-31037 | _na 253_aa | YibE/F-like protein | |
| 2176 | AZKM01000020.1 | GCA000510425_01096 | CDS | open | 31125-31538 | _na 137_aa | hypothetical protein | |
| 2177 | AZKM01000020.1 | GCA000510425_01097 | CDS | open | 31875-32318 | _na 147_aa | Lipoprotein | |
| 2178 | AZKM01000020.1 | GCA000510425_01098 | CDS | open | 32336-32959 | _na 207_aa | ABC transporter%2C ATP-binding protein | |
| 2179 | AZKM01000020.1 | GCA000510425_01099 | CDS | open | 33029-33733 | _na 234_aa | ABC-2 family transporter protein | |
| 2180 | AZKM01000020.1 | GCA000510425_01100 | CDS | open | 33723-34466 | _na 247_aa | Putative membrane protein | |
| 2181 | AZKM01000020.1 | GCA000510425_01101 | CDS | open | 34453-35223 | _na 256_aa | ABC-2 family transporter protein | |
| 2182 | AZKM01000020.1 | GCA000510425_01102 | CDS | open | 35293-35664 | _na 123_aa | DUF2712 domain-containing protein | |
| 2183 | AZKM01000020.1 | GCA000510425_01103 | CDS | open | 35847-36674 | _na 275_aa | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| 2184 | AZKM01000020.1 | GCA000510425_01104 | CDS | open | 36708-37658 | _na 316_aa | PF10728 domain protein | |
| 2185 | AZKM01000020.1 | GCA000510425_01105 | CDS | open | 37874-39070 | _na 398_aa | Alanine-glyoxylate amino-transferase | |
| 2186 | AZKM01000020.1 | GCA000510425_01106 | CDS | open | 39219-39656 | _na 145_aa | aroQ | type II 3-dehydroquinate dehydratase |
| 2187 | AZKM01000020.1 | GCA000510425_01107 | CDS | open | 39767-41017 | _na 416_aa | Multifunctional fusion protein | |
| 2188 | AZKM01000020.1 | GCA000510425_01108 | CDS | open | 41083-41349 | _na 88_aa | Putative chorismate mutase | |
| 2189 | AZKM01000020.1 | GCA000510425_01109 | CDS | open | 41366-42520 | _na 384_aa | Bifunctional chorismate mutase/prephenate dehydratase | |
| 2190 | AZKM01000020.1 | GCA000510425_01110 | CDS | open | 42538-43095 | _na 185_aa | Chromate transport protein | |
| 2191 | AZKM01000020.1 | GCA000510425_01111 | CDS | open | 43096-43644 | _na 182_aa | Chromate transport protein | |
| 2192 | AZKM01000020.1 | GCA000510425_01112 | CDS | open | 43762-44439 | _na 225_aa | DNA alkylation repair enzyme | |
| 2193 | AZKM01000020.1 | GCA000510425_01113 | CDS | open | 44440-45444 | _na 334_aa | aroC | chorismate synthase |
| 2194 | AZKM01000020.1 | GCA000510425_01114 | CDS | open | 45554-46753 | _na 399_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 2195 | AZKM01000020.1 | GCA000510425_01115 | CDS | open | 46757-47620 | _na 287_aa | Prephenate dehydrogenase | |
| 2196 | AZKM01000020.1 | GCA000510425_01116 | CDS | open | 47617-48618 | _na 333_aa | bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase | |
| 2197 | AZKM01000020.1 | GCA000510425_01117 | CDS | open | 48708-48800 | _na 30_aa | hypothetical protein | |
| 2198 | AZKM01000020.1 | GCA000510425_01118 | CDS | open | 49019-50761 | _na 580_aa | AMP-binding enzyme | |
| 2199 | AZKM01000020.1 | GCA000510425_01119 | CDS | open | 50957-51835 | _na 292_aa | UPF0251 protein HMPREF0378_0246 | |
| 2200 | AZKM01000020.1 | GCA000510425_01120 | CDS | open | 51961-52890 | _na 309_aa | cysK | cysteine synthase A |
| 2201 | AZKM01000020.1 | GCA000510425_01121 | CDS | open | 53235-54599 | _na 454_aa | Radical SAM domain protein | |
| 2202 | AZKM01000020.1 | GCA000510425_01122 | CDS | open | 54842-55735 | _na 297_aa | hypothetical protein | |
| 2203 | AZKM01000020.1 | GCA000510425_01123 | CDS | open | 55739-56896 | _na 385_aa | CRISPR-associated protein Csm4 | |
| 2204 | AZKM01000020.1 | GCA000510425_01124 | CDS | open | 56908-57609 | _na 233_aa | CRISPR-associated RAMP protein | |
| 2205 | AZKM01000020.1 | GCA000510425_01125 | CDS | open | 57674-59692 | _na 672_aa | Cas10/Cmr2 second palm domain-containing protein | |
| 2206 | AZKM01000020.1 | GCA000510425_01126 | CDS | open | 59696-60640 | _na 314_aa | DUF6602 domain-containing protein | |
| 2207 | AZKM01000020.1 | GCA000510425_01127 | CDS | open | 60710-61084 | _na 124_aa | hypothetical protein | |
| 2208 | AZKM01000020.1 | GCA000510425_01128 | CDS | open | 61088-61465 | _na 125_aa | AAA domain protein | |
| 2209 | AZKM01000020.1 | GCA000510425_01065 | gene | open | 220-501 | |||
| 2210 | AZKM01000020.1 | GCA000510425_01066 | gene | open | 913-1155 | |||
| 2211 | AZKM01000020.1 | GCA000510425_01067 | gene | open | 1338-1616 | hupA | ||
| 2212 | AZKM01000020.1 | GCA000510425_01068 | gene | open | 1790-3433 | |||
| 2213 | AZKM01000020.1 | GCA000510425_01069 | gene | open | 3463-4758 | |||
| 2214 | AZKM01000020.1 | GCA000510425_01070 | gene | open | 4748-8068 | mfd | ||
| 2215 | AZKM01000020.1 | GCA000510425_01071 | gene | open | 8074-8172 | |||
| 2216 | AZKM01000020.1 | GCA000510425_01072 | gene | open | 8165-8758 | pth | ||
| 2217 | AZKM01000020.1 | GCA000510425_01073 | gene | open | 8799-9749 | |||
| 2218 | AZKM01000020.1 | GCA000510425_01074 | gene | open | 9779-10474 | |||
| 2219 | AZKM01000020.1 | GCA000510425_01075 | gene | open | 10475-11854 | murC | ||
| 2220 | AZKM01000020.1 | GCA000510425_01076 | gene | open | 11946-12506 | |||
| 2221 | AZKM01000020.1 | GCA000510425_01077 | gene | open | 12689-12964 | spoVG | ||
| 2222 | AZKM01000020.1 | GCA000510425_01078 | gene | open | 13117-13923 | purR | ||
| 2223 | AZKM01000020.1 | GCA000510425_01079 | gene | open | 13961-15394 | pyk | ||
| 2224 | AZKM01000020.1 | GCA000510425_01080 | gene | open | 15376-15909 | |||
| 2225 | AZKM01000020.1 | GCA000510425_01081 | gene | open | 16080-16286 | |||
| 2226 | AZKM01000020.1 | GCA000510425_01082 | gene | open | 16817-17620 | |||
| 2227 | AZKM01000020.1 | GCA000510425_01083 | gene | open | 17863-18543 | |||
| 2228 | AZKM01000020.1 | GCA000510425_01084 | gene | open | 18862-19275 | panD | ||
| 2229 | AZKM01000020.1 | GCA000510425_01085 | gene | open | 19373-20212 | panC | ||
| 2230 | AZKM01000020.1 | GCA000510425_01086 | gene | open | 20293-20985 | deoC | ||
| 2231 | AZKM01000020.1 | GCA000510425_01087 | gene | open | 21162-22406 | |||
| 2232 | AZKM01000020.1 | GCA000510425_01088 | gene | open | 22480-23187 | |||
| 2233 | AZKM01000020.1 | GCA000510425_01089 | gene | open | 23300-24601 | |||
| 2234 | AZKM01000020.1 | GCA000510425_01090 | gene | open | 24598-25776 | |||
| 2235 | AZKM01000020.1 | GCA000510425_01091 | gene | open | 25812-26513 | |||
| 2236 | AZKM01000020.1 | GCA000510425_01092 | gene | open | 26528-27676 | rmuC | ||
| 2237 | AZKM01000020.1 | GCA000510425_01093 | gene | open | 27724-28998 | |||
| 2238 | AZKM01000020.1 | GCA000510425_01094 | gene | open | 29161-30234 | |||
| 2239 | AZKM01000020.1 | GCA000510425_01095 | gene | open | 30276-31037 | |||
| 2240 | AZKM01000020.1 | GCA000510425_01096 | gene | open | 31125-31538 | |||
| 2241 | AZKM01000020.1 | GCA000510425_01097 | gene | open | 31875-32318 | |||
| 2242 | AZKM01000020.1 | GCA000510425_01098 | gene | open | 32336-32959 | |||
| 2243 | AZKM01000020.1 | GCA000510425_01099 | gene | open | 33029-33733 | |||
| 2244 | AZKM01000020.1 | GCA000510425_01100 | gene | open | 33723-34466 | |||
| 2245 | AZKM01000020.1 | GCA000510425_01101 | gene | open | 34453-35223 | |||
| 2246 | AZKM01000020.1 | GCA000510425_01102 | gene | open | 35293-35664 | |||
| 2247 | AZKM01000020.1 | GCA000510425_01103 | gene | open | 35847-36674 | panB | ||
| 2248 | AZKM01000020.1 | GCA000510425_01104 | gene | open | 36708-37658 | |||
| 2249 | AZKM01000020.1 | GCA000510425_01105 | gene | open | 37874-39070 | |||
| 2250 | AZKM01000020.1 | GCA000510425_01106 | gene | open | 39219-39656 | aroQ | ||
| 2251 | AZKM01000020.1 | GCA000510425_01107 | gene | open | 39767-41017 | |||
| 2252 | AZKM01000020.1 | GCA000510425_01108 | gene | open | 41083-41349 | |||
| 2253 | AZKM01000020.1 | GCA000510425_01109 | gene | open | 41366-42520 | |||
| 2254 | AZKM01000020.1 | GCA000510425_01110 | gene | open | 42538-43095 | |||
| 2255 | AZKM01000020.1 | GCA000510425_01111 | gene | open | 43096-43644 | |||
| 2256 | AZKM01000020.1 | GCA000510425_01112 | gene | open | 43762-44439 | |||
| 2257 | AZKM01000020.1 | GCA000510425_01113 | gene | open | 44440-45444 | aroC | ||
| 2258 | AZKM01000020.1 | GCA000510425_01114 | gene | open | 45554-46753 | aroA | ||
| 2259 | AZKM01000020.1 | GCA000510425_01115 | gene | open | 46757-47620 | |||
| 2260 | AZKM01000020.1 | GCA000510425_01116 | gene | open | 47617-48618 | |||
| 2261 | AZKM01000020.1 | GCA000510425_01117 | gene | open | 48708-48800 | |||
| 2262 | AZKM01000020.1 | GCA000510425_01118 | gene | open | 49019-50761 | |||
| 2263 | AZKM01000020.1 | GCA000510425_01119 | gene | open | 50957-51835 | |||
| 2264 | AZKM01000020.1 | GCA000510425_01120 | gene | open | 51961-52890 | cysK | ||
| 2265 | AZKM01000020.1 | GCA000510425_01121 | gene | open | 53235-54599 | |||
| 2266 | AZKM01000020.1 | GCA000510425_01122 | gene | open | 54842-55735 | |||
| 2267 | AZKM01000020.1 | GCA000510425_01123 | gene | open | 55739-56896 | |||
| 2268 | AZKM01000020.1 | GCA000510425_01124 | gene | open | 56908-57609 | |||
| 2269 | AZKM01000020.1 | GCA000510425_01125 | gene | open | 57674-59692 | |||
| 2270 | AZKM01000020.1 | GCA000510425_01126 | gene | open | 59696-60640 | |||
| 2271 | AZKM01000020.1 | GCA000510425_01127 | gene | open | 60710-61084 | |||
| 2272 | AZKM01000020.1 | GCA000510425_01128 | gene | open | 61088-61465 | |||
| 2273 | AZKM01000021.1 | GCA000510425_01129 | CDS | open | 270-1553 | _na 427_aa | FMN-binding domain protein | |
| 2274 | AZKM01000021.1 | GCA000510425_01131 | CDS | open | 2040-3380 | _na 446_aa | hypothetical protein | |
| 2275 | AZKM01000021.1 | GCA000510425_01129 | gene | open | 270-1553 | |||
| 2276 | AZKM01000021.1 | GCA000510425_01131 | gene | open | 2040-3380 | |||
| 2277 | AZKM01000021.1 | GCA000510425_01130 | gene | open | 1745-1827 | trnL | ||
| 2278 | AZKM01000021.1 | GCA000510425_01130 | tRNA | open | 1745-1827 | trnL | tRNA-Leu(tag) | |
| 2279 | AZKM01000022.1 | GCA000510425_01132 | CDS | open | 162-401 | _na 79_aa | hypothetical protein | |
| 2280 | AZKM01000022.1 | GCA000510425_01133 | CDS | open | 398-1393 | _na 331_aa | Cytosine-specific methyltransferase | |
| 2281 | AZKM01000022.1 | GCA000510425_01134 | CDS | open | 1374-2456 | _na 360_aa | Cytosine-specific methyltransferase | |
| 2282 | AZKM01000022.1 | GCA000510425_01135 | CDS | open | 2495-3349 | _na 284_aa | hypothetical protein | |
| 2283 | AZKM01000022.1 | GCA000510425_01136 | CDS | open | 3352-3561 | _na 69_aa | HTH cro/C1-type domain-containing protein | |
| 2284 | AZKM01000022.1 | GCA000510425_01137 | CDS | open | 3946-4794 | _na 282_aa | NYN domain protein | |
| 2285 | AZKM01000022.1 | GCA000510425_01138 | CDS | open | 4778-5410 | _na 210_aa | Peptidase C39-like family protein | |
| 2286 | AZKM01000022.1 | GCA000510425_01139 | CDS | open | 5537-6517 | _na 326_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 2287 | AZKM01000022.1 | GCA000510425_01140 | CDS | open | 6836-7273 | _na 145_aa | hypothetical protein | |
| 2288 | AZKM01000022.1 | GCA000510425_01141 | CDS | open | 7529-7708 | _na 59_aa | Spo0E like sporulation regulatory protein | |
| 2289 | AZKM01000022.1 | GCA000510425_01142 | CDS | open | 7972-8514 | _na 180_aa | Large polyvalent protein associated domain-containing protein | |
| 2290 | AZKM01000022.1 | GCA000510425_01143 | CDS | open | 8659-9483 | _na 274_aa | VirC1-like protein | |
| 2291 | AZKM01000022.1 | GCA000510425_01144 | CDS | open | 9437-10387 | _na 316_aa | ParB-like protein | |
| 2292 | AZKM01000022.1 | GCA000510425_01145 | CDS | open | 10579-12888 | _na 769_aa | LPXTG cell wall anchor domain protein | |
| 2293 | AZKM01000022.1 | GCA000510425_01146 | CDS | open | 13061-13150 | _na 29_aa | hypothetical protein | |
| 2294 | AZKM01000022.1 | GCA000510425_01147 | CDS | open | 13185-13403 | _na 72_aa | Phage protein | |
| 2295 | AZKM01000022.1 | GCA000510425_01148 | CDS | open | 13417-15036 | _na 539_aa | DNA methylase | |
| 2296 | AZKM01000022.1 | GCA000510425_01149 | CDS | open | 15089-19381 | _na 1430_aa | Methyltransferase domain protein | |
| 2297 | AZKM01000022.1 | GCA000510425_01150 | CDS | open | 20088-21893 | _na 601_aa | ltrA | group II intron reverse transcriptase/maturase |
| 2298 | AZKM01000022.1 | GCA000510425_01151 | CDS | open | 22057-24135 | _na 692_aa | Helicase C-terminal domain protein | |
| 2299 | AZKM01000022.1 | GCA000510425_01152 | CDS | open | 24422-25834 | _na 470_aa | DNA-binding helix-turn-helix protein | |
| 2300 | AZKM01000022.1 | GCA000510425_01153 | CDS | open | 26387-27706 | _na 439_aa | AAA domain protein | |
| 2301 | AZKM01000022.1 | GCA000510425_01154 | CDS | open | 27709-28368 | _na 219_aa | RloB-like protein | |
| 2302 | AZKM01000022.1 | GCA000510425_01155 | CDS | open | 28373-29809 | _na 478_aa | thsA | NAD(+) hydrolase ThsA |
| 2303 | AZKM01000022.1 | GCA000510425_01156 | CDS | open | 29813-30424 | _na 203_aa | TIR-like PF08937 domain protein | |
| 2304 | AZKM01000022.1 | GCA000510425_01157 | CDS | open | 30531-30866 | _na 111_aa | PF12959 family protein | |
| 2305 | AZKM01000022.1 | GCA000510425_01158 | CDS | open | 30875-31843 | _na 322_aa | PF13154 family protein | |
| 2306 | AZKM01000022.1 | GCA000510425_01159 | CDS | open | 31913-32191 | _na 92_aa | hypothetical protein | |
| 2307 | AZKM01000022.1 | GCA000510425_01160 | CDS | open | 32303-32647 | _na 114_aa | copG | Ribbon-helix-helix protein%2C CopG family |
| 2308 | AZKM01000022.1 | GCA000510425_01161 | CDS | open | 32634-33542 | _na 302_aa | Relaxase/mobilization nuclease domain protein | |
| 2309 | AZKM01000022.1 | GCA000510425_01162 | CDS | open | 33655-34014 | _na 119_aa | PF12958 family protein | |
| 2310 | AZKM01000022.1 | GCA000510425_01163 | CDS | open | 33977-34594 | _na 205_aa | PF12687 family protein | |
| 2311 | AZKM01000022.1 | GCA000510425_01164 | CDS | open | 34764-35642 | _na 292_aa | LtrC-like protein | |
| 2312 | AZKM01000022.1 | GCA000510425_01165 | CDS | open | 35660-35857 | _na 65_aa | hypothetical protein | |
| 2313 | AZKM01000022.1 | GCA000510425_01166 | CDS | open | 35844-37637 | _na 597_aa | VirD4-like conjugal transfer protein%2C CD1115 family | |
| 2314 | AZKM01000022.1 | GCA000510425_01167 | CDS | open | 37667-38020 | _na 117_aa | Glutamyl-tRNA amidotransferase | |
| 2315 | AZKM01000022.1 | GCA000510425_01168 | CDS | open | 38084-38920 | _na 278_aa | TrbL/VirB6 plasmid conjugal transfer protein | |
| 2316 | AZKM01000022.1 | GCA000510425_01169 | CDS | open | 39118-39813 | _na 231_aa | PF13338 domain protein | |
| 2317 | AZKM01000022.1 | GCA000510425_01170 | CDS | open | 39800-40738 | _na 312_aa | Nucleotidyl transferase%2C PF08843 family | |
| 2318 | AZKM01000022.1 | GCA000510425_01171 | CDS | open | 40856-41242 | _na 128_aa | prgI | PrgI family protein |
| 2319 | AZKM01000022.1 | GCA000510425_01172 | CDS | open | 41214-43547 | _na 777_aa | VirB4-like conjugal transfer ATPase%2C CD1110 family | |
| 2320 | AZKM01000022.1 | GCA000510425_01173 | CDS | open | 43560-45131 | _na 523_aa | CHAP domain protein | |
| 2321 | AZKM01000022.1 | GCA000510425_01174 | CDS | open | 45696-45920 | _na 74_aa | Cro/C1-type HTH DNA-binding domain protein | |
| 2322 | AZKM01000022.1 | GCA000510425_01175 | CDS | open | 45907-46281 | _na 124_aa | Phospholipid methyltransferase | |
| 2323 | AZKM01000022.1 | GCA000510425_01176 | CDS | open | 46418-47203 | _na 261_aa | Alpha/beta hydrolase family protein | |
| 2324 | AZKM01000022.1 | GCA000510425_01177 | CDS | open | 47385-48254 | _na 289_aa | Leucine carboxyl methyltransferase | |
| 2325 | AZKM01000022.1 | GCA000510425_01178 | CDS | open | 48236-49162 | _na 308_aa | Hydrolase%2C alpha/beta domain protein | |
| 2326 | AZKM01000022.1 | GCA000510425_01179 | CDS | open | 49155-49664 | _na 169_aa | DUF3899 domain-containing protein | |
| 2327 | AZKM01000022.1 | GCA000510425_01180 | CDS | open | 49763-50269 | _na 168_aa | Integral membrane protein | |
| 2328 | AZKM01000022.1 | GCA000510425_01181 | CDS | open | 50290-51000 | _na 236_aa | Transglutaminase-like protein | |
| 2329 | AZKM01000022.1 | GCA000510425_01182 | CDS | open | 51736-52995 | _na 419_aa | ltrA | group II intron reverse transcriptase/maturase |
| 2330 | AZKM01000022.1 | GCA000510425_01183 | CDS | open | 53077-53682 | _na 201_aa | tetR | Transcriptional regulator%2C TetR family |
| 2331 | AZKM01000022.1 | GCA000510425_01184 | CDS | open | 53730-55646 | _na 638_aa | ABC transporter%2C ATP-binding protein | |
| 2332 | AZKM01000022.1 | GCA000510425_01185 | CDS | open | 55650-57386 | _na 578_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 2333 | AZKM01000022.1 | GCA000510425_01186 | CDS | open | 57843-58163 | _na 106_aa | Resolvase%2C N-terminal domain protein | |
| 2334 | AZKM01000022.1 | GCA000510425_01132 | gene | open | 162-401 | |||
| 2335 | AZKM01000022.1 | GCA000510425_01133 | gene | open | 398-1393 | |||
| 2336 | AZKM01000022.1 | GCA000510425_01134 | gene | open | 1374-2456 | |||
| 2337 | AZKM01000022.1 | GCA000510425_01135 | gene | open | 2495-3349 | |||
| 2338 | AZKM01000022.1 | GCA000510425_01136 | gene | open | 3352-3561 | |||
| 2339 | AZKM01000022.1 | GCA000510425_01137 | gene | open | 3946-4794 | |||
| 2340 | AZKM01000022.1 | GCA000510425_01138 | gene | open | 4778-5410 | |||
| 2341 | AZKM01000022.1 | GCA000510425_01139 | gene | open | 5537-6517 | guaA | ||
| 2342 | AZKM01000022.1 | GCA000510425_01140 | gene | open | 6836-7273 | |||
| 2343 | AZKM01000022.1 | GCA000510425_01141 | gene | open | 7529-7708 | |||
| 2344 | AZKM01000022.1 | GCA000510425_01142 | gene | open | 7972-8514 | |||
| 2345 | AZKM01000022.1 | GCA000510425_01143 | gene | open | 8659-9483 | |||
| 2346 | AZKM01000022.1 | GCA000510425_01144 | gene | open | 9437-10387 | |||
| 2347 | AZKM01000022.1 | GCA000510425_01145 | gene | open | 10579-12888 | |||
| 2348 | AZKM01000022.1 | GCA000510425_01146 | gene | open | 13061-13150 | |||
| 2349 | AZKM01000022.1 | GCA000510425_01147 | gene | open | 13185-13403 | |||
| 2350 | AZKM01000022.1 | GCA000510425_01148 | gene | open | 13417-15036 | |||
| 2351 | AZKM01000022.1 | GCA000510425_01149 | gene | open | 15089-19381 | |||
| 2352 | AZKM01000022.1 | GCA000510425_01150 | gene | open | 20088-21893 | ltrA | ||
| 2353 | AZKM01000022.1 | GCA000510425_01151 | gene | open | 22057-24135 | |||
| 2354 | AZKM01000022.1 | GCA000510425_01152 | gene | open | 24422-25834 | |||
| 2355 | AZKM01000022.1 | GCA000510425_01153 | gene | open | 26387-27706 | |||
| 2356 | AZKM01000022.1 | GCA000510425_01154 | gene | open | 27709-28368 | |||
| 2357 | AZKM01000022.1 | GCA000510425_01155 | gene | open | 28373-29809 | thsA | ||
| 2358 | AZKM01000022.1 | GCA000510425_01156 | gene | open | 29813-30424 | |||
| 2359 | AZKM01000022.1 | GCA000510425_01157 | gene | open | 30531-30866 | |||
| 2360 | AZKM01000022.1 | GCA000510425_01158 | gene | open | 30875-31843 | |||
| 2361 | AZKM01000022.1 | GCA000510425_01159 | gene | open | 31913-32191 | |||
| 2362 | AZKM01000022.1 | GCA000510425_01160 | gene | open | 32303-32647 | copG | ||
| 2363 | AZKM01000022.1 | GCA000510425_01161 | gene | open | 32634-33542 | |||
| 2364 | AZKM01000022.1 | GCA000510425_01162 | gene | open | 33655-34014 | |||
| 2365 | AZKM01000022.1 | GCA000510425_01163 | gene | open | 33977-34594 | |||
| 2366 | AZKM01000022.1 | GCA000510425_01164 | gene | open | 34764-35642 | |||
| 2367 | AZKM01000022.1 | GCA000510425_01165 | gene | open | 35660-35857 | |||
| 2368 | AZKM01000022.1 | GCA000510425_01166 | gene | open | 35844-37637 | |||
| 2369 | AZKM01000022.1 | GCA000510425_01167 | gene | open | 37667-38020 | |||
| 2370 | AZKM01000022.1 | GCA000510425_01168 | gene | open | 38084-38920 | |||
| 2371 | AZKM01000022.1 | GCA000510425_01169 | gene | open | 39118-39813 | |||
| 2372 | AZKM01000022.1 | GCA000510425_01170 | gene | open | 39800-40738 | |||
| 2373 | AZKM01000022.1 | GCA000510425_01171 | gene | open | 40856-41242 | prgI | ||
| 2374 | AZKM01000022.1 | GCA000510425_01172 | gene | open | 41214-43547 | |||
| 2375 | AZKM01000022.1 | GCA000510425_01173 | gene | open | 43560-45131 | |||
| 2376 | AZKM01000022.1 | GCA000510425_01174 | gene | open | 45696-45920 | |||
| 2377 | AZKM01000022.1 | GCA000510425_01175 | gene | open | 45907-46281 | |||
| 2378 | AZKM01000022.1 | GCA000510425_01176 | gene | open | 46418-47203 | |||
| 2379 | AZKM01000022.1 | GCA000510425_01177 | gene | open | 47385-48254 | |||
| 2380 | AZKM01000022.1 | GCA000510425_01178 | gene | open | 48236-49162 | |||
| 2381 | AZKM01000022.1 | GCA000510425_01179 | gene | open | 49155-49664 | |||
| 2382 | AZKM01000022.1 | GCA000510425_01180 | gene | open | 49763-50269 | |||
| 2383 | AZKM01000022.1 | GCA000510425_01181 | gene | open | 50290-51000 | |||
| 2384 | AZKM01000022.1 | GCA000510425_01182 | gene | open | 51736-52995 | ltrA | ||
| 2385 | AZKM01000022.1 | GCA000510425_01183 | gene | open | 53077-53682 | tetR | ||
| 2386 | AZKM01000022.1 | GCA000510425_01184 | gene | open | 53730-55646 | |||
| 2387 | AZKM01000022.1 | GCA000510425_01185 | gene | open | 55650-57386 | mdlB | ||
| 2388 | AZKM01000022.1 | GCA000510425_01186 | gene | open | 57843-58163 | |||
| 2389 | AZKM01000023.1 | GCA000510425_01187 | CDS | open | 3062-3514 | _na 150_aa | PF06998 family protein | |
| 2390 | AZKM01000023.1 | GCA000510425_01188 | CDS | open | 3615-4634 | _na 339_aa | luxR | Transcriptional regulator%2C LuxR family |
| 2391 | AZKM01000023.1 | GCA000510425_01189 | CDS | open | 5186-6016 | _na 276_aa | putative endonuclease 4 | |
| 2392 | AZKM01000023.1 | GCA000510425_01190 | CDS | open | 6093-7181 | _na 362_aa | orr | ornithine racemase Orr |
| 2393 | AZKM01000023.1 | GCA000510425_01191 | CDS | open | 7196-8911 | _na 571_aa | GlmL-related ornithine degradation protein | |
| 2394 | AZKM01000023.1 | GCA000510425_01192 | CDS | open | 9237-10232 | _na 331_aa | DNA-binding helix-turn-helix protein | |
| 2395 | AZKM01000023.1 | GCA000510425_01193 | CDS | open | 10614-12866 | _na 750_aa | oraE | D-ornithine 4%2C5-aminomutase subunit OraE |
| 2396 | AZKM01000023.1 | GCA000510425_01194 | CDS | open | 12868-13239 | _na 123_aa | D-Lysine 5%2C6-aminomutase alpha subunit domain-containing protein | |
| 2397 | AZKM01000023.1 | GCA000510425_01195 | CDS | open | 13293-14705 | _na 470_aa | ortB | 2-amino-4-oxopentanoate thiolase subunit OrtB |
| 2398 | AZKM01000023.1 | GCA000510425_01196 | CDS | open | 14705-15004 | _na 99_aa | ortA | 2-amino-4-oxopentanoate thiolase subunit OrtA |
| 2399 | AZKM01000023.1 | GCA000510425_01197 | CDS | open | 15086-16147 | _na 353_aa | ord | 2%2C4-diaminopentanoate dehydrogenase |
| 2400 | AZKM01000023.1 | GCA000510425_01198 | CDS | open | 16493-17890 | _na 465_aa | rocR | Putative arginine utilization regulatory protein RocR |
| 2401 | AZKM01000023.1 | GCA000510425_01199 | CDS | open | 18032-19393 | _na 453_aa | mepA | Multidrug export protein MepA |
| 2402 | AZKM01000023.1 | GCA000510425_01200 | CDS | open | 19445-20131 | _na 228_aa | tetR | Transcriptional regulator%2C TetR family |
| 2403 | AZKM01000023.1 | GCA000510425_01201 | CDS | open | 20722-21084 | _na 120_aa | Bacterial CdiA-CT RNAse A domain-containing protein | |
| 2404 | AZKM01000023.1 | GCA000510425_01202 | CDS | open | 21496-21606 | _na 36_aa | hypothetical protein | |
| 2405 | AZKM01000023.1 | GCA000510425_01203 | CDS | open | 21904-22359 | _na 151_aa | Acetyltransferase (GNAT) domain protein | |
| 2406 | AZKM01000023.1 | GCA000510425_01204 | CDS | open | 22422-22568 | _na 48_aa | hypothetical protein | |
| 2407 | AZKM01000023.1 | GCA000510425_01187 | gene | open | 3062-3514 | |||
| 2408 | AZKM01000023.1 | GCA000510425_01188 | gene | open | 3615-4634 | luxR | ||
| 2409 | AZKM01000023.1 | GCA000510425_01189 | gene | open | 5186-6016 | |||
| 2410 | AZKM01000023.1 | GCA000510425_01190 | gene | open | 6093-7181 | orr | ||
| 2411 | AZKM01000023.1 | GCA000510425_01191 | gene | open | 7196-8911 | |||
| 2412 | AZKM01000023.1 | GCA000510425_01192 | gene | open | 9237-10232 | |||
| 2413 | AZKM01000023.1 | GCA000510425_01193 | gene | open | 10614-12866 | oraE | ||
| 2414 | AZKM01000023.1 | GCA000510425_01194 | gene | open | 12868-13239 | |||
| 2415 | AZKM01000023.1 | GCA000510425_01195 | gene | open | 13293-14705 | ortB | ||
| 2416 | AZKM01000023.1 | GCA000510425_01196 | gene | open | 14705-15004 | ortA | ||
| 2417 | AZKM01000023.1 | GCA000510425_01197 | gene | open | 15086-16147 | ord | ||
| 2418 | AZKM01000023.1 | GCA000510425_01198 | gene | open | 16493-17890 | rocR | ||
| 2419 | AZKM01000023.1 | GCA000510425_01199 | gene | open | 18032-19393 | mepA | ||
| 2420 | AZKM01000023.1 | GCA000510425_01200 | gene | open | 19445-20131 | tetR | ||
| 2421 | AZKM01000023.1 | GCA000510425_01201 | gene | open | 20722-21084 | |||
| 2422 | AZKM01000023.1 | GCA000510425_01202 | gene | open | 21496-21606 | |||
| 2423 | AZKM01000023.1 | GCA000510425_01203 | gene | open | 21904-22359 | |||
| 2424 | AZKM01000023.1 | GCA000510425_01204 | gene | open | 22422-22568 | |||
| 2425 | AZKM01000024.1 | GCA000510425_01205 | CDS | open | 228-560 | _na 110_aa | Asp23 family protein | |
| 2426 | AZKM01000024.1 | GCA000510425_01206 | CDS | open | 561-953 | _na 130_aa | nusB | transcription antitermination factor NusB |
| 2427 | AZKM01000024.1 | GCA000510425_01207 | CDS | open | 950-1936 | _na 328_aa | N(6)-L-threonylcarbamoyladenine synthase | |
| 2428 | AZKM01000024.1 | GCA000510425_01208 | CDS | open | 1899-3047 | _na 382_aa | xseA | exodeoxyribonuclease VII large subunit |
| 2429 | AZKM01000024.1 | GCA000510425_01209 | CDS | open | 3037-3228 | _na 63_aa | xseB | exodeoxyribonuclease VII small subunit |
| 2430 | AZKM01000024.1 | GCA000510425_01210 | CDS | open | 3242-4135 | _na 297_aa | Polyprenyl synthetase | |
| 2431 | AZKM01000024.1 | GCA000510425_01211 | CDS | open | 4152-6002 | _na 616_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 2432 | AZKM01000024.1 | GCA000510425_01212 | CDS | open | 5986-6786 | _na 266_aa | Ribosomal RNA large subunit methyltransferase J | |
| 2433 | AZKM01000024.1 | GCA000510425_01213 | CDS | open | 6812-8011 | _na 399_aa | Aminotransferase | |
| 2434 | AZKM01000024.1 | GCA000510425_01214 | CDS | open | 8025-10643 | _na 872_aa | mutS | DNA mismatch repair protein MutS |
| 2435 | AZKM01000024.1 | GCA000510425_01215 | CDS | open | 10636-12558 | _na 640_aa | mutL | DNA mismatch repair endonuclease MutL |
| 2436 | AZKM01000024.1 | GCA000510425_01216 | CDS | open | 12561-13499 | _na 312_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 2437 | AZKM01000024.1 | GCA000510425_01217 | CDS | open | 13472-14641 | _na 389_aa | Site-specific recombinase%2C phage integrase family | |
| 2438 | AZKM01000024.1 | GCA000510425_01218 | CDS | open | 14692-15981 | _na 429_aa | Methionine gamma-lyase | |
| 2439 | AZKM01000024.1 | GCA000510425_01219 | CDS | open | 15981-16706 | _na 241_aa | TVP38/TMEM64 family membrane protein | |
| 2440 | AZKM01000024.1 | GCA000510425_01220 | CDS | open | 16914-18563 | _na 549_aa | Fibronectin type III domain protein | |
| 2441 | AZKM01000024.1 | GCA000510425_01221 | CDS | open | 18647-19018 | _na 123_aa | hypothetical protein | |
| 2442 | AZKM01000024.1 | GCA000510425_01222 | CDS | open | 19018-21156 | _na 712_aa | hypothetical protein | |
| 2443 | AZKM01000024.1 | GCA000510425_01223 | CDS | open | 21146-22309 | _na 387_aa | Oligopeptide ABC transporter%2C oligopeptide-binding protein | |
| 2444 | AZKM01000024.1 | GCA000510425_01224 | CDS | open | 22326-23375 | _na 349_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 2445 | AZKM01000024.1 | GCA000510425_01225 | CDS | open | 23368-24477 | _na 369_aa | ABC transporter%2C ATP-binding protein | |
| 2446 | AZKM01000024.1 | GCA000510425_01226 | CDS | open | 24644-24943 | _na 99_aa | lysM | LysM domain protein |
| 2447 | AZKM01000024.1 | GCA000510425_01227 | CDS | open | 25363-25779 | _na 138_aa | Bacterial PH domain-containing protein | |
| 2448 | AZKM01000024.1 | GCA000510425_01228 | CDS | open | 25900-27420 | _na 506_aa | nhaC | Na+/H+ antiporter NhaC |
| 2449 | AZKM01000024.1 | GCA000510425_01229 | CDS | open | 27537-28340 | _na 267_aa | Stage 0 sporulation A-like protein | |
| 2450 | AZKM01000024.1 | GCA000510425_01230 | CDS | open | 28315-29613 | _na 432_aa | Histidine kinase | |
| 2451 | AZKM01000024.1 | GCA000510425_01231 | CDS | open | 29729-33436 | _na 1235_aa | phosphoribosylformylglycinamidine synthase | |
| 2452 | AZKM01000024.1 | GCA000510425_01232 | CDS | open | 33436-34704 | _na 422_aa | Phosphoribosylamine--glycine ligase | |
| 2453 | AZKM01000024.1 | GCA000510425_01233 | CDS | open | 34718-35902 | _na 394_aa | phosphoribosylaminoimidazolecarboxamide formyltransferase | |
| 2454 | AZKM01000024.1 | GCA000510425_01234 | CDS | open | 35902-36621 | _na 239_aa | IMP cyclohydrolase-like protein | |
| 2455 | AZKM01000024.1 | GCA000510425_01235 | CDS | open | 36621-37211 | _na 196_aa | purN | phosphoribosylglycinamide formyltransferase |
| 2456 | AZKM01000024.1 | GCA000510425_01236 | CDS | open | 37205-38245 | _na 346_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 2457 | AZKM01000024.1 | GCA000510425_01237 | CDS | open | 38263-38757 | _na 164_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 2458 | AZKM01000024.1 | GCA000510425_01238 | CDS | open | 38918-39343 | _na 141_aa | ruvX | Holliday junction resolvase RuvX |
| 2459 | AZKM01000024.1 | GCA000510425_01239 | CDS | open | 39396-39641 | _na 81_aa | ireB | IreB family regulatory phosphoprotein |
| 2460 | AZKM01000024.1 | GCA000510425_01240 | CDS | open | 39768-42386 | _na 872_aa | alaS | alanine--tRNA ligase |
| 2461 | AZKM01000024.1 | GCA000510425_01241 | CDS | open | 42417-44081 | _na 554_aa | Phosphoglucomutase | |
| 2462 | AZKM01000024.1 | GCA000510425_01242 | CDS | open | 44226-44882 | _na 218_aa | quinolinate synthase | |
| 2463 | AZKM01000024.1 | GCA000510425_01243 | CDS | open | 44863-45141 | _na 92_aa | hypothetical protein | |
| 2464 | AZKM01000024.1 | GCA000510425_01244 | CDS | open | 45360-46736 | _na 458_aa | L-aspartate oxidase | |
| 2465 | AZKM01000024.1 | GCA000510425_01245 | CDS | open | 46729-47586 | _na 285_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 2466 | AZKM01000024.1 | GCA000510425_01246 | CDS | open | 47758-48204 | _na 148_aa | nifU | Fe-S cluster assembly scaffold protein NifU |
| 2467 | AZKM01000024.1 | GCA000510425_01247 | CDS | open | 48206-49393 | _na 395_aa | nifS | cysteine desulfurase NifS |
| 2468 | AZKM01000024.1 | GCA000510425_01248 | CDS | open | 49626-49811 | _na 61_aa | UPF0291 protein HMPREF0378_0607 | |
| 2469 | AZKM01000024.1 | GCA000510425_01249 | CDS | open | 49862-50524 | _na 220_aa | ComEA protein | |
| 2470 | AZKM01000024.1 | GCA000510425_01250 | CDS | open | 50557-51243 | _na 228_aa | TIGR03936 family radical SAM-associated protein | |
| 2471 | AZKM01000024.1 | GCA000510425_01251 | CDS | open | 51236-53590 | _na 784_aa | Radical SAM domain protein | |
| 2472 | AZKM01000024.1 | GCA000510425_01252 | CDS | open | 53612-54943 | _na 443_aa | obgE | GTPase ObgE |
| 2473 | AZKM01000024.1 | GCA000510425_01253 | CDS | open | 54959-55219 | _na 86_aa | rpmA | 50S ribosomal protein L27 |
| 2474 | AZKM01000024.1 | GCA000510425_01254 | CDS | open | 55252-55731 | _na 159_aa | rplU | 50S ribosomal protein L21 |
| 2475 | AZKM01000024.1 | GCA000510425_01255 | CDS | open | 56046-57146 | _na 366_aa | recA | recombinase RecA |
| 2476 | AZKM01000024.1 | GCA000510425_01256 | CDS | open | 57278-58510 | _na 410_aa | competence/damage-inducible protein A | |
| 2477 | AZKM01000024.1 | GCA000510425_01257 | CDS | open | 58525-59064 | _na 179_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 2478 | AZKM01000024.1 | GCA000510425_01258 | CDS | open | 59067-60383 | _na 438_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 2479 | AZKM01000024.1 | GCA000510425_01259 | CDS | open | 60395-62845 | _na 816_aa | Putative stage III sporulation protein E | |
| 2480 | AZKM01000024.1 | GCA000510425_01260 | CDS | open | 62862-63704 | _na 280_aa | Undecaprenyl-diphosphatase | |
| 2481 | AZKM01000024.1 | GCA000510425_01261 | CDS | open | 63718-64914 | _na 398_aa | asd | aspartate-semialdehyde dehydrogenase |
| 2482 | AZKM01000024.1 | GCA000510425_01262 | CDS | open | 65139-67739 | _na 866_aa | clpB | ATP-dependent chaperone ClpB |
| 2483 | AZKM01000024.1 | GCA000510425_01263 | CDS | open | 68155-68874 | _na 239_aa | Peptidase%2C M50 family | |
| 2484 | AZKM01000024.1 | GCA000510425_01264 | CDS | open | 68861-69136 | _na 91_aa | hypothetical protein | |
| 2485 | AZKM01000024.1 | GCA000510425_01265 | CDS | open | 69148-70476 | _na 442_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 2486 | AZKM01000024.1 | GCA000510425_01266 | CDS | open | 70486-71484 | _na 332_aa | NAD(P)H-dependent glycerol-3-phosphate dehydrogenase | |
| 2487 | AZKM01000024.1 | GCA000510425_01267 | CDS | open | 71486-72091 | _na 201_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 2488 | AZKM01000024.1 | GCA000510425_01268 | CDS | open | 72092-73417 | _na 441_aa | der | ribosome biogenesis GTPase Der |
| 2489 | AZKM01000024.1 | GCA000510425_01269 | CDS | open | 73410-74312 | _na 300_aa | ftsY | signal recognition particle-docking protein FtsY |
| 2490 | AZKM01000024.1 | GCA000510425_01270 | CDS | open | 74321-77881 | _na 1186_aa | smc | chromosome segregation protein SMC |
| 2491 | AZKM01000024.1 | GCA000510425_01271 | CDS | open | 77881-78579 | _na 232_aa | rnc | ribonuclease III |
| 2492 | AZKM01000024.1 | GCA000510425_01272 | CDS | open | 78563-79600 | _na 345_aa | plsX | phosphate acyltransferase PlsX |
| 2493 | AZKM01000024.1 | GCA000510425_01273 | CDS | open | 79665-80924 | _na 419_aa | Serine hydroxymethyltransferase | |
| 2494 | AZKM01000024.1 | GCA000510425_01274 | CDS | open | 81055-81510 | _na 151_aa | PF12821 family protein | |
| 2495 | AZKM01000024.1 | GCA000510425_01275 | CDS | open | 81507-82265 | _na 252_aa | PF06738 family protein | |
| 2496 | AZKM01000024.1 | GCA000510425_01276 | CDS | open | 82351-83640 | _na 429_aa | tetrahydrofolate synthase | |
| 2497 | AZKM01000024.1 | GCA000510425_01277 | CDS | open | 83643-86357 | _na 904_aa | valine--tRNA ligase | |
| 2498 | AZKM01000024.1 | GCA000510425_01278 | CDS | open | 86872-89796 | _na 974_aa | Fibronectin type III domain protein | |
| 2499 | AZKM01000024.1 | GCA000510425_01279 | CDS | open | 90356-91477 | _na 373_aa | ribonucleotide-diphosphate reductase subunit beta | |
| 2500 | AZKM01000024.1 | GCA000510425_01280 | CDS | open | 91510-94023 | _na 837_aa | ribonucleoside-diphosphate reductase subunit alpha |

