HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Roseomonas mucosa (GCA_000622225.1)

Select a Genome:
BAKTA Annotations for GCA_000622225.1
Genome Selected: Roseomonas mucosa
ContigsBases CDSrRNA tmRNAtRNA
77 4864580 4404 4 1 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 8955 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:16]    |    Number of Records Found: 8955 [18 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
7501 JHWD01000038.1 GCA000622225_04213 gene open 20281-21129
7502 JHWD01000038.1 GCA000622225_04214 gene open 21139-22215
7503 JHWD01000038.1 GCA000622225_04215 gene open 22229-22369
7504 JHWD01000039.1 GCA000622225_04216 CDS open 337-669 _na     110_aa Type II toxin-antitoxin system PemK/MazF family toxin
7505 JHWD01000039.1 GCA000622225_04217 CDS open 701-943 _na     80_aa copG Ribbon-helix-helix protein CopG domain-containing protein
7506 JHWD01000039.1 GCA000622225_04218 CDS open 1459-2175 _na     238_aa IS6 family transposase
7507 JHWD01000039.1 GCA000622225_04219 CDS open 2686-3087 _na     133_aa DUF2442 domain-containing protein
7508 JHWD01000039.1 GCA000622225_04220 CDS open 3080-3337 _na     85_aa DUF4160 domain-containing protein
7509 JHWD01000039.1 GCA000622225_04221 CDS open 3485-5683 _na     732_aa recD ATP-dependent RecD2 DNA helicase
7510 JHWD01000039.1 GCA000622225_04222 CDS open 5819-6538 _na     239_aa hypothetical protein
7511 JHWD01000039.1 GCA000622225_04223 CDS open 7377-8297 _na     306_aa repA Plasmid encoded RepA protein
7512 JHWD01000039.1 GCA000622225_04224 CDS open 8746-8871 _na     41_aa Transposase
7513 JHWD01000039.1 GCA000622225_04225 CDS open 9210-9386 _na     58_aa Transposase
7514 JHWD01000039.1 GCA000622225_04226 CDS open 9383-9730 _na     115_aa tnpB IS66 family insertion sequence element accessory protein TnpB
7515 JHWD01000039.1 GCA000622225_04227 CDS open 9812-11383 _na     523_aa tnpC IS66 family transposase
7516 JHWD01000039.1 GCA000622225_04228 CDS open 11380-11979 _na     199_aa Plasmid pRiA4b ORF-3-like protein
7517 JHWD01000039.1 GCA000622225_04229 CDS open 12027-12407 _na     126_aa hypothetical protein
7518 JHWD01000039.1 GCA000622225_04230 CDS open 12534-12761 _na     75_aa SpoVT-AbrB domain-containing protein
7519 JHWD01000039.1 GCA000622225_04231 CDS open 12758-13150 _na     130_aa doc Toxin Doc
7520 JHWD01000039.1 GCA000622225_04232 CDS open 13214-13570 _na     118_aa hypothetical protein
7521 JHWD01000039.1 GCA000622225_04233 CDS open 13888-15399 _na     503_aa istA IS21 family transposase
7522 JHWD01000039.1 GCA000622225_04234 CDS open 15396-16205 _na     269_aa istB IS21-like element helper ATPase IstB
7523 JHWD01000039.1 GCA000622225_04216 gene open 337-669
7524 JHWD01000039.1 GCA000622225_04217 gene open 701-943 copG
7525 JHWD01000039.1 GCA000622225_04218 gene open 1459-2175
7526 JHWD01000039.1 GCA000622225_04219 gene open 2686-3087
7527 JHWD01000039.1 GCA000622225_04220 gene open 3080-3337
7528 JHWD01000039.1 GCA000622225_04221 gene open 3485-5683 recD
7529 JHWD01000039.1 GCA000622225_04222 gene open 5819-6538
7530 JHWD01000039.1 GCA000622225_04223 gene open 7377-8297 repA
7531 JHWD01000039.1 GCA000622225_04224 gene open 8746-8871
7532 JHWD01000039.1 GCA000622225_04225 gene open 9210-9386
7533 JHWD01000039.1 GCA000622225_04226 gene open 9383-9730 tnpB
7534 JHWD01000039.1 GCA000622225_04227 gene open 9812-11383 tnpC
7535 JHWD01000039.1 GCA000622225_04228 gene open 11380-11979
7536 JHWD01000039.1 GCA000622225_04229 gene open 12027-12407
7537 JHWD01000039.1 GCA000622225_04230 gene open 12534-12761
7538 JHWD01000039.1 GCA000622225_04231 gene open 12758-13150 doc
7539 JHWD01000039.1 GCA000622225_04232 gene open 13214-13570
7540 JHWD01000039.1 GCA000622225_04233 gene open 13888-15399 istA
7541 JHWD01000039.1 GCA000622225_04234 gene open 15396-16205 istB
7542 JHWD01000040.1 GCA000622225_04235 CDS open 42-263 _na     73_aa Integrase catalytic domain-containing protein
7543 JHWD01000040.1 GCA000622225_04236 CDS open 439-1500 _na     353_aa Bile acid:sodium symporter
7544 JHWD01000040.1 GCA000622225_04237 CDS open 1598-2458 _na     286_aa lysR CysJI operon transcriptional activator
7545 JHWD01000040.1 GCA000622225_04238 CDS open 2572-3789 _na     405_aa ltrA Low temperature requirement protein A
7546 JHWD01000040.1 GCA000622225_04239 CDS open 4198-5331 _na     377_aa csdA Isopenicillin N epimerase
7547 JHWD01000040.1 GCA000622225_04240 CDS open 5390-6865 _na     491_aa baeS histidine kinase
7548 JHWD01000040.1 GCA000622225_04241 CDS open 6862-7527 _na     221_aa ompR DNA-binding response regulator
7549 JHWD01000040.1 GCA000622225_04242 CDS open 7663-8436 _na     257_aa tauB ABC transporter
7550 JHWD01000040.1 GCA000622225_04243 CDS open 8447-9328 _na     293_aa tauC ABC transporter permease
7551 JHWD01000040.1 GCA000622225_04244 CDS open 9380-10405 _na     341_aa tauA SsuA/THI5-like domain-containing protein
7552 JHWD01000040.1 GCA000622225_04245 CDS open 10453-11028 _na     191_aa Tyrosine specific protein phosphatases domain-containing protein
7553 JHWD01000040.1 GCA000622225_04246 CDS open 11330-11713 _na     127_aa cof Capsular biosynthesis protein
7554 JHWD01000040.1 GCA000622225_04247 CDS open 11710-13308 _na     532_aa Capsular polysaccharide biosynthesis protein
7555 JHWD01000040.1 GCA000622225_04248 CDS open 13305-14057 _na     250_aa Glucose-1-phosphate thymidylyltransferase
7556 JHWD01000040.1 GCA000622225_04249 CDS open 14121-15560 _na     479_aa hypothetical protein
7557 JHWD01000040.1 GCA000622225_04250 CDS open 15637-16353 _na     238_aa Streptogramin A acetyltransferase
7558 JHWD01000040.1 GCA000622225_04235 gene open 42-263
7559 JHWD01000040.1 GCA000622225_04236 gene open 439-1500
7560 JHWD01000040.1 GCA000622225_04237 gene open 1598-2458 lysR
7561 JHWD01000040.1 GCA000622225_04238 gene open 2572-3789 ltrA
7562 JHWD01000040.1 GCA000622225_04239 gene open 4198-5331 csdA
7563 JHWD01000040.1 GCA000622225_04240 gene open 5390-6865 baeS
7564 JHWD01000040.1 GCA000622225_04241 gene open 6862-7527 ompR
7565 JHWD01000040.1 GCA000622225_04242 gene open 7663-8436 tauB
7566 JHWD01000040.1 GCA000622225_04243 gene open 8447-9328 tauC
7567 JHWD01000040.1 GCA000622225_04244 gene open 9380-10405 tauA
7568 JHWD01000040.1 GCA000622225_04245 gene open 10453-11028
7569 JHWD01000040.1 GCA000622225_04246 gene open 11330-11713 cof
7570 JHWD01000040.1 GCA000622225_04247 gene open 11710-13308
7571 JHWD01000040.1 GCA000622225_04248 gene open 13305-14057
7572 JHWD01000040.1 GCA000622225_04249 gene open 14121-15560
7573 JHWD01000040.1 GCA000622225_04250 gene open 15637-16353
7574 JHWD01000041.1 GCA000622225_04251 CDS open 429-998 _na     189_aa PIN domain-containing protein
7575 JHWD01000041.1 GCA000622225_04252 CDS open 1005-1187 _na     60_aa hypothetical protein
7576 JHWD01000041.1 GCA000622225_04253 CDS open 1347-2309 _na     320_aa Integrase
7577 JHWD01000041.1 GCA000622225_04254 CDS open 2538-2942 _na     134_aa copG CopG family transcriptional regulator
7578 JHWD01000041.1 GCA000622225_04255 CDS open 3253-4620 _na     455_aa repC plasmid replication protein RepC
7579 JHWD01000041.1 GCA000622225_04256 CDS open 4849-5007 _na     52_aa hypothetical protein
7580 JHWD01000041.1 GCA000622225_04257 CDS open 4997-6496 _na     499_aa umuC UmuC domain-containing protein
7581 JHWD01000041.1 GCA000622225_04258 CDS open 6504-9794 _na     1096_aa Error-prone DNA polymerase
7582 JHWD01000041.1 GCA000622225_04259 CDS open 10081-10743 _na     220_aa Antiporter inner membrane protein
7583 JHWD01000041.1 GCA000622225_04260 CDS open 10985-11128 _na     47_aa copG Ribbon-helix-helix protein CopG domain-containing protein
7584 JHWD01000041.1 GCA000622225_04261 CDS open 11561-12514 _na     317_aa DUF3991 domain-containing protein
7585 JHWD01000041.1 GCA000622225_04262 CDS open 12511-12849 _na     112_aa Alpha/beta hydrolase family protein
7586 JHWD01000041.1 GCA000622225_04263 CDS open 12833-14875 _na     680_aa DNA 3'-5' helicase
7587 JHWD01000041.1 GCA000622225_04264 CDS open 14915-15760 _na     281_aa hypothetical protein
7588 JHWD01000041.1 GCA000622225_04251 gene open 429-998
7589 JHWD01000041.1 GCA000622225_04252 gene open 1005-1187
7590 JHWD01000041.1 GCA000622225_04253 gene open 1347-2309
7591 JHWD01000041.1 GCA000622225_04254 gene open 2538-2942 copG
7592 JHWD01000041.1 GCA000622225_04255 gene open 3253-4620 repC
7593 JHWD01000041.1 GCA000622225_04256 gene open 4849-5007
7594 JHWD01000041.1 GCA000622225_04257 gene open 4997-6496 umuC
7595 JHWD01000041.1 GCA000622225_04258 gene open 6504-9794
7596 JHWD01000041.1 GCA000622225_04259 gene open 10081-10743
7597 JHWD01000041.1 GCA000622225_04260 gene open 10985-11128 copG
7598 JHWD01000041.1 GCA000622225_04261 gene open 11561-12514
7599 JHWD01000041.1 GCA000622225_04262 gene open 12511-12849
7600 JHWD01000041.1 GCA000622225_04263 gene open 12833-14875
7601 JHWD01000041.1 GCA000622225_04264 gene open 14915-15760
7602 JHWD01000042.1 GCA000622225_04265 CDS open 520-1536 _na     338_aa fpr Vanillate demethylase oxidoreductase subunit
7603 JHWD01000042.1 GCA000622225_04266 CDS open 1569-2294 _na     241_aa gntR GntR family transcriptional regulator
7604 JHWD01000042.1 GCA000622225_04267 CDS open 2300-3364 _na     354_aa pobA 3-ketosteroid-9-alpha-hydroxylase oxygenase subunit
7605 JHWD01000042.1 GCA000622225_04268 CDS open 3492-4220 _na     242_aa livF ABC transporter ATP-binding protein
7606 JHWD01000042.1 GCA000622225_04269 CDS open 4213-5013 _na     266_aa livG Cobalt import ATP-binding protein CbiO
7607 JHWD01000042.1 GCA000622225_04270 CDS open 5010-6017 _na     335_aa livM Branched-chain amino acid ABC transporter permease
7608 JHWD01000042.1 GCA000622225_04271 CDS open 6029-6889 _na     286_aa livH Branched-chain amino acid ABC transporter permease
7609 JHWD01000042.1 GCA000622225_04272 CDS open 6905-8083 _na     392_aa livK ABC transporter substrate-binding protein
7610 JHWD01000042.1 GCA000622225_04273 CDS open 8145-9137 _na     330_aa catE catechol 2%2C3-dioxygenase
7611 JHWD01000042.1 GCA000622225_04274 CDS open 9134-9856 _na     240_aa menH Alpha/beta hydrolase
7612 JHWD01000042.1 GCA000622225_04275 CDS open 9846-10697 _na     283_aa ligB Protocatechuate 3%2C4-dioxygenase
7613 JHWD01000042.1 GCA000622225_04276 CDS open 10697-11092 _na     131_aa Protocatechuate 4%2C5-dioxygenase alpha chain
7614 JHWD01000042.1 GCA000622225_04277 CDS open 11192-12181 _na     329_aa lysR HTH-type transcriptional regulator AbgR
7615 JHWD01000042.1 GCA000622225_04278 CDS open 12327-13205 _na     292_aa mmsB Phosphogluconate dehydrogenase
7616 JHWD01000042.1 GCA000622225_04279 CDS open 13202-14107 _na     301_aa 4-sulfomuconolactone hydrolase
7617 JHWD01000042.1 GCA000622225_04280 CDS open 14104-15105 _na     333_aa tctC Tripartite tricarboxylate transporter receptor protein
7618 JHWD01000042.1 GCA000622225_04265 gene open 520-1536 fpr
7619 JHWD01000042.1 GCA000622225_04266 gene open 1569-2294 gntR
7620 JHWD01000042.1 GCA000622225_04267 gene open 2300-3364 pobA
7621 JHWD01000042.1 GCA000622225_04268 gene open 3492-4220 livF
7622 JHWD01000042.1 GCA000622225_04269 gene open 4213-5013 livG
7623 JHWD01000042.1 GCA000622225_04270 gene open 5010-6017 livM
7624 JHWD01000042.1 GCA000622225_04271 gene open 6029-6889 livH
7625 JHWD01000042.1 GCA000622225_04272 gene open 6905-8083 livK
7626 JHWD01000042.1 GCA000622225_04273 gene open 8145-9137 catE
7627 JHWD01000042.1 GCA000622225_04274 gene open 9134-9856 menH
7628 JHWD01000042.1 GCA000622225_04275 gene open 9846-10697 ligB
7629 JHWD01000042.1 GCA000622225_04276 gene open 10697-11092
7630 JHWD01000042.1 GCA000622225_04277 gene open 11192-12181 lysR
7631 JHWD01000042.1 GCA000622225_04278 gene open 12327-13205 mmsB
7632 JHWD01000042.1 GCA000622225_04279 gene open 13202-14107
7633 JHWD01000042.1 GCA000622225_04280 gene open 14104-15105 tctC
7634 JHWD01000043.1 regulatory_region open 7983-8099 ALIL pseudoknot
7635 JHWD01000043.1 GCA000622225_04281 CDS open 498-596 _na     32_aa Transposase
7636 JHWD01000043.1 GCA000622225_04282 CDS open 680-1663 _na     327_aa repA Plasmid encoded RepA protein
7637 JHWD01000043.1 GCA000622225_04283 CDS open 2286-2660 _na     124_aa putative protein conserved in bacteria
7638 JHWD01000043.1 GCA000622225_04284 CDS open 2653-2970 _na     105_aa Antitoxin igA-2
7639 JHWD01000043.1 GCA000622225_04285 CDS open 3026-4324 _na     432_aa Methyltransferase
7640 JHWD01000043.1 GCA000622225_04286 CDS open 4327-5463 _na     378_aa DUF262 domain-containing protein
7641 JHWD01000043.1 GCA000622225_04287 CDS open 5450-6139 _na     229_aa RiboL-PSP-HEPN domain-containing protein
7642 JHWD01000043.1 GCA000622225_04288 CDS open 6178-6618 _na     146_aa xerD Tyrosine recombinase XerD
7643 JHWD01000043.1 GCA000622225_04289 CDS open 7180-7611 _na     143_aa IS3 family transposase
7644 JHWD01000043.1 GCA000622225_04290 CDS open 7702-8028 _na     108_aa Transposase
7645 JHWD01000043.1 GCA000622225_04291 CDS open 8025-8930 _na     301_aa IS3 family transposase
7646 JHWD01000043.1 GCA000622225_04292 CDS open 8894-9376 _na     160_aa HTH-like domain-containing protein
7647 JHWD01000043.1 GCA000622225_04293 CDS open 9373-9717 _na     114_aa Transposase
7648 JHWD01000043.1 GCA000622225_04294 CDS open 9969-10310 _na     113_aa hypothetical protein
7649 JHWD01000043.1 GCA000622225_04295 CDS open 10371-10793 _na     140_aa padR Transcriptional regulator YqjI
7650 JHWD01000043.1 GCA000622225_04296 CDS open 10849-12303 _na     484_aa Putative glutamate synthase subunit beta
7651 JHWD01000043.1 GCA000622225_04297 CDS open 12300-13541 _na     413_aa Oxalate/formate antiporter family transporter
7652 JHWD01000043.1 GCA000622225_04298 CDS open 13860-14162 _na     100_aa hypothetical protein
7653 JHWD01000043.1 GCA000622225_04281 gene open 498-596
7654 JHWD01000043.1 GCA000622225_04282 gene open 680-1663 repA
7655 JHWD01000043.1 GCA000622225_04283 gene open 2286-2660
7656 JHWD01000043.1 GCA000622225_04284 gene open 2653-2970
7657 JHWD01000043.1 GCA000622225_04285 gene open 3026-4324
7658 JHWD01000043.1 GCA000622225_04286 gene open 4327-5463
7659 JHWD01000043.1 GCA000622225_04287 gene open 5450-6139
7660 JHWD01000043.1 GCA000622225_04288 gene open 6178-6618 xerD
7661 JHWD01000043.1 GCA000622225_04289 gene open 7180-7611
7662 JHWD01000043.1 GCA000622225_04290 gene open 7702-8028
7663 JHWD01000043.1 GCA000622225_04291 gene open 8025-8930
7664 JHWD01000043.1 GCA000622225_04292 gene open 8894-9376
7665 JHWD01000043.1 GCA000622225_04293 gene open 9373-9717
7666 JHWD01000043.1 GCA000622225_04294 gene open 9969-10310
7667 JHWD01000043.1 GCA000622225_04295 gene open 10371-10793 padR
7668 JHWD01000043.1 GCA000622225_04296 gene open 10849-12303
7669 JHWD01000043.1 GCA000622225_04297 gene open 12300-13541
7670 JHWD01000043.1 GCA000622225_04298 gene open 13860-14162
7671 JHWD01000044.1 GCA000622225_04299 CDS open 87-260 _na     57_aa Integrase catalytic domain-containing protein
7672 JHWD01000044.1 GCA000622225_04300 CDS open 343-1542 _na     399_aa hypothetical protein
7673 JHWD01000044.1 GCA000622225_04301 CDS open 1547-1990 _na     147_aa CRISPR type III-B/RAMP module-associated protein Cmr5
7674 JHWD01000044.1 GCA000622225_04302 CDS open 1999-5025 _na     1008_aa DUF1156 domain-containing protein
7675 JHWD01000044.1 GCA000622225_04303 CDS open 5022-6347 _na     441_aa Metallo-beta-lactamase superfamily
7676 JHWD01000044.1 GCA000622225_04304 CDS open 6399-9959 _na     1186_aa rapA RNA polymerase-associated protein rapA
7677 JHWD01000044.1 GCA000622225_04305 CDS open 10028-10438 _na     136_aa vapC Ribonuclease VapC
7678 JHWD01000044.1 GCA000622225_04306 CDS open 10435-10659 _na     74_aa vagC Antitoxin
7679 JHWD01000044.1 GCA000622225_04307 CDS open 10772-11896 _na     374_aa xerD Tyrosine recombinase XerD
7680 JHWD01000044.1 GCA000622225_04308 CDS open 11893-12300 _na     135_aa vapC Ribonuclease VapC
7681 JHWD01000044.1 GCA000622225_04309 CDS open 12297-12533 _na     78_aa mazE Antitoxin MazE
7682 JHWD01000044.1 GCA000622225_04310 CDS open 12816-13589 _na     257_aa hypothetical protein
7683 JHWD01000044.1 GCA000622225_04311 CDS open 13606-13827 _na     73_aa Integrase catalytic domain-containing protein
7684 JHWD01000044.1 GCA000622225_04299 gene open 87-260
7685 JHWD01000044.1 GCA000622225_04300 gene open 343-1542
7686 JHWD01000044.1 GCA000622225_04301 gene open 1547-1990
7687 JHWD01000044.1 GCA000622225_04302 gene open 1999-5025
7688 JHWD01000044.1 GCA000622225_04303 gene open 5022-6347
7689 JHWD01000044.1 GCA000622225_04304 gene open 6399-9959 rapA
7690 JHWD01000044.1 GCA000622225_04305 gene open 10028-10438 vapC
7691 JHWD01000044.1 GCA000622225_04306 gene open 10435-10659 vagC
7692 JHWD01000044.1 GCA000622225_04307 gene open 10772-11896 xerD
7693 JHWD01000044.1 GCA000622225_04308 gene open 11893-12300 vapC
7694 JHWD01000044.1 GCA000622225_04309 gene open 12297-12533 mazE
7695 JHWD01000044.1 GCA000622225_04310 gene open 12816-13589
7696 JHWD01000044.1 GCA000622225_04311 gene open 13606-13827
7697 JHWD01000045.1 repeat_region open 9261-9534 CRISPR array with 5 repeats of length 29%2C consensus sequence GTGTTCCCCGCGAGCGCGGGGATGAACCG and spacer length 32
7698 JHWD01000045.1 GCA000622225_04312 CDS open 3-413 _na     136_aa vapC Ribonuclease VapC
7699 JHWD01000045.1 GCA000622225_04313 CDS open 750-3146 _na     798_aa CRISPR-associated helicase/endonuclease Cas3
7700 JHWD01000045.1 GCA000622225_04314 CDS open 3205-4839 _na     544_aa casA type I-E CRISPR-associated protein Cse1/CasA
7701 JHWD01000045.1 GCA000622225_04315 CDS open 4836-5396 _na     186_aa casB type I-E CRISPR-associated protein Cse2/CasB
7702 JHWD01000045.1 GCA000622225_04316 CDS open 5393-6472 _na     359_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
7703 JHWD01000045.1 GCA000622225_04317 CDS open 6477-7244 _na     255_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
7704 JHWD01000045.1 GCA000622225_04318 CDS open 7241-7930 _na     229_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
7705 JHWD01000045.1 GCA000622225_04319 CDS open 7930-8898 _na     322_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
7706 JHWD01000045.1 GCA000622225_04320 CDS open 8879-9211 _na     110_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
7707 JHWD01000045.1 GCA000622225_04312 gene open 3-413 vapC
7708 JHWD01000045.1 GCA000622225_04313 gene open 750-3146
7709 JHWD01000045.1 GCA000622225_04314 gene open 3205-4839 casA
7710 JHWD01000045.1 GCA000622225_04315 gene open 4836-5396 casB
7711 JHWD01000045.1 GCA000622225_04316 gene open 5393-6472 cas7e
7712 JHWD01000045.1 GCA000622225_04317 gene open 6477-7244 cas5e
7713 JHWD01000045.1 GCA000622225_04318 gene open 7241-7930 cas6e
7714 JHWD01000045.1 GCA000622225_04319 gene open 7930-8898 cas1e
7715 JHWD01000045.1 GCA000622225_04320 gene open 8879-9211 cas2e
7716 JHWD01000046.1 GCA000622225_04321 CDS open 22-762 _na     246_aa helix-turn-helix domain-containing protein
7717 JHWD01000046.1 GCA000622225_04322 CDS open 1058-1615 _na     185_aa hypothetical protein
7718 JHWD01000046.1 GCA000622225_04323 CDS open 2095-2364 _na     89_aa Integrase catalytic domain-containing protein
7719 JHWD01000046.1 GCA000622225_04324 CDS open 3049-4080 _na     343_aa repA Plasmid encoded RepA protein
7720 JHWD01000046.1 GCA000622225_04325 CDS open 4442-5167 _na     241_aa hypothetical protein
7721 JHWD01000046.1 GCA000622225_04326 CDS open 5160-5876 _na     238_aa Septum formation inhibitor-activating ATPase
7722 JHWD01000046.1 GCA000622225_04327 CDS open 6686-6904 _na     72_aa Transposase
7723 JHWD01000046.1 GCA000622225_04328 CDS open 7097-8596 _na     499_aa Tetratricopeptide repeat protein
7724 JHWD01000046.1 GCA000622225_04321 gene open 22-762
7725 JHWD01000046.1 GCA000622225_04322 gene open 1058-1615
7726 JHWD01000046.1 GCA000622225_04323 gene open 2095-2364
7727 JHWD01000046.1 GCA000622225_04324 gene open 3049-4080 repA
7728 JHWD01000046.1 GCA000622225_04325 gene open 4442-5167
7729 JHWD01000046.1 GCA000622225_04326 gene open 5160-5876
7730 JHWD01000046.1 GCA000622225_04327 gene open 6686-6904
7731 JHWD01000046.1 GCA000622225_04328 gene open 7097-8596
7732 JHWD01000047.1 GCA000622225_04329 CDS open 103-996 _na     297_aa Hca operon transcriptional activator
7733 JHWD01000047.1 GCA000622225_04330 CDS open 1253-1981 _na     242_aa Glucose 1-dehydrogenase 2
7734 JHWD01000047.1 GCA000622225_04331 CDS open 1978-2250 _na     90_aa catC muconolactone Delta-isomerase
7735 JHWD01000047.1 GCA000622225_04332 CDS open 2482-3378 _na     298_aa putative 3-hydroxybutyryl-CoA dehydrogenase
7736 JHWD01000047.1 GCA000622225_04333 CDS open 3428-4441 _na     337_aa Cyclase
7737 JHWD01000047.1 GCA000622225_04334 CDS open 4690-6033 _na     447_aa Short-chain fatty acids transporter
7738 JHWD01000047.1 GCA000622225_04335 CDS open 6150-6446 _na     98_aa YciI-like protein
7739 JHWD01000047.1 GCA000622225_04336 CDS open 6459-6800 _na     113_aa Tc1-like transposase DDE domain-containing protein
7740 JHWD01000047.1 GCA000622225_04337 CDS open 6902-7372 _na     156_aa DUF772 domain-containing protein
7741 JHWD01000047.1 GCA000622225_04338 CDS open 7735-7854 _na     39_aa Transposase
7742 JHWD01000047.1 GCA000622225_04339 CDS open 8162-8425 _na     87_aa Mutator family transposase
7743 JHWD01000047.1 GCA000622225_04340 CDS open 8380-8487 _na     35_aa hypothetical protein
7744 JHWD01000047.1 GCA000622225_04329 gene open 103-996
7745 JHWD01000047.1 GCA000622225_04330 gene open 1253-1981
7746 JHWD01000047.1 GCA000622225_04331 gene open 1978-2250 catC
7747 JHWD01000047.1 GCA000622225_04332 gene open 2482-3378
7748 JHWD01000047.1 GCA000622225_04333 gene open 3428-4441
7749 JHWD01000047.1 GCA000622225_04334 gene open 4690-6033
7750 JHWD01000047.1 GCA000622225_04335 gene open 6150-6446
7751 JHWD01000047.1 GCA000622225_04336 gene open 6459-6800
7752 JHWD01000047.1 GCA000622225_04337 gene open 6902-7372
7753 JHWD01000047.1 GCA000622225_04338 gene open 7735-7854
7754 JHWD01000047.1 GCA000622225_04339 gene open 8162-8425
7755 JHWD01000047.1 GCA000622225_04340 gene open 8380-8487
7756 JHWD01000048.1 GCA000622225_04341 CDS open 1-3111 _na     1036_aa Lhr-like helicases
7757 JHWD01000048.1 GCA000622225_04342 CDS open 3116-7093 _na     1325_aa hypothetical protein
7758 JHWD01000048.1 GCA000622225_04341 gene open 1-3111
7759 JHWD01000048.1 GCA000622225_04342 gene open 3116-7093
7760 JHWD01000049.1 GCA000622225_04343 CDS open 626-814 _na     62_aa hypothetical protein
7761 JHWD01000049.1 GCA000622225_04344 CDS open 1257-2522 _na     421_aa Xylosidase/arabinosidase
7762 JHWD01000049.1 GCA000622225_04345 CDS open 2615-3271 _na     218_aa metW methionine biosynthesis protein MetW
7763 JHWD01000049.1 GCA000622225_04346 CDS open 3489-3770 _na     93_aa hypothetical protein
7764 JHWD01000049.1 GCA000622225_04347 CDS open 3767-4405 _na     212_aa maf Nucleoside triphosphate pyrophosphatase
7765 JHWD01000049.1 GCA000622225_04348 CDS open 4528-6192 _na     554_aa nptA PhoU domain-containing protein
7766 JHWD01000049.1 GCA000622225_04349 CDS open 6409-7629 _na     406_aa Putative inner membrane protein
7767 JHWD01000049.1 GCA000622225_04343 gene open 626-814
7768 JHWD01000049.1 GCA000622225_04344 gene open 1257-2522
7769 JHWD01000049.1 GCA000622225_04345 gene open 2615-3271 metW
7770 JHWD01000049.1 GCA000622225_04346 gene open 3489-3770
7771 JHWD01000049.1 GCA000622225_04347 gene open 3767-4405 maf
7772 JHWD01000049.1 GCA000622225_04348 gene open 4528-6192 nptA
7773 JHWD01000049.1 GCA000622225_04349 gene open 6409-7629
7774 JHWD01000050.1 GCA000622225_04350 CDS open 14-1702 _na     562_aa ParB/Sulfiredoxin domain-containing protein
7775 JHWD01000050.1 GCA000622225_04351 CDS open 2462-3013 _na     183_aa hypothetical protein
7776 JHWD01000050.1 GCA000622225_04352 CDS open 3142-3402 _na     86_aa Transposase
7777 JHWD01000050.1 GCA000622225_04353 CDS open 3399-3911 _na     170_aa hypothetical protein
7778 JHWD01000050.1 GCA000622225_04354 CDS open 3908-4087 _na     59_aa hypothetical protein
7779 JHWD01000050.1 GCA000622225_04355 CDS open 4519-4998 _na     159_aa Single-stranded DNA-binding protein
7780 JHWD01000050.1 GCA000622225_04356 CDS open 5109-5378 _na     89_aa WGR domain-containing protein
7781 JHWD01000050.1 GCA000622225_04357 CDS open 5389-5631 _na     80_aa Cytosolic protein
7782 JHWD01000050.1 GCA000622225_04358 CDS open 5631-6029 _na     132_aa Cytosolic protein
7783 JHWD01000050.1 GCA000622225_04359 CDS open 6186-6392 _na     68_aa hypothetical protein
7784 JHWD01000050.1 GCA000622225_04360 CDS open 6433-7005 _na     190_aa hypothetical protein
7785 JHWD01000050.1 GCA000622225_04361 CDS open 7129-7407 _na     92_aa dnaJ Molecular chaperone DnaJ
7786 JHWD01000050.1 GCA000622225_04350 gene open 14-1702
7787 JHWD01000050.1 GCA000622225_04351 gene open 2462-3013
7788 JHWD01000050.1 GCA000622225_04352 gene open 3142-3402
7789 JHWD01000050.1 GCA000622225_04353 gene open 3399-3911
7790 JHWD01000050.1 GCA000622225_04354 gene open 3908-4087
7791 JHWD01000050.1 GCA000622225_04355 gene open 4519-4998
7792 JHWD01000050.1 GCA000622225_04356 gene open 5109-5378
7793 JHWD01000050.1 GCA000622225_04357 gene open 5389-5631
7794 JHWD01000050.1 GCA000622225_04358 gene open 5631-6029
7795 JHWD01000050.1 GCA000622225_04359 gene open 6186-6392
7796 JHWD01000050.1 GCA000622225_04360 gene open 6433-7005
7797 JHWD01000050.1 GCA000622225_04361 gene open 7129-7407 dnaJ
7798 JHWD01000051.1 regulatory_region open 2035-2120 chrB-a RNA
7799 JHWD01000051.1 GCA000622225_04362 CDS open 1204-2037 _na     277_aa Chromate resistance exported protein
7800 JHWD01000051.1 GCA000622225_04363 CDS open 2279-3457 _na     392_aa Nickel/cobalt efflux system
7801 JHWD01000051.1 GCA000622225_04364 CDS open 3468-3746 _na     92_aa Copper-sensitive operon repressor
7802 JHWD01000051.1 GCA000622225_04365 CDS open 3819-5330 _na     503_aa Spermidine synthase
7803 JHWD01000051.1 GCA000622225_04366 CDS open 5613-5765 _na     50_aa hypothetical protein
7804 JHWD01000051.1 GCA000622225_04362 gene open 1204-2037
7805 JHWD01000051.1 GCA000622225_04363 gene open 2279-3457
7806 JHWD01000051.1 GCA000622225_04364 gene open 3468-3746
7807 JHWD01000051.1 GCA000622225_04365 gene open 3819-5330
7808 JHWD01000051.1 GCA000622225_04366 gene open 5613-5765
7809 JHWD01000052.1 GCA000622225_04367 CDS open 69-557 _na     162_aa Transposase IS4-like domain-containing protein
7810 JHWD01000052.1 GCA000622225_04368 CDS open 521-865 _na     114_aa Transposase
7811 JHWD01000052.1 GCA000622225_04369 CDS open 2849-3604 _na     251_aa Putative transposase
7812 JHWD01000052.1 GCA000622225_04370 CDS open 3647-4414 _na     255_aa Transposase for insertion sequence element IS21-like C-terminal domain-containing protein
7813 JHWD01000052.1 GCA000622225_04371 CDS open 4374-5075 _na     233_aa istB IS21-like element helper ATPase IstB
7814 JHWD01000052.1 GCA000622225_04372 CDS open 5147-5635 _na     162_aa Transposase IS116/IS110/IS902 family
7815 JHWD01000052.1 GCA000622225_04373 CDS open 5625-5867 _na     80_aa Integrase catalytic domain-containing protein
7816 JHWD01000052.1 GCA000622225_04367 gene open 69-557
7817 JHWD01000052.1 GCA000622225_04368 gene open 521-865
7818 JHWD01000052.1 GCA000622225_04369 gene open 2849-3604
7819 JHWD01000052.1 GCA000622225_04370 gene open 3647-4414
7820 JHWD01000052.1 GCA000622225_04371 gene open 4374-5075 istB
7821 JHWD01000052.1 GCA000622225_04372 gene open 5147-5635
7822 JHWD01000052.1 GCA000622225_04373 gene open 5625-5867
7823 JHWD01000053.1 GCA000622225_04374 CDS open 174-1118 _na     314_aa Permease
7824 JHWD01000053.1 GCA000622225_04375 CDS open 1273-1983 _na     236_aa IS6 family transposase
7825 JHWD01000053.1 GCA000622225_04376 CDS open 2408-3568 _na     386_aa IS110 family transposase
7826 JHWD01000053.1 GCA000622225_04377 CDS open 3714-3962 _na     82_aa hypothetical protein
7827 JHWD01000053.1 GCA000622225_04378 CDS open 4116-4709 _na     197_aa CobQCobBMinDParA nucleotide binding domain protein
7828 JHWD01000053.1 GCA000622225_04379 CDS open 4706-5287 _na     193_aa DUF3102 domain-containing protein
7829 JHWD01000053.1 GCA000622225_04380 CDS open 5617-6546 _na     309_aa repA Plasmid encoded RepA protein
7830 JHWD01000053.1 GCA000622225_04374 gene open 174-1118
7831 JHWD01000053.1 GCA000622225_04375 gene open 1273-1983
7832 JHWD01000053.1 GCA000622225_04376 gene open 2408-3568
7833 JHWD01000053.1 GCA000622225_04377 gene open 3714-3962
7834 JHWD01000053.1 GCA000622225_04378 gene open 4116-4709
7835 JHWD01000053.1 GCA000622225_04379 gene open 4706-5287
7836 JHWD01000053.1 GCA000622225_04380 gene open 5617-6546 repA
7837 JHWD01000054.1 GCA000622225_04381 CDS open 224-700 _na     158_aa Transposase
7838 JHWD01000054.1 GCA000622225_04382 CDS open 1583-3148 _na     521_aa Resolvase%2C N terminal domain
7839 JHWD01000054.1 GCA000622225_04383 CDS open 3148-4038 _na     296_aa parB putative chromosome-partitioning protein parB
7840 JHWD01000054.1 GCA000622225_04384 CDS open 4041-4940 _na     299_aa Plasmid partitioning protein
7841 JHWD01000054.1 GCA000622225_04385 CDS open 5025-5957 _na     310_aa EcoKMrr
7842 JHWD01000054.1 GCA000622225_04386 CDS open 6123-6422 _na     99_aa tyrosine-type recombinase/integrase
7843 JHWD01000054.1 GCA000622225_04381 gene open 224-700
7844 JHWD01000054.1 GCA000622225_04382 gene open 1583-3148
7845 JHWD01000054.1 GCA000622225_04383 gene open 3148-4038 parB
7846 JHWD01000054.1 GCA000622225_04384 gene open 4041-4940
7847 JHWD01000054.1 GCA000622225_04385 gene open 5025-5957
7848 JHWD01000054.1 GCA000622225_04386 gene open 6123-6422
7849 JHWD01000055.1 GCA000622225_04387 CDS open 54-827 _na     257_aa traC DNA primase TraC
7850 JHWD01000055.1 GCA000622225_04388 CDS open 1065-1400 _na     111_aa GNAT family N-acetyltransferase
7851 JHWD01000055.1 GCA000622225_04389 CDS open 1411-1746 _na     111_aa hypothetical protein
7852 JHWD01000055.1 GCA000622225_04390 CDS open 1949-2731 _na     260_aa XF1762 family protein
7853 JHWD01000055.1 GCA000622225_04391 CDS open 2735-3325 _na     196_aa hypothetical protein
7854 JHWD01000055.1 GCA000622225_04392 CDS open 3400-3747 _na     115_aa hypothetical protein
7855 JHWD01000055.1 GCA000622225_04393 CDS open 3744-3917 _na     57_aa hypothetical protein
7856 JHWD01000055.1 GCA000622225_04394 CDS open 4098-5855 _na     585_aa ATP-binding protein
7857 JHWD01000055.1 GCA000622225_04387 gene open 54-827 traC
7858 JHWD01000055.1 GCA000622225_04388 gene open 1065-1400
7859 JHWD01000055.1 GCA000622225_04389 gene open 1411-1746
7860 JHWD01000055.1 GCA000622225_04390 gene open 1949-2731
7861 JHWD01000055.1 GCA000622225_04391 gene open 2735-3325
7862 JHWD01000055.1 GCA000622225_04392 gene open 3400-3747
7863 JHWD01000055.1 GCA000622225_04393 gene open 3744-3917
7864 JHWD01000055.1 GCA000622225_04394 gene open 4098-5855
7865 JHWD01000056.1 GCA000622225_04395 CDS open 525-896 _na     123_aa IS3 family transposase
7866 JHWD01000056.1 GCA000622225_04396 CDS open 893-1240 _na     115_aa tnpB IS66 family insertion sequence element accessory protein TnpB
7867 JHWD01000056.1 GCA000622225_04397 CDS open 1303-2667 _na     454_aa tnpC IS66 family transposase
7868 JHWD01000056.1 GCA000622225_04398 CDS open 2657-3205 _na     182_aa IS630 family transposase
7869 JHWD01000056.1 GCA000622225_04399 CDS open 3770-4501 _na     243_aa ISL3 family transposase
7870 JHWD01000056.1 GCA000622225_04400 CDS open 4804-5019 _na     71_aa Transposase
7871 JHWD01000056.1 GCA000622225_04401 CDS open 5178-5783 _na     201_aa marR MarR family transcriptional regulator
7872 JHWD01000056.1 GCA000622225_04395 gene open 525-896
7873 JHWD01000056.1 GCA000622225_04396 gene open 893-1240 tnpB
7874 JHWD01000056.1 GCA000622225_04397 gene open 1303-2667 tnpC
7875 JHWD01000056.1 GCA000622225_04398 gene open 2657-3205
7876 JHWD01000056.1 GCA000622225_04399 gene open 3770-4501
7877 JHWD01000056.1 GCA000622225_04400 gene open 4804-5019
7878 JHWD01000056.1 GCA000622225_04401 gene open 5178-5783 marR
7879 JHWD01000057.1 GCA000622225_04402 CDS open 62-916 _na     284_aa IS3 family transposase
7880 JHWD01000057.1 GCA000622225_04403 CDS open 913-1203 _na     96_aa Transposase
7881 JHWD01000057.1 GCA000622225_04404 CDS open 1580-3430 _na     616_aa cdaR Carbohydrate diacid transcriptional activator CdaR
7882 JHWD01000057.1 GCA000622225_04405 CDS open 3557-4870 _na     437_aa Monooxygenase
7883 JHWD01000057.1 GCA000622225_04406 CDS open 4912-5550 _na     212_aa ABC transporter substrate-binding protein
7884 JHWD01000057.1 GCA000622225_04407 CDS open 5547-5687 _na     46_aa Transposase DDE domain-containing protein
7885 JHWD01000057.1 GCA000622225_04402 gene open 62-916
7886 JHWD01000057.1 GCA000622225_04403 gene open 913-1203
7887 JHWD01000057.1 GCA000622225_04404 gene open 1580-3430 cdaR
7888 JHWD01000057.1 GCA000622225_04405 gene open 3557-4870
7889 JHWD01000057.1 GCA000622225_04406 gene open 4912-5550
7890 JHWD01000057.1 GCA000622225_04407 gene open 5547-5687
7891 JHWD01000058.1 GCA000622225_04408 CDS open 273-1010 _na     245_aa Phthalate dioxygenase reductase
7892 JHWD01000058.1 GCA000622225_04409 CDS open 1192-2256 _na     354_aa Anthranilate 1%2C2-dioxygenase large subunit
7893 JHWD01000058.1 GCA000622225_04410 CDS open 2633-4153 _na     506_aa Short-chain-fatty-acid--CoA ligase
7894 JHWD01000058.1 GCA000622225_04411 CDS open 4181-4687 _na     168_aa p-hydroxycinnamoyl CoA hydratase/lyase
7895 JHWD01000058.1 GCA000622225_04412 CDS open 4839-5030 _na     63_aa Transposase
7896 JHWD01000058.1 GCA000622225_04408 gene open 273-1010
7897 JHWD01000058.1 GCA000622225_04409 gene open 1192-2256
7898 JHWD01000058.1 GCA000622225_04410 gene open 2633-4153
7899 JHWD01000058.1 GCA000622225_04411 gene open 4181-4687
7900 JHWD01000058.1 GCA000622225_04412 gene open 4839-5030
7901 JHWD01000059.1 GCA000622225_04413 CDS open 184-1140 _na     318_aa Replication initiator protein A
7902 JHWD01000059.1 GCA000622225_04414 CDS open 2115-2477 _na     120_aa copG Ribbon-helix-helix protein CopG domain-containing protein
7903 JHWD01000059.1 GCA000622225_04415 CDS open 2495-3046 _na     183_aa PIN domain-containing protein
7904 JHWD01000059.1 GCA000622225_04416 CDS open 3290-4654 _na     454_aa AIPR protein
7905 JHWD01000059.1 GCA000622225_04413 gene open 184-1140
7906 JHWD01000059.1 GCA000622225_04414 gene open 2115-2477 copG
7907 JHWD01000059.1 GCA000622225_04415 gene open 2495-3046
7908 JHWD01000059.1 GCA000622225_04416 gene open 3290-4654
7909 JHWD01000060.1 GCA000622225_04417 CDS open 503-721 _na     72_aa hypothetical protein
7910 JHWD01000060.1 GCA000622225_04418 CDS open 722-1081 _na     119_aa mazF Type II toxin-antitoxin system PemK/MazF family toxin
7911 JHWD01000060.1 GCA000622225_04419 CDS open 1394-1654 _na     86_aa Plasmid stability protein
7912 JHWD01000060.1 GCA000622225_04420 CDS open 1651-2073 _na     140_aa vapC Ribonuclease VapC
7913 JHWD01000060.1 GCA000622225_04421 CDS open 2070-3101 _na     343_aa xerD Integrase
7914 JHWD01000060.1 GCA000622225_04422 CDS open 3117-3752 _na     211_aa DUF4130 domain-containing protein
7915 JHWD01000060.1 GCA000622225_04423 CDS open 3760-4581 _na     273_aa scpA Segregation and condensation protein A
7916 JHWD01000060.1 GCA000622225_04417 gene open 503-721
7917 JHWD01000060.1 GCA000622225_04418 gene open 722-1081 mazF
7918 JHWD01000060.1 GCA000622225_04419 gene open 1394-1654
7919 JHWD01000060.1 GCA000622225_04420 gene open 1651-2073 vapC
7920 JHWD01000060.1 GCA000622225_04421 gene open 2070-3101 xerD
7921 JHWD01000060.1 GCA000622225_04422 gene open 3117-3752
7922 JHWD01000060.1 GCA000622225_04423 gene open 3760-4581 scpA
7923 JHWD01000061.1 GCA000622225_04424 CDS open 56-1168 _na     370_aa xerD Tyrosine recombinase XerD
7924 JHWD01000061.1 GCA000622225_04425 CDS open 1230-1610 _na     126_aa putative transcriptional regulator
7925 JHWD01000061.1 GCA000622225_04426 CDS open 1607-1894 _na     95_aa tumE Toxin TumE
7926 JHWD01000061.1 GCA000622225_04427 CDS open 2165-3295 _na     376_aa HTH DNA binding domain-containing protein
7927 JHWD01000061.1 GCA000622225_04428 CDS open 3439-4488 _na     349_aa Cytosolic protein
7928 JHWD01000061.1 GCA000622225_04424 gene open 56-1168 xerD
7929 JHWD01000061.1 GCA000622225_04425 gene open 1230-1610
7930 JHWD01000061.1 GCA000622225_04426 gene open 1607-1894 tumE
7931 JHWD01000061.1 GCA000622225_04427 gene open 2165-3295
7932 JHWD01000061.1 GCA000622225_04428 gene open 3439-4488
7933 JHWD01000062.1 GCA000622225_04429 CDS open 95-523 _na     142_aa Putative efflux pump membrane fusion protein
7934 JHWD01000062.1 GCA000622225_04430 CDS open 520-3240 _na     906_aa rbbA ribosome-associated ATPase/putative transporter RbbA
7935 JHWD01000062.1 GCA000622225_04431 CDS open 3646-3807 _na     53_aa hypothetical protein
7936 JHWD01000062.1 GCA000622225_04429 gene open 95-523
7937 JHWD01000062.1 GCA000622225_04430 gene open 520-3240 rbbA
7938 JHWD01000062.1 GCA000622225_04431 gene open 3646-3807
7939 JHWD01000063.1 GCA000622225_04432 CDS open 165-1205 _na     346_aa hypothetical protein
7940 JHWD01000063.1 GCA000622225_04433 CDS open 1351-1941 _na     196_aa DNA-invertase hin
7941 JHWD01000063.1 GCA000622225_04434 CDS open 2141-2389 _na     82_aa Post-segregation antitoxin (Ccd killing mechanism protein) encoded by the F plasmid
7942 JHWD01000063.1 GCA000622225_04435 CDS open 2389-2691 _na     100_aa ccdB Toxin CcdB
7943 JHWD01000063.1 GCA000622225_04432 gene open 165-1205
7944 JHWD01000063.1 GCA000622225_04433 gene open 1351-1941
7945 JHWD01000063.1 GCA000622225_04434 gene open 2141-2389
7946 JHWD01000063.1 GCA000622225_04435 gene open 2389-2691 ccdB
7947 JHWD01000064.1 GCA000622225_04437 gene open 2541-2616 suhB
7948 JHWD01000064.1 GCA000622225_04437 ncRNA open 2541-2616 suhB Makes More Granules Regulator RNA (mmgR)
7949 JHWD01000064.1 GCA000622225_04436 CDS open 160-2538 _na     792_aa Lactate dehydrogenase
7950 JHWD01000064.1 GCA000622225_04436 gene open 160-2538
7951 JHWD01000065.1 GCA000622225_04438 CDS open 527-988 _na     153_aa Nucleotidyltransferase domain
7952 JHWD01000065.1 GCA000622225_04439 CDS open 982-1356 _na     124_aa Protein of putative function DUF86
7953 JHWD01000065.1 GCA000622225_04440 CDS open 1385-1579 _na     64_aa Prevent-host-death protein
7954 JHWD01000065.1 GCA000622225_04441 CDS open 1723-2211 _na     162_aa Helicase%2C RecD/TraA family
7955 JHWD01000065.1 GCA000622225_04438 gene open 527-988
7956 JHWD01000065.1 GCA000622225_04439 gene open 982-1356
7957 JHWD01000065.1 GCA000622225_04440 gene open 1385-1579
7958 JHWD01000065.1 GCA000622225_04441 gene open 1723-2211
7959 JHWD01000066.1 GCA000622225_04442 CDS open 127-993 _na     288_aa Plasmid replication protein
7960 JHWD01000066.1 GCA000622225_04443 CDS open 1543-1824 _na     93_aa Bifunctional SbtC-like/phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase
7961 JHWD01000066.1 GCA000622225_04444 CDS open 1821-2273 _na     150_aa putative nucleic acid-binding protein%2C contains PIN domain
7962 JHWD01000066.1 GCA000622225_04442 gene open 127-993
7963 JHWD01000066.1 GCA000622225_04443 gene open 1543-1824
7964 JHWD01000066.1 GCA000622225_04444 gene open 1821-2273
7965 JHWD01000067.1 GCA000622225_04445 gene open 1-2441 rrl
7966 JHWD01000067.1 GCA000622225_04445 rRNA open 1-2441 rrl 23S ribosomal RNA
7967 JHWD01000068.1 GCA000622225_04446 CDS open 383-736 _na     117_aa IS630 family transposase
7968 JHWD01000068.1 GCA000622225_04447 CDS open 878-1510 _na     210_aa HNH nuclease domain-containing protein
7969 JHWD01000068.1 GCA000622225_04448 CDS open 1519-2190 _na     223_aa hypothetical protein
7970 JHWD01000068.1 GCA000622225_04446 gene open 383-736
7971 JHWD01000068.1 GCA000622225_04447 gene open 878-1510
7972 JHWD01000068.1 GCA000622225_04448 gene open 1519-2190
7973 JHWD01000069.1 GCA000622225_04449 CDS open 75-506 _na     143_aa tnpA IS66-like element accessory protein TnpA
7974 JHWD01000069.1 GCA000622225_04450 CDS open 503-859 _na     118_aa tnpB IS66 family insertion sequence element accessory protein TnpB
7975 JHWD01000069.1 GCA000622225_04451 CDS open 872-2461 _na     529_aa tnpC IS66 family transposase
7976 JHWD01000069.1 GCA000622225_04449 gene open 75-506 tnpA
7977 JHWD01000069.1 GCA000622225_04450 gene open 503-859 tnpB
7978 JHWD01000069.1 GCA000622225_04451 gene open 872-2461 tnpC
7979 JHWD01000070.1 GCA000622225_04452 CDS open 178-573 _na     131_aa Transposase
7980 JHWD01000070.1 GCA000622225_04453 CDS open 1332-2351 _na     339_aa Transposase IS701-like DDE domain-containing protein
7981 JHWD01000070.1 GCA000622225_04452 gene open 178-573
7982 JHWD01000070.1 GCA000622225_04453 gene open 1332-2351
7983 JHWD01000071.1 GCA000622225_04454 gene open 1-1395 rrs
7984 JHWD01000071.1 GCA000622225_04454 rRNA open 1-1395 rrs 16S ribosomal RNA
7985 JHWD01000071.1 GCA000622225_04455 gene open 1687-1760 trnI
7986 JHWD01000071.1 GCA000622225_04456 gene open 1822-1894 trnA
7987 JHWD01000071.1 GCA000622225_04455 tRNA open 1687-1760 trnI tRNA-Ile(gat)
7988 JHWD01000071.1 GCA000622225_04456 tRNA open 1822-1894 trnA tRNA-Ala(tgc)
7989 JHWD01000072.1 GCA000622225_04457 CDS open 295-1659 _na     454_aa araJ 4-hydroxybenzoate transporter PcaK
7990 JHWD01000072.1 GCA000622225_04457 gene open 295-1659 araJ
7991 JHWD01000073.1 GCA000622225_04458 CDS open 55-357 _na     100_aa araC AraC family transcriptional regulator
7992 JHWD01000073.1 GCA000622225_04459 CDS open 506-1720 _na     404_aa 3-hydroxybenzoate 6-hydroxylase 1
7993 JHWD01000073.1 GCA000622225_04458 gene open 55-357 araC
7994 JHWD01000073.1 GCA000622225_04459 gene open 506-1720
7995 JHWD01000074.1 GCA000622225_04460 CDS open 87-467 _na     126_aa hypothetical protein
7996 JHWD01000074.1 GCA000622225_04461 CDS open 460-1323 _na     287_aa Segregation and condensation protein A
7997 JHWD01000074.1 GCA000622225_04460 gene open 87-467
7998 JHWD01000074.1 GCA000622225_04461 gene open 460-1323
7999 JHWD01000075.1 GCA000622225_04462 CDS open 187-1362 _na     391_aa tdh S-(Hydroxymethyl)glutathione dehydrogenase
8000 JHWD01000075.1 GCA000622225_04462 gene open 187-1362 tdh