HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_000691745.1)

Select a Genome:
BAKTA Annotations for GCA_000691745.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
226 2520807 2235 4 1 41
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4591 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4591 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 JAAH01000203.1 GCA000691745_02247 CDS open 11627-12607 _na     326_aa Arginase
4502 JAAH01000203.1 GCA000691745_02248 CDS open 12661-13893 _na     410_aa Nramp family divalent metal transporter
4503 JAAH01000203.1 GCA000691745_02235 gene open 5-427
4504 JAAH01000203.1 GCA000691745_02236 gene open 417-968
4505 JAAH01000203.1 GCA000691745_02237 gene open 1235-2026
4506 JAAH01000203.1 GCA000691745_02238 gene open 2035-3051
4507 JAAH01000203.1 GCA000691745_02239 gene open 3032-3817
4508 JAAH01000203.1 GCA000691745_02240 gene open 3875-5179
4509 JAAH01000203.1 GCA000691745_02241 gene open 5176-5958
4510 JAAH01000203.1 GCA000691745_02242 gene open 5989-7392
4511 JAAH01000203.1 GCA000691745_02243 gene open 7401-8165
4512 JAAH01000203.1 GCA000691745_02244 gene open 8167-9204
4513 JAAH01000203.1 GCA000691745_02245 gene open 9281-10423
4514 JAAH01000203.1 GCA000691745_02246 gene open 10722-11477 iclR
4515 JAAH01000203.1 GCA000691745_02247 gene open 11627-12607
4516 JAAH01000203.1 GCA000691745_02248 gene open 12661-13893
4517 JAAH01000204.1 GCA000691745_02249 CDS open 34-1227 _na     397_aa DUF3322 DUF2220 domains-containing protein
4518 JAAH01000204.1 GCA000691745_02250 CDS open 1202-4555 _na     1117_aa ATP-dependent exonuclease SbcCD%2C C subunit-like protein
4519 JAAH01000204.1 GCA000691745_02251 CDS open 4571-5152 _na     193_aa DUF4194 domain-containing protein
4520 JAAH01000204.1 GCA000691745_02252 CDS open 5145-6620 _na     491_aa DUF3375 domain-containing protein
4521 JAAH01000204.1 GCA000691745_02249 gene open 34-1227
4522 JAAH01000204.1 GCA000691745_02250 gene open 1202-4555
4523 JAAH01000204.1 GCA000691745_02251 gene open 4571-5152
4524 JAAH01000204.1 GCA000691745_02252 gene open 5145-6620
4525 JAAH01000208.1 GCA000691745_02253 CDS open 1245-4649 _na     1134_aa Cell surface protein
4526 JAAH01000208.1 GCA000691745_02253 gene open 1245-4649
4527 JAAH01000209.1 GCA000691745_02254 CDS open 620-1651 _na     343_aa hypothetical protein
4528 JAAH01000209.1 GCA000691745_02255 CDS open 1652-2095 _na     147_aa hypothetical protein
4529 JAAH01000209.1 GCA000691745_02256 CDS open 2108-3124 _na     338_aa hypothetical protein
4530 JAAH01000209.1 GCA000691745_02257 CDS open 3436-4038 _na     200_aa hypothetical protein
4531 JAAH01000209.1 GCA000691745_02254 gene open 620-1651
4532 JAAH01000209.1 GCA000691745_02255 gene open 1652-2095
4533 JAAH01000209.1 GCA000691745_02256 gene open 2108-3124
4534 JAAH01000209.1 GCA000691745_02257 gene open 3436-4038
4535 JAAH01000210.1 repeat_region open 139-2035 CRISPR array with 29 repeats of length 30%2C consensus sequence ATTTACATTCTACTCTAGTAATACTCTAAT and spacer length 36
4536 JAAH01000213.1 GCA000691745_02258 CDS open 60-1268 _na     402_aa hemagglutinin repeat-containing protein
4537 JAAH01000213.1 GCA000691745_02258 gene open 60-1268
4538 JAAH01000214.1 GCA000691745_02259 CDS open 136-495 _na     119_aa hypothetical protein
4539 JAAH01000214.1 GCA000691745_02260 CDS open 519-914 _na     131_aa Testis-expressed sequence 9 protein
4540 JAAH01000214.1 GCA000691745_02259 gene open 136-495
4541 JAAH01000214.1 GCA000691745_02260 gene open 519-914
4542 JAAH01000217.1 GCA000691745_02261 CDS open 137-1027 _na     296_aa B12-binding domain-containing radical SAM protein
4543 JAAH01000217.1 GCA000691745_02262 CDS open 1182-2321 _na     379_aa tnpB IS200/IS605 family element RNA-guided endonuclease TnpB
4544 JAAH01000217.1 GCA000691745_02263 CDS open 2335-2493 _na     52_aa Transposase
4545 JAAH01000217.1 GCA000691745_02261 gene open 137-1027
4546 JAAH01000217.1 GCA000691745_02262 gene open 1182-2321 tnpB
4547 JAAH01000217.1 GCA000691745_02263 gene open 2335-2493
4548 JAAH01000218.1 GCA000691745_02264 CDS open 1835-2242 _na     135_aa tnpV TnpV protein
4549 JAAH01000218.1 GCA000691745_02265 CDS open 3090-4097 _na     335_aa Nucleotidyltransferase
4550 JAAH01000218.1 GCA000691745_02266 CDS open 4090-4695 _na     201_aa Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system
4551 JAAH01000218.1 GCA000691745_02264 gene open 1835-2242 tnpV
4552 JAAH01000218.1 GCA000691745_02265 gene open 3090-4097
4553 JAAH01000218.1 GCA000691745_02266 gene open 4090-4695
4554 JAAH01000219.1 GCA000691745_02267 CDS open 101-1450 _na     449_aa glucose-6-phosphate isomerase
4555 JAAH01000219.1 GCA000691745_02268 CDS open 1473-1904 _na     143_aa S-layer-like y domain-containing protein
4556 JAAH01000219.1 GCA000691745_02267 gene open 101-1450
4557 JAAH01000219.1 GCA000691745_02268 gene open 1473-1904
4558 JAAH01000220.1 GCA000691745_02269 CDS open 271-816 _na     181_aa hypothetical protein
4559 JAAH01000220.1 GCA000691745_02270 CDS open 1256-1519 _na     87_aa hypothetical protein
4560 JAAH01000220.1 GCA000691745_02271 CDS open 1569-1964 _na     131_aa Testis-expressed sequence 9 protein
4561 JAAH01000220.1 GCA000691745_02272 CDS open 1988-2347 _na     119_aa hypothetical protein
4562 JAAH01000220.1 GCA000691745_02269 gene open 271-816
4563 JAAH01000220.1 GCA000691745_02270 gene open 1256-1519
4564 JAAH01000220.1 GCA000691745_02271 gene open 1569-1964
4565 JAAH01000220.1 GCA000691745_02272 gene open 1988-2347
4566 JAAH01000221.1 GCA000691745_02273 CDS open 5753-6301 _na     182_aa hypothetical protein
4567 JAAH01000221.1 GCA000691745_02273 gene open 5753-6301
4568 JAAH01000222.1 GCA000691745_02274 CDS open 1-1221 _na     406_aa Cas10/Cmr2 second palm domain-containing protein
4569 JAAH01000222.1 GCA000691745_02275 CDS open 1225-2118 _na     297_aa DUF6602 domain-containing protein
4570 JAAH01000222.1 GCA000691745_02276 CDS open 2224-3180 _na     318_aa RloB-like protein
4571 JAAH01000222.1 GCA000691745_02277 CDS open 3184-4569 _na     461_aa AAA domain protein
4572 JAAH01000222.1 GCA000691745_02278 CDS open 5002-6066 _na     354_aa Peptidase%2C A26 omptin family protein
4573 JAAH01000222.1 GCA000691745_02281 CDS open 6510-7808 _na     432_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
4574 JAAH01000222.1 GCA000691745_02282 CDS open 7945-9285 _na     446_aa mgtE magnesium transporter
4575 JAAH01000222.1 GCA000691745_02283 CDS open 9370-10263 _na     297_aa eamA EamA domain-containing protein
4576 JAAH01000222.1 GCA000691745_02284 CDS open 10270-10917 _na     215_aa tRNA 5-hydroxyuridine methyltransferase
4577 JAAH01000222.1 GCA000691745_02285 CDS open 10966-12141 _na     391_aa Multidrug transporter
4578 JAAH01000222.1 GCA000691745_02274 gene open 1-1221
4579 JAAH01000222.1 GCA000691745_02275 gene open 1225-2118
4580 JAAH01000222.1 GCA000691745_02276 gene open 2224-3180
4581 JAAH01000222.1 GCA000691745_02277 gene open 3184-4569
4582 JAAH01000222.1 GCA000691745_02278 gene open 5002-6066
4583 JAAH01000222.1 GCA000691745_02281 gene open 6510-7808 rsmB
4584 JAAH01000222.1 GCA000691745_02282 gene open 7945-9285 mgtE
4585 JAAH01000222.1 GCA000691745_02283 gene open 9370-10263 eamA
4586 JAAH01000222.1 GCA000691745_02284 gene open 10270-10917
4587 JAAH01000222.1 GCA000691745_02285 gene open 10966-12141
4588 JAAH01000222.1 GCA000691745_02279 gene open 6271-6360 trnS
4589 JAAH01000222.1 GCA000691745_02280 gene open 6366-6449 trnS
4590 JAAH01000222.1 GCA000691745_02279 tRNA open 6271-6360 trnS tRNA-Ser(gct)
4591 JAAH01000222.1 GCA000691745_02280 tRNA open 6366-6449 trnS tRNA-Ser(tga)