HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. oralis (GCA_000722675.1)

Select a Genome:
BAKTA Annotations for GCA_000722675.1
Genome Selected: Streptococcus oralis subsp. oralis
ContigsBases CDSrRNA tmRNAtRNA
11 1873971 1829 12 1 59
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3863 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3863 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JPGA01000005.1 GCA000722675_00302 CDS open 98725-99477 _na     250_aa ceuD ATP-binding cassette domain-containing protein
502 JPGA01000005.1 GCA000722675_00303 CDS open 99474-100430 _na     318_aa ceuC Ferric iron ABC transporter membrane-spanning permease
503 JPGA01000005.1 GCA000722675_00304 CDS open 100420-101379 _na     319_aa ceuB Iron-compound ABC transporter permease
504 JPGA01000005.1 GCA000722675_00305 CDS open 101616-102680 _na     354_aa pepA glutamyl aminopeptidase
505 JPGA01000005.1 GCA000722675_00306 CDS open 102701-102997 _na     98_aa Enterocin A Immunity
506 JPGA01000005.1 GCA000722675_00307 CDS open 103093-104724 _na     543_aa phoU PhoU domain-containing protein
507 JPGA01000005.1 GCA000722675_00308 CDS open 105307-106506 _na     399_aa pgk Phosphoglycerate kinase
508 JPGA01000005.1 GCA000722675_00309 CDS open 106644-107171 _na     175_aa ygaE Aromatic acid exporter family protein
509 JPGA01000005.1 GCA000722675_00310 CDS open 107248-107604 _na     118_aa glnR transcriptional repressor GlnR
510 JPGA01000005.1 GCA000722675_00311 CDS open 107645-108991 _na     448_aa glnA type I glutamate--ammonia ligase
511 JPGA01000005.1 GCA000722675_00312 CDS open 109103-109423 _na     106_aa padR Transcription regulator PadR N-terminal domain-containing protein
512 JPGA01000005.1 GCA000722675_00313 CDS open 109423-109998 _na     191_aa DUF2812 domain-containing protein
513 JPGA01000005.1 GCA000722675_00314 CDS open 110033-110545 _na     170_aa Phosphoglycerate kinase
514 JPGA01000005.1 GCA000722675_00315 CDS open 110706-111740 _na     344_aa hrcA heat-inducible transcriptional repressor HrcA
515 JPGA01000005.1 GCA000722675_00316 CDS open 111767-112282 _na     171_aa grpE nucleotide exchange factor GrpE
516 JPGA01000005.1 GCA000722675_00317 CDS open 112551-114374 _na     607_aa dnaK molecular chaperone DnaK
517 JPGA01000005.1 GCA000722675_00318 CDS open 114778-115914 _na     378_aa dnaJ molecular chaperone DnaJ
518 JPGA01000005.1 GCA000722675_00319 CDS open 115992-116645 _na     217_aa DUF4825 domain-containing protein
519 JPGA01000005.1 GCA000722675_00320 CDS open 116712-116990 _na     92_aa Methyl-accepting chemotaxis protein
520 JPGA01000005.1 GCA000722675_00321 CDS open 117000-117410 _na     136_aa HIT domain-containing protein
521 JPGA01000005.1 GCA000722675_00322 CDS open 117478-118209 _na     243_aa rbbA ABC transporter ATP-binding protein
522 JPGA01000005.1 GCA000722675_00323 CDS open 118206-119255 _na     349_aa ecsB Bacterial ABC transporter protein EcsB
523 JPGA01000005.1 GCA000722675_00324 CDS open 119303-120097 _na     264_aa ccrZ cell cycle regulator CcrZ
524 JPGA01000005.1 GCA000722675_00325 CDS open 120094-120729 _na     211_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
525 JPGA01000005.1 GCA000722675_00326 CDS open 120808-121335 _na     175_aa rimP ribosome maturation factor RimP
526 JPGA01000005.1 GCA000722675_00327 CDS open 121390-122514 _na     374_aa nusA Transcription termination/antitermination protein NusA
527 JPGA01000005.1 GCA000722675_00328 CDS open 122536-122829 _na     97_aa rnpM RNase P modulator RnpM
528 JPGA01000005.1 GCA000722675_00329 CDS open 122822-123121 _na     99_aa rpl7Ae YlxQ-related RNA-binding protein
529 JPGA01000005.1 GCA000722675_00330 CDS open 123138-125870 _na     910_aa infB translation initiation factor IF-2
530 JPGA01000005.1 GCA000722675_00331 CDS open 126036-126386 _na     116_aa rbfA 30S ribosome-binding factor RbfA
531 JPGA01000005.1 GCA000722675_00332 CDS open 126537-127316 _na     259_aa Valyl-tRNA synthetase
532 JPGA01000005.1 GCA000722675_00333 CDS open 127318-127500 _na     60_aa Phage protein
533 JPGA01000005.1 GCA000722675_00334 CDS open 127715-127948 _na     77_aa DUF1858 domain-containing protein
534 JPGA01000005.1 GCA000722675_00335 CDS open 127948-129282 _na     444_aa Hemerythrin HHE cation binding domain subfamily
535 JPGA01000005.1 GCA000722675_00336 CDS open 129292-129546 _na     84_aa Aldose 1-epimerase
536 JPGA01000005.1 GCA000722675_00337 CDS open 129644-130039 _na     131_aa Helicase
537 JPGA01000005.1 GCA000722675_00338 CDS open 130320-130880 _na     186_aa [ribosomal protein uS5]-alanine N-acetyltransferase
538 JPGA01000005.1 GCA000722675_00339 CDS open 130880-131458 _na     192_aa Shikimate kinase
539 JPGA01000005.1 GCA000722675_00340 CDS open 131451-134102 _na     883_aa valS valine--tRNA ligase
540 JPGA01000005.1 GCA000722675_00341 CDS open 134171-134926 _na     251_aa Protein NO VEIN C-terminal domain-containing protein
541 JPGA01000005.1 GCA000722675_00342 CDS open 135226-135801 _na     191_aa HTH tetR-type domain-containing protein
542 JPGA01000005.1 GCA000722675_00343 CDS open 135798-136478 _na     226_aa ABC transporter domain-containing protein
543 JPGA01000005.1 GCA000722675_00344 CDS open 136482-137627 _na     381_aa ABC3 transporter permease C-terminal domain-containing protein
544 JPGA01000005.1 GCA000722675_00345 CDS open 138016-138621 _na     201_aa rpoE DNA-directed RNA polymerase subunit delta
545 JPGA01000005.1 GCA000722675_00346 CDS open 138939-140546 _na     535_aa pyrG CTP synthase
546 JPGA01000005.1 GCA000722675_00347 CDS open 140665-141738 _na     357_aa pcpA Choline binding protein PcpA
547 JPGA01000005.1 GCA000722675_00348 CDS open 141971-142270 _na     99_aa DUF4651 domain-containing protein
548 JPGA01000005.1 GCA000722675_00349 CDS open 142267-142584 _na     105_aa trxA Thioredoxin domain-containing protein
549 JPGA01000005.1 GCA000722675_00350 CDS open 142600-143226 _na     208_aa ytpR YtpR family tRNA-binding protein
550 JPGA01000005.1 GCA000722675_00351 CDS open 143267-144028 _na     253_aa ydfG 3-oxoacyl-ACP reductase
551 JPGA01000005.1 GCA000722675_00352 CDS open 144106-144501 _na     131_aa ssb single-stranded DNA-binding protein
552 JPGA01000005.1 GCA000722675_00353 CDS open 144811-145095 _na     94_aa groES co-chaperone GroES
553 JPGA01000005.1 GCA000722675_00354 CDS open 145111-146733 _na     540_aa groL chaperonin GroEL
554 JPGA01000005.1 GCA000722675_00355 CDS open 146858-147625 _na     255_aa queH Epoxyqueuosine reductase QueH
555 JPGA01000005.1 GCA000722675_00356 CDS open 147695-148228 _na     177_aa ygaC Nucleoside triphosphate/diphosphate phosphatase
556 JPGA01000005.1 GCA000722675_00357 CDS open 148317-149093 _na     258_aa recX recombination regulator RecX
557 JPGA01000005.1 GCA000722675_00358 CDS open 149131-150501 _na     456_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
558 JPGA01000005.1 GCA000722675_00204 gene open 519-4910 polC
559 JPGA01000005.1 GCA000722675_00205 gene open 4930-5082 polC
560 JPGA01000005.1 GCA000722675_00206 gene open 5104-6345 pepS
561 JPGA01000005.1 GCA000722675_00207 gene open 6355-6585
562 JPGA01000005.1 GCA000722675_00208 gene open 6659-7381
563 JPGA01000005.1 GCA000722675_00209 gene open 7492-8826 pepC
564 JPGA01000005.1 GCA000722675_00210 gene open 8991-11219
565 JPGA01000005.1 GCA000722675_00211 gene open 11277-12188
566 JPGA01000005.1 GCA000722675_00212 gene open 12203-13015
567 JPGA01000005.1 GCA000722675_00213 gene open 13091-14080 agaB
568 JPGA01000005.1 GCA000722675_00214 gene open 14363-15175
569 JPGA01000005.1 GCA000722675_00215 gene open 15364-16782
570 JPGA01000005.1 GCA000722675_00216 gene open 16836-17543
571 JPGA01000005.1 GCA000722675_00217 gene open 17646-18590 folP
572 JPGA01000005.1 GCA000722675_00218 gene open 18592-19914
573 JPGA01000005.1 GCA000722675_00219 gene open 19895-20449 folE
574 JPGA01000005.1 GCA000722675_00220 gene open 20598-21419 folK
575 JPGA01000005.1 GCA000722675_00221 gene open 21412-22695
576 JPGA01000005.1 GCA000722675_00222 gene open 22746-23063
577 JPGA01000005.1 GCA000722675_00223 gene open 23270-24280 ccpA
578 JPGA01000005.1 GCA000722675_00224 gene open 24527-25489 ansA
579 JPGA01000005.1 GCA000722675_00225 gene open 25555-26940
580 JPGA01000005.1 GCA000722675_00226 gene open 26977-27429 uspA
581 JPGA01000005.1 GCA000722675_00227 gene open 27595-27894
582 JPGA01000005.1 GCA000722675_00228 gene open 28038-29252 aspB
583 JPGA01000005.1 GCA000722675_00229 gene open 29397-29531 rpmH
584 JPGA01000005.1 GCA000722675_00230 gene open 29713-31557
585 JPGA01000005.1 GCA000722675_00231 gene open 31709-32485 tatD
586 JPGA01000005.1 GCA000722675_00232 gene open 32482-33045 rnmV
587 JPGA01000005.1 GCA000722675_00233 gene open 33057-33911
588 JPGA01000005.1 GCA000722675_00234 gene open 34105-34440
589 JPGA01000005.1 GCA000722675_00235 gene open 34437-35309 rsmA
590 JPGA01000005.1 GCA000722675_00236 gene open 35311-36189 rsgA
591 JPGA01000005.1 GCA000722675_00237 gene open 36200-36856 rpe
592 JPGA01000005.1 GCA000722675_00238 gene open 36819-37481 thiN
593 JPGA01000005.1 GCA000722675_00239 gene open 37483-38739 rmuC
594 JPGA01000005.1 GCA000722675_00240 gene open 38729-39670 yhaM
595 JPGA01000005.1 GCA000722675_00241 gene open 39798-40601 purR
596 JPGA01000005.1 GCA000722675_00242 gene open 40668-41924 lysA
597 JPGA01000005.1 GCA000722675_00243 gene open 42046-42840 pflA
598 JPGA01000005.1 GCA000722675_00244 gene open 42913-43857 yidC
599 JPGA01000005.1 GCA000722675_00245 gene open 43926-44204 acyP
600 JPGA01000005.1 GCA000722675_00246 gene open 44339-44977 trmH
601 JPGA01000005.1 GCA000722675_00247 gene open 45032-45715 ybhL
602 JPGA01000005.1 GCA000722675_00248 gene open 45825-46817 asnA
603 JPGA01000005.1 GCA000722675_00249 gene open 46882-47421 rsmD
604 JPGA01000005.1 GCA000722675_00250 gene open 47411-47899 coaD
605 JPGA01000005.1 GCA000722675_00251 gene open 47883-48920 sepM
606 JPGA01000005.1 GCA000722675_00252 gene open 48976-49206
607 JPGA01000005.1 GCA000722675_00253 gene open 49230-50513 murA
608 JPGA01000005.1 GCA000722675_00254 gene open 50500-50694
609 JPGA01000005.1 GCA000722675_00255 gene open 50735-51559
610 JPGA01000005.1 GCA000722675_00256 gene open 51695-53026
611 JPGA01000005.1 GCA000722675_00258 gene open 53530-55509 amiA
612 JPGA01000005.1 GCA000722675_00259 gene open 55576-57072 amiC
613 JPGA01000005.1 GCA000722675_00260 gene open 57072-57998 oppC
614 JPGA01000005.1 GCA000722675_00261 gene open 58007-59074 amiE
615 JPGA01000005.1 GCA000722675_00262 gene open 59085-60014 amiF
616 JPGA01000005.1 GCA000722675_00263 gene open 60103-61542 trkG
617 JPGA01000005.1 GCA000722675_00264 gene open 61546-62895 trkA
618 JPGA01000005.1 GCA000722675_00265 gene open 63295-63798 trmL
619 JPGA01000005.1 GCA000722675_00266 gene open 64210-64773 fmnP
620 JPGA01000005.1 GCA000722675_00267 gene open 64787-65413 bcrC
621 JPGA01000005.1 GCA000722675_00268 gene open 65687-66733 pheS
622 JPGA01000005.1 GCA000722675_00269 gene open 66852-69257 pheT
623 JPGA01000005.1 GCA000722675_00270 gene open 69507-70400 yhaQ
624 JPGA01000005.1 GCA000722675_00271 gene open 70466-71596
625 JPGA01000005.1 GCA000722675_00272 gene open 71807-72253 rplM
626 JPGA01000005.1 GCA000722675_00273 gene open 72272-72664 rpsI
627 JPGA01000005.1 GCA000722675_00274 gene open 73048-74013
628 JPGA01000005.1 GCA000722675_00275 gene open 74218-74904
629 JPGA01000005.1 GCA000722675_00276 gene open 74908-76323
630 JPGA01000005.1 GCA000722675_00277 gene open 76320-76682
631 JPGA01000005.1 GCA000722675_00278 gene open 76675-76983
632 JPGA01000005.1 GCA000722675_00279 gene open 77006-77482
633 JPGA01000005.1 GCA000722675_00280 gene open 77479-78057
634 JPGA01000005.1 GCA000722675_00281 gene open 78070-78411
635 JPGA01000005.1 GCA000722675_00282 gene open 78422-78964
636 JPGA01000005.1 GCA000722675_00283 gene open 78980-79174 xRE
637 JPGA01000005.1 GCA000722675_00284 gene open 79337-80287 rsmH
638 JPGA01000005.1 GCA000722675_00285 gene open 80298-80615 ftsL
639 JPGA01000005.1 GCA000722675_00286 gene open 80619-82874 pbp2X
640 JPGA01000005.1 GCA000722675_00287 gene open 82876-83856 mraY
641 JPGA01000005.1 GCA000722675_00288 gene open 83991-86495
642 JPGA01000005.1 GCA000722675_00289 gene open 86758-87471 treR
643 JPGA01000005.1 GCA000722675_00290 gene open 87656-89623 treB
644 JPGA01000005.1 GCA000722675_00291 gene open 89687-91312 treC
645 JPGA01000005.1 GCA000722675_00292 gene open 91457-91702 yneF
646 JPGA01000005.1 GCA000722675_00293 gene open 91908-92702 racE
647 JPGA01000005.1 GCA000722675_00294 gene open 92699-93670
648 JPGA01000005.1 GCA000722675_00295 gene open 93646-94167 yfcE
649 JPGA01000005.1 GCA000722675_00296 gene open 94164-94625 cbpB
650 JPGA01000005.1 GCA000722675_00297 gene open 94616-95356 xerD
651 JPGA01000005.1 GCA000722675_00298 gene open 95356-96084 scpA
652 JPGA01000005.1 GCA000722675_00299 gene open 96103-96672 scpB
653 JPGA01000005.1 GCA000722675_00300 gene open 96659-97381 rsuA
654 JPGA01000005.1 GCA000722675_00301 gene open 97655-98626 ceuA
655 JPGA01000005.1 GCA000722675_00302 gene open 98725-99477 ceuD
656 JPGA01000005.1 GCA000722675_00303 gene open 99474-100430 ceuC
657 JPGA01000005.1 GCA000722675_00304 gene open 100420-101379 ceuB
658 JPGA01000005.1 GCA000722675_00305 gene open 101616-102680 pepA
659 JPGA01000005.1 GCA000722675_00306 gene open 102701-102997
660 JPGA01000005.1 GCA000722675_00307 gene open 103093-104724 phoU
661 JPGA01000005.1 GCA000722675_00308 gene open 105307-106506 pgk
662 JPGA01000005.1 GCA000722675_00309 gene open 106644-107171 ygaE
663 JPGA01000005.1 GCA000722675_00310 gene open 107248-107604 glnR
664 JPGA01000005.1 GCA000722675_00311 gene open 107645-108991 glnA
665 JPGA01000005.1 GCA000722675_00312 gene open 109103-109423 padR
666 JPGA01000005.1 GCA000722675_00313 gene open 109423-109998
667 JPGA01000005.1 GCA000722675_00314 gene open 110033-110545
668 JPGA01000005.1 GCA000722675_00315 gene open 110706-111740 hrcA
669 JPGA01000005.1 GCA000722675_00316 gene open 111767-112282 grpE
670 JPGA01000005.1 GCA000722675_00317 gene open 112551-114374 dnaK
671 JPGA01000005.1 GCA000722675_00318 gene open 114778-115914 dnaJ
672 JPGA01000005.1 GCA000722675_00319 gene open 115992-116645
673 JPGA01000005.1 GCA000722675_00320 gene open 116712-116990
674 JPGA01000005.1 GCA000722675_00321 gene open 117000-117410
675 JPGA01000005.1 GCA000722675_00322 gene open 117478-118209 rbbA
676 JPGA01000005.1 GCA000722675_00323 gene open 118206-119255 ecsB
677 JPGA01000005.1 GCA000722675_00324 gene open 119303-120097 ccrZ
678 JPGA01000005.1 GCA000722675_00325 gene open 120094-120729 trmB
679 JPGA01000005.1 GCA000722675_00326 gene open 120808-121335 rimP
680 JPGA01000005.1 GCA000722675_00327 gene open 121390-122514 nusA
681 JPGA01000005.1 GCA000722675_00328 gene open 122536-122829 rnpM
682 JPGA01000005.1 GCA000722675_00329 gene open 122822-123121 rpl7Ae
683 JPGA01000005.1 GCA000722675_00330 gene open 123138-125870 infB
684 JPGA01000005.1 GCA000722675_00331 gene open 126036-126386 rbfA
685 JPGA01000005.1 GCA000722675_00332 gene open 126537-127316
686 JPGA01000005.1 GCA000722675_00333 gene open 127318-127500
687 JPGA01000005.1 GCA000722675_00334 gene open 127715-127948
688 JPGA01000005.1 GCA000722675_00335 gene open 127948-129282
689 JPGA01000005.1 GCA000722675_00336 gene open 129292-129546
690 JPGA01000005.1 GCA000722675_00337 gene open 129644-130039
691 JPGA01000005.1 GCA000722675_00338 gene open 130320-130880
692 JPGA01000005.1 GCA000722675_00339 gene open 130880-131458
693 JPGA01000005.1 GCA000722675_00340 gene open 131451-134102 valS
694 JPGA01000005.1 GCA000722675_00341 gene open 134171-134926
695 JPGA01000005.1 GCA000722675_00342 gene open 135226-135801
696 JPGA01000005.1 GCA000722675_00343 gene open 135798-136478
697 JPGA01000005.1 GCA000722675_00344 gene open 136482-137627
698 JPGA01000005.1 GCA000722675_00345 gene open 138016-138621 rpoE
699 JPGA01000005.1 GCA000722675_00346 gene open 138939-140546 pyrG
700 JPGA01000005.1 GCA000722675_00347 gene open 140665-141738 pcpA
701 JPGA01000005.1 GCA000722675_00348 gene open 141971-142270
702 JPGA01000005.1 GCA000722675_00349 gene open 142267-142584 trxA
703 JPGA01000005.1 GCA000722675_00350 gene open 142600-143226 ytpR
704 JPGA01000005.1 GCA000722675_00351 gene open 143267-144028 ydfG
705 JPGA01000005.1 GCA000722675_00352 gene open 144106-144501 ssb
706 JPGA01000005.1 GCA000722675_00353 gene open 144811-145095 groES
707 JPGA01000005.1 GCA000722675_00354 gene open 145111-146733 groL
708 JPGA01000005.1 GCA000722675_00355 gene open 146858-147625 queH
709 JPGA01000005.1 GCA000722675_00356 gene open 147695-148228 ygaC
710 JPGA01000005.1 GCA000722675_00357 gene open 148317-149093 recX
711 JPGA01000005.1 GCA000722675_00358 gene open 149131-150501 rlmD
712 JPGA01000005.1 GCA000722675_00200 gene open 5-76 trnG
713 JPGA01000005.1 GCA000722675_00201 gene open 84-169 trnL
714 JPGA01000005.1 GCA000722675_00202 gene open 181-254 trnR
715 JPGA01000005.1 GCA000722675_00203 gene open 270-343 trnP
716 JPGA01000005.1 GCA000722675_00257 gene open 53160-53230 trnC
717 JPGA01000005.1 GCA000722675_00359 gene open 150560-150631 trnE
718 JPGA01000005.1 GCA000722675_00361 gene open 152458-152530 trnA
719 JPGA01000005.1 GCA000722675_00200 tRNA open 5-76 trnG tRNA-Gly(gcc)
720 JPGA01000005.1 GCA000722675_00201 tRNA open 84-169 trnL tRNA-Leu(taa)
721 JPGA01000005.1 GCA000722675_00202 tRNA open 181-254 trnR tRNA-Arg(acg)
722 JPGA01000005.1 GCA000722675_00203 tRNA open 270-343 trnP tRNA-Pro(tgg)
723 JPGA01000005.1 GCA000722675_00257 tRNA open 53160-53230 trnC tRNA-Cys(gca)
724 JPGA01000005.1 GCA000722675_00359 tRNA open 150560-150631 trnE tRNA-Glu(ttc)
725 JPGA01000005.1 GCA000722675_00361 tRNA open 152458-152530 trnA tRNA-Ala(tgc)
726 JPGA01000006.1 GCA000722675_01157 gene open 763368-763712 ssrA
727 JPGA01000006.1 GCA000722675_01157 tmRNA open 763368-763712 ssrA transfer-messenger RNA%2C SsrA
728 JPGA01000006.1 GCA000722675_00552 gene open 192558-192708 rli38
729 JPGA01000006.1 GCA000722675_00917 gene open 530327-530469 asd
730 JPGA01000006.1 GCA000722675_01133 gene open 740312-740408 SpF43_sRNA
731 JPGA01000006.1 GCA000722675_01138 gene open 744638-744733 SpF44_sRNA
732 JPGA01000006.1 GCA000722675_01183 gene open 784378-784499 SpR19_sRNA
733 JPGA01000006.1 GCA000722675_01446 gene open 1045015-1045130 rrf
734 JPGA01000006.1 GCA000722675_01447 gene open 1045207-1047836 rrl
735 JPGA01000006.1 GCA000722675_00552 ncRNA open 192558-192708 Listeria sRNA rli38
736 JPGA01000006.1 GCA000722675_00917 ncRNA open 530327-530469 MarS sRNA
737 JPGA01000006.1 GCA000722675_01133 ncRNA open 740312-740408 Streptococcus sRNA SpF43
738 JPGA01000006.1 GCA000722675_01138 ncRNA open 744638-744733 Streptococcus sRNA SpF44
739 JPGA01000006.1 GCA000722675_01183 ncRNA open 784378-784499 Streptococcus sRNA SpR19
740 JPGA01000006.1 regulatory_region open 48757-48861 PyrR binding site
741 JPGA01000006.1 regulatory_region open 54774-54862 TPP riboswitch aptamer (THI element)
742 JPGA01000006.1 regulatory_region open 61207-61305 TPP riboswitch aptamer (THI element)
743 JPGA01000006.1 regulatory_region open 191455-191590 Ribosomal protein L10 leader
744 JPGA01000006.1 regulatory_region open 243150-243212 pemK RNA
745 JPGA01000006.1 regulatory_region open 531249-531345 PreQ1-II (pre queuosine) riboswitch aptamer
746 JPGA01000006.1 regulatory_region open 636694-636910 T-box leader
747 JPGA01000006.1 regulatory_region open 686345-686476 Ribosomal protein L20 leader
748 JPGA01000006.1 regulatory_region open 708988-709075 Ribosomal protein L21 leader
749 JPGA01000006.1 regulatory_region open 738383-738515 PyrR binding site
750 JPGA01000006.1 regulatory_region open 1004076-1004306 T-box leader
751 JPGA01000006.1 regulatory_region open 1014139-1014234 Purine riboswitch aptamer
752 JPGA01000006.1 GCA000722675_01446 rRNA open 1045015-1045130 rrf 5S ribosomal RNA
753 JPGA01000006.1 GCA000722675_01447 rRNA open 1045207-1047836 rrl 23S ribosomal RNA
754 JPGA01000006.1 repeat_region open 894131-894373 CRISPR array with 4 repeats of length 38%2C consensus sequence GGTTTTTGTAGTCTCCAAAATTATGACCGATAAAACCT and spacer length 27
755 JPGA01000006.1 GCA000722675_00362 CDS open 53-604 _na     183_aa DUF1307 domain-containing protein
756 JPGA01000006.1 GCA000722675_00363 CDS open 923-1474 _na     183_aa DUF1307 domain-containing protein
757 JPGA01000006.1 GCA000722675_00364 CDS open 1614-2651 _na     345_aa frvX Deblocking aminopeptidase
758 JPGA01000006.1 GCA000722675_00365 CDS open 2653-3114 _na     153_aa HIT domain-containing protein
759 JPGA01000006.1 GCA000722675_00366 CDS open 3158-3844 _na     228_aa ldcB LD-carboxypeptidase LdcB/DacB
760 JPGA01000006.1 GCA000722675_00367 CDS open 3967-4392 _na     141_aa Large ribosomal subunit protein uL11
761 JPGA01000006.1 GCA000722675_00368 CDS open 4490-5179 _na     229_aa rplA 50S ribosomal protein L1
762 JPGA01000006.1 GCA000722675_00369 CDS open 5663-6421 _na     252_aa ubiE Demethylrebeccamycin-D-glucose O-methyltransferase
763 JPGA01000006.1 GCA000722675_00370 CDS open 6508-7020 _na     170_aa apt adenine phosphoribosyltransferase
764 JPGA01000006.1 GCA000722675_00371 CDS open 7207-8151 _na     314_aa metA homoserine O-succinyltransferase
765 JPGA01000006.1 GCA000722675_00372 CDS open 8160-8837 _na     225_aa dnaD DnaD domain protein
766 JPGA01000006.1 GCA000722675_00373 CDS open 8934-9692 _na     252_aa tpiA triose-phosphate isomerase
767 JPGA01000006.1 GCA000722675_00374 CDS open 9884-10402 _na     172_aa DNA protection during starvation protein
768 JPGA01000006.1 GCA000722675_00375 CDS open 10614-10952 _na     112_aa phnA Alkylphosphonate utilization operon protein PhnA
769 JPGA01000006.1 GCA000722675_00376 CDS open 10955-11578 _na     207_aa Pr6Pr family membrane protein
770 JPGA01000006.1 GCA000722675_00377 CDS open 11691-12842 _na     383_aa Transporter%2C major facilitator family protein
771 JPGA01000006.1 GCA000722675_00378 CDS open 12942-13691 _na     249_aa truA tRNA pseudouridine(38-40) synthase TruA
772 JPGA01000006.1 GCA000722675_00379 CDS open 13681-14454 _na     257_aa thiD bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
773 JPGA01000006.1 GCA000722675_00380 CDS open 14432-14893 _na     153_aa hmpT Thiamine transporter HmpT
774 JPGA01000006.1 GCA000722675_00381 CDS open 14936-16018 _na     360_aa pepP Proline dipeptidase
775 JPGA01000006.1 GCA000722675_00382 CDS open 16146-16928 _na     260_aa gatD lipid II isoglutaminyl synthase subunit GatD
776 JPGA01000006.1 GCA000722675_00383 CDS open 16928-18271 _na     447_aa murT lipid II isoglutaminyl synthase subunit MurT
777 JPGA01000006.1 GCA000722675_00384 CDS open 18524-19840 _na     438_aa lpd FAD-containing oxidoreductase
778 JPGA01000006.1 GCA000722675_00385 CDS open 20190-21767 _na     525_aa cshA DEAD-box ATP-dependent RNA helicase CshA
779 JPGA01000006.1 GCA000722675_00386 CDS open 22051-22839 _na     262_aa codY GTP-sensing pleiotropic transcriptional regulator CodY
780 JPGA01000006.1 GCA000722675_00387 CDS open 22839-23414 _na     191_aa Isochorismatase
781 JPGA01000006.1 GCA000722675_00389 CDS open 23975-25252 _na     425_aa lolE Macrolide export ATP-binding/permease protein MacB
782 JPGA01000006.1 GCA000722675_00390 CDS open 25265-25912 _na     215_aa lolD ABC transporter ATP-binding subunit Vex2
783 JPGA01000006.1 GCA000722675_00391 CDS open 25963-27342 _na     459_aa lolE ABC transporter permease subunit Vex3
784 JPGA01000006.1 GCA000722675_00392 CDS open 27592-28248 _na     218_aa vncR response regulator transcription factor VncR
785 JPGA01000006.1 GCA000722675_00393 CDS open 28245-29573 _na     442_aa vncS sensor histidine kinase VncS
786 JPGA01000006.1 GCA000722675_00394 CDS open 29713-30594 _na     293_aa fba class II fructose-bisphosphate aldolase
787 JPGA01000006.1 GCA000722675_00395 CDS open 30723-31655 _na     310_aa AB hydrolase-1 domain-containing protein
788 JPGA01000006.1 GCA000722675_00396 CDS open 31713-32258 _na     181_aa Phosphoglycerate mutase
789 JPGA01000006.1 GCA000722675_00397 CDS open 32578-33570 _na     330_aa ATP-binding cassette domain-containing protein
790 JPGA01000006.1 GCA000722675_00398 CDS open 33572-34390 _na     272_aa Antibiotic ABC transporter permease
791 JPGA01000006.1 GCA000722675_00399 CDS open 34392-35177 _na     261_aa Multidrug ABC transporter permease
792 JPGA01000006.1 GCA000722675_00401 CDS open 35646-36545 _na     299_aa DUF6287 domain-containing protein
793 JPGA01000006.1 GCA000722675_00402 CDS open 36772-37086 _na     104_aa Tat pathway signal sequence domain protein
794 JPGA01000006.1 GCA000722675_00403 CDS open 37246-37956 _na     236_aa IgA FC receptor
795 JPGA01000006.1 GCA000722675_00404 CDS open 38137-39951 _na     604_aa N-acetylmuramoyl-L-alanine amidase
796 JPGA01000006.1 GCA000722675_00405 CDS open 40006-40914 _na     302_aa lysR HTH lysR-type domain-containing protein
797 JPGA01000006.1 GCA000722675_00406 CDS open 41017-41250 _na     77_aa DUF910 domain-containing protein
798 JPGA01000006.1 GCA000722675_00407 CDS open 41247-41627 _na     126_aa moeZ Putative adenylyltransferase/sulfurtransferase MoeZ
799 JPGA01000006.1 GCA000722675_00408 CDS open 41965-42690 _na     241_aa Pseudouridine synthase
800 JPGA01000006.1 GCA000722675_00409 CDS open 42849-44690 _na     613_aa typA translational GTPase TypA
801 JPGA01000006.1 GCA000722675_00410 CDS open 44710-44964 _na     84_aa Monovalent cation/H+ antiporter subunit F domain protein
802 JPGA01000006.1 GCA000722675_00411 CDS open 45082-46434 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
803 JPGA01000006.1 GCA000722675_00412 CDS open 46436-47494 _na     352_aa murG UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
804 JPGA01000006.1 GCA000722675_00413 CDS open 47504-48667 _na     387_aa Cell division protein DivIB
805 JPGA01000006.1 GCA000722675_00414 CDS open 48896-49597 _na     233_aa pyrF orotidine-5'-phosphate decarboxylase
806 JPGA01000006.1 GCA000722675_00415 CDS open 49631-50263 _na     210_aa Orotate phosphoribosyltransferase
807 JPGA01000006.1 GCA000722675_00416 CDS open 50326-51192 _na     288_aa Amino acid ABC transporter%2C amino acid-binding protein
808 JPGA01000006.1 GCA000722675_00417 CDS open 51204-51962 _na     252_aa glnQ Amino acid ABC transporter ATP-binding protein
809 JPGA01000006.1 GCA000722675_00418 CDS open 51963-52640 _na     225_aa hisM ABC transporter membrane-spanning permease-glutamine transport
810 JPGA01000006.1 GCA000722675_00419 CDS open 52600-53280 _na     226_aa hisM ABC transporter permease subunit
811 JPGA01000006.1 GCA000722675_00420 CDS open 53490-54626 _na     378_aa lctO L-lactate oxidase
812 JPGA01000006.1 GCA000722675_00421 CDS open 55021-55581 _na     186_aa ykoE Cobalt ABC transporter permease
813 JPGA01000006.1 GCA000722675_00422 CDS open 55582-56967 _na     461_aa ccmA heme ABC exporter ATP-binding protein CcmA
814 JPGA01000006.1 GCA000722675_00423 CDS open 56969-57619 _na     216_aa Cobalt ABC transporter domain-containing protein
815 JPGA01000006.1 GCA000722675_00424 CDS open 57630-58310 _na     226_aa tenA thiaminase II
816 JPGA01000006.1 GCA000722675_00425 CDS open 58326-58850 _na     174_aa thiW energy coupling factor transporter S component ThiW
817 JPGA01000006.1 GCA000722675_00426 CDS open 58850-59653 _na     267_aa Hydroxyethylthiazole kinase
818 JPGA01000006.1 GCA000722675_00427 CDS open 59646-60278 _na     210_aa thiE2 Thiamine-phosphate synthase 2
819 JPGA01000006.1 GCA000722675_00428 CDS open 60331-61122 _na     263_aa thiD Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase
820 JPGA01000006.1 GCA000722675_00429 CDS open 61489-61884 _na     131_aa copY CopY/TcrY family copper transport repressor
821 JPGA01000006.1 GCA000722675_00430 CDS open 61895-62266 _na     123_aa Copper transporter P-type ATPase
822 JPGA01000006.1 GCA000722675_00431 CDS open 62276-64498 _na     740_aa P-type Cu(+) transporter
823 JPGA01000006.1 GCA000722675_00432 CDS open 64711-66486 _na     591_aa spxB pyruvate oxidase
824 JPGA01000006.1 GCA000722675_00433 CDS open 66596-66943 _na     115_aa VOC domain-containing protein
825 JPGA01000006.1 GCA000722675_00434 CDS open 67161-67421 _na     86_aa MtN3/saliva family protein
826 JPGA01000006.1 GCA000722675_00435 CDS open 67552-68991 _na     479_aa 6-phospho-beta-glucosidase
827 JPGA01000006.1 GCA000722675_00436 CDS open 69112-70056 _na     314_aa manA mannose-6-phosphate isomerase%2C class I
828 JPGA01000006.1 GCA000722675_00437 CDS open 70097-71437 _na     446_aa Transporter
829 JPGA01000006.1 GCA000722675_00439 CDS open 71804-72544 _na     246_aa HTH merR-type domain-containing protein
830 JPGA01000006.1 GCA000722675_00440 CDS open 72573-73028 _na     151_aa yjhB 8-oxo-dGTP diphosphatase
831 JPGA01000006.1 GCA000722675_00441 CDS open 73039-73560 _na     173_aa DUF1697 domain-containing protein
832 JPGA01000006.1 GCA000722675_00442 CDS open 73574-74794 _na     406_aa yhiN BaiN-like insert domain-containing protein
833 JPGA01000006.1 GCA000722675_00443 CDS open 74813-75658 _na     281_aa degV EDD domain protein%2C DegV family
834 JPGA01000006.1 GCA000722675_00444 CDS open 75783-76340 _na     185_aa acrR HTH tetR-type domain-containing protein
835 JPGA01000006.1 GCA000722675_00445 CDS open 76359-76826 _na     155_aa comEB Cytidine and deoxycytidylate deaminase zinc-binding region family protein
836 JPGA01000006.1 GCA000722675_00446 CDS open 76915-77544 _na     209_aa upp uracil phosphoribosyltransferase
837 JPGA01000006.1 GCA000722675_00447 CDS open 77718-78308 _na     196_aa clpP ATP-dependent Clp protease proteolytic subunit ClpP
838 JPGA01000006.1 GCA000722675_00448 CDS open 78387-78656 _na     89_aa UPF0298 protein HMPREF9184_01783
839 JPGA01000006.1 GCA000722675_00449 CDS open 78745-79905 _na     386_aa livK Branched chain amino acid ABC transporter substrate+B481-binding protein
840 JPGA01000006.1 GCA000722675_00450 CDS open 80025-80894 _na     289_aa livH ABC transporter membrane-spanning permease-branched chain amino acid transport
841 JPGA01000006.1 GCA000722675_00451 CDS open 80898-81854 _na     318_aa livM ABC transporter membrane-spanning permease-branched chain amino acid transport
842 JPGA01000006.1 GCA000722675_00452 CDS open 81854-82618 _na     254_aa livG ATP-binding cassette domain-containing protein
843 JPGA01000006.1 GCA000722675_00453 CDS open 82618-83328 _na     236_aa livF ABC transporter%2C ATP-binding protein
844 JPGA01000006.1 GCA000722675_00454 CDS open 83795-84451 _na     218_aa cBS Inosine-5'-monophosphate dehydrogenase
845 JPGA01000006.1 GCA000722675_00456 CDS open 84680-85657 _na     325_aa prfB peptide chain release factor 2
846 JPGA01000006.1 GCA000722675_00457 CDS open 85675-86367 _na     230_aa ftsE cell division ATP-binding protein FtsE
847 JPGA01000006.1 GCA000722675_00458 CDS open 86360-87286 _na     308_aa ftsX permease-like cell division protein FtsX
848 JPGA01000006.1 GCA000722675_00459 CDS open 87506-89689 _na     727_aa PTS system IIBC component
849 JPGA01000006.1 GCA000722675_00460 CDS open 89741-90556 _na     271_aa Endonuclease/exonuclease/phosphatase family protein
850 JPGA01000006.1 GCA000722675_00461 CDS open 90688-92031 _na     447_aa srmB DEAD-box ATP-dependent RNA helicase CshB
851 JPGA01000006.1 GCA000722675_00462 CDS open 92228-93418 _na     396_aa metK methionine adenosyltransferase
852 JPGA01000006.1 GCA000722675_00463 CDS open 93489-93788 _na     99_aa Ribose-5-phosphate isomerase A
853 JPGA01000006.1 GCA000722675_00464 CDS open 93847-94299 _na     150_aa Nudix hydrolase domain-containing protein
854 JPGA01000006.1 GCA000722675_00465 CDS open 94431-96689 _na     752_aa clpE ATP-dependent Clp protease ATP-binding subunit ClpE
855 JPGA01000006.1 GCA000722675_00466 CDS open 96927-97157 _na     76_aa Cytoplasmic protein
856 JPGA01000006.1 GCA000722675_00467 CDS open 97349-98032 _na     227_aa hisM ABC transporter membrane-spanning permease-glutamine transport
857 JPGA01000006.1 GCA000722675_00468 CDS open 98032-98766 _na     244_aa glnQ Glutamine transport ATP-binding protein GlnQ
858 JPGA01000006.1 GCA000722675_00469 CDS open 98800-99120 _na     106_aa tfoX TfoX N-terminal domain-containing protein
859 JPGA01000006.1 GCA000722675_00470 CDS open 99269-100126 _na     285_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
860 JPGA01000006.1 GCA000722675_00471 CDS open 100131-100904 _na     257_aa HMP-PP phosphatase
861 JPGA01000006.1 GCA000722675_00472 CDS open 100962-101813 _na     283_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
862 JPGA01000006.1 GCA000722675_00473 CDS open 102010-104502 _na     830_aa dnaQ bifunctional DnaQ family exonuclease/ATP-dependent helicase
863 JPGA01000006.1 GCA000722675_00474 CDS open 104508-105731 _na     407_aa ftsW Rod shape determining protein
864 JPGA01000006.1 GCA000722675_00475 CDS open 105742-106296 _na     184_aa DJ-1 family glyoxalase III
865 JPGA01000006.1 GCA000722675_00476 CDS open 106372-106944 _na     190_aa Phosphoglycolate phosphatase
866 JPGA01000006.1 GCA000722675_00477 CDS open 106958-108904 _na     648_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
867 JPGA01000006.1 GCA000722675_00478 CDS open 108985-110712 _na     575_aa ezrA septation ring formation regulator EzrA
868 JPGA01000006.1 GCA000722675_00479 CDS open 110787-111200 _na     137_aa Integrase
869 JPGA01000006.1 GCA000722675_00480 CDS open 112088-115729 _na     1213_aa Alcohol dehydrogenase
870 JPGA01000006.1 GCA000722675_00481 CDS open 115936-116676 _na     246_aa Demethylrebeccamycin-D-glucose O-methyltransferase
871 JPGA01000006.1 GCA000722675_00482 CDS open 116758-117117 _na     119_aa Integral membrane protein
872 JPGA01000006.1 GCA000722675_00483 CDS open 117209-118165 _na     318_aa TIGR01212 family radical SAM protein
873 JPGA01000006.1 GCA000722675_00484 CDS open 118149-118706 _na     185_aa 16S rRNA (Cytosine(1402)-N(4))-methyltransferase
874 JPGA01000006.1 GCA000722675_00485 CDS open 118699-118953 _na     84_aa Phage protein
875 JPGA01000006.1 GCA000722675_00486 CDS open 118965-121019 _na     684_aa Sodium/hydrogen exchanger family protein
876 JPGA01000006.1 GCA000722675_00487 CDS open 121049-121909 _na     286_aa yihY YihY family protein
877 JPGA01000006.1 GCA000722675_00488 CDS open 121949-122977 _na     342_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
878 JPGA01000006.1 GCA000722675_00489 CDS open 123123-123830 _na     235_aa nagB Glucosamine-6-phosphate deaminase
879 JPGA01000006.1 GCA000722675_00490 CDS open 124051-130824 _na     2257_aa YSIRK type signal peptide
880 JPGA01000006.1 GCA000722675_00491 CDS open 131139-131654 _na     171_aa Methyltransferase
881 JPGA01000006.1 GCA000722675_00492 CDS open 131668-132291 _na     207_aa Peptidase family S51
882 JPGA01000006.1 GCA000722675_00493 CDS open 132448-132624 _na     58_aa rpsU 30S ribosomal protein S21
883 JPGA01000006.1 GCA000722675_00494 CDS open 132689-133651 _na     320_aa hypothetical protein
884 JPGA01000006.1 GCA000722675_00495 CDS open 133789-134724 _na     311_aa hprK HPr(Ser) kinase/phosphatase
885 JPGA01000006.1 GCA000722675_00496 CDS open 134717-135505 _na     262_aa lgt prolipoprotein diacylglyceryl transferase
886 JPGA01000006.1 GCA000722675_00497 CDS open 135506-135889 _na     127_aa Methyl-accepting chemotaxis family domain protein
887 JPGA01000006.1 GCA000722675_00498 CDS open 135905-136303 _na     132_aa Late embryogeneis abundant protein
888 JPGA01000006.1 GCA000722675_00499 CDS open 136377-137507 _na     376_aa hemW radical SAM family heme chaperone HemW
889 JPGA01000006.1 GCA000722675_00500 CDS open 137512-138249 _na     245_aa Acyl-ACP thioesterase%2C putative
890 JPGA01000006.1 GCA000722675_00501 CDS open 138260-139033 _na     257_aa nagD Acid sugar phosphatase
891 JPGA01000006.1 GCA000722675_00502 CDS open 139023-139643 _na     206_aa TIGR01906 family membrane protein
892 JPGA01000006.1 GCA000722675_00503 CDS open 139861-140262 _na     133_aa spx Global transcriptional regulator Spx
893 JPGA01000006.1 GCA000722675_00504 CDS open 140263-140541 _na     92_aa yktA UPF0223 protein SPH_1535
894 JPGA01000006.1 GCA000722675_00505 CDS open 140531-141304 _na     257_aa Inositol monophosphatase family protein
895 JPGA01000006.1 GCA000722675_00506 CDS open 141305-142609 _na     434_aa Ribosomal RNA small subunit methyltransferase F
896 JPGA01000006.1 GCA000722675_00507 CDS open 142820-143698 _na     292_aa Phosphate-binding protein
897 JPGA01000006.1 GCA000722675_00508 CDS open 143698-144615 _na     305_aa pstC phosphate ABC transporter permease subunit PstC
898 JPGA01000006.1 GCA000722675_00509 CDS open 144605-145489 _na     294_aa pstA phosphate ABC transporter permease PstA
899 JPGA01000006.1 GCA000722675_00510 CDS open 145500-146303 _na     267_aa pstB phosphate ABC transporter ATP-binding protein PstB
900 JPGA01000006.1 GCA000722675_00511 CDS open 146316-147074 _na     252_aa pstB phosphate ABC transporter ATP-binding protein PstB
901 JPGA01000006.1 GCA000722675_00512 CDS open 147086-147739 _na     217_aa phoU phosphate signaling complex protein PhoU
902 JPGA01000006.1 GCA000722675_00513 CDS open 147828-148295 _na     155_aa Nudix hydrolase domain-containing protein
903 JPGA01000006.1 GCA000722675_00514 CDS open 148414-149229 _na     271_aa Solute-binding protein family 3/N-terminal domain-containing protein
904 JPGA01000006.1 GCA000722675_00515 CDS open 149249-150520 _na     423_aa gntR Transcriptional regulator%2C GntR family
905 JPGA01000006.1 GCA000722675_00516 CDS open 150665-151396 _na     243_aa budA acetolactate decarboxylase
906 JPGA01000006.1 GCA000722675_00517 CDS open 151406-152158 _na     250_aa Membrane peptidase
907 JPGA01000006.1 GCA000722675_00518 CDS open 152270-153175 _na     301_aa murB UDP-N-acetylmuramate dehydrogenase
908 JPGA01000006.1 GCA000722675_00519 CDS open 153315-154472 _na     385_aa potA Spermidine/putrescine import ATP-binding protein PotA
909 JPGA01000006.1 GCA000722675_00520 CDS open 154453-155259 _na     268_aa potB Spermidine/putrescine ABC transporter permease
910 JPGA01000006.1 GCA000722675_00521 CDS open 155256-156029 _na     257_aa potC ABC transmembrane type-1 domain-containing protein
911 JPGA01000006.1 GCA000722675_00522 CDS open 156026-157096 _na     356_aa potD Putrescine-binding periplasmic protein
912 JPGA01000006.1 GCA000722675_00523 CDS open 157752-158237 _na     161_aa UDP-N-acetylenolpyruvoylglucosamine reductase
913 JPGA01000006.1 GCA000722675_00524 CDS open 158259-160877 _na     872_aa alaS alanine--tRNA ligase
914 JPGA01000006.1 GCA000722675_00525 CDS open 160968-162416 _na     482_aa amyA alpha-amylase
915 JPGA01000006.1 GCA000722675_00526 CDS open 162689-163852 _na     387_aa 23S rRNA methyltransferase
916 JPGA01000006.1 GCA000722675_00527 CDS open 163849-164526 _na     225_aa aroD 3-dehydroquinate dehydratase
917 JPGA01000006.1 GCA000722675_00528 CDS open 164516-165370 _na     284_aa aroE shikimate dehydrogenase
918 JPGA01000006.1 GCA000722675_00529 CDS open 165389-166456 _na     355_aa aroB 3-dehydroquinate synthase
919 JPGA01000006.1 GCA000722675_00530 CDS open 166466-167632 _na     388_aa aroC chorismate synthase
920 JPGA01000006.1 GCA000722675_00531 CDS open 167642-168745 _na     367_aa tyrA prephenate dehydrogenase
921 JPGA01000006.1 GCA000722675_00532 CDS open 168756-169094 _na     112_aa YlbF/YmcA family competence regulator
922 JPGA01000006.1 GCA000722675_00533 CDS open 169185-170468 _na     427_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
923 JPGA01000006.1 GCA000722675_00534 CDS open 170461-170937 _na     158_aa aroK Shikimate kinase
924 JPGA01000006.1 GCA000722675_00535 CDS open 170934-171782 _na     282_aa pheA prephenate dehydratase
925 JPGA01000006.1 GCA000722675_00536 CDS open 171779-173074 _na     431_aa msrR Regulatory protein MsrR
926 JPGA01000006.1 GCA000722675_00537 CDS open 173218-174054 _na     278_aa licD LicD/FKTN/FKRP nucleotidyltransferase domain-containing protein
927 JPGA01000006.1 GCA000722675_00538 CDS open 174051-175019 _na     322_aa Glycosyl transferase
928 JPGA01000006.1 GCA000722675_00539 CDS open 175028-177181 _na     717_aa licD1 Lipopolysaccharide cholinephosphotransferase LicD1
929 JPGA01000006.1 GCA000722675_00540 CDS open 177185-177895 _na     236_aa LicD/FKTN/FKRP nucleotidyltransferase domain-containing protein
930 JPGA01000006.1 GCA000722675_00541 CDS open 178084-180591 _na     835_aa Choline binding protein E
931 JPGA01000006.1 GCA000722675_00542 CDS open 180642-182120 _na     492_aa Putative teichoic acid flippase
932 JPGA01000006.1 GCA000722675_00543 CDS open 182243-182983 _na     246_aa mecA adaptor protein MecA
933 JPGA01000006.1 GCA000722675_00544 CDS open 183132-184418 _na     428_aa thrA Homoserine dehydrogenase
934 JPGA01000006.1 GCA000722675_00545 CDS open 184420-185289 _na     289_aa thrB homoserine kinase
935 JPGA01000006.1 GCA000722675_00546 CDS open 185549-186487 _na     312_aa msrAB1 Peptide methionine sulfoxide reductase MsrA/MsrB 1
936 JPGA01000006.1 GCA000722675_00547 CDS open 186547-188271 _na     574_aa mdlB Putative multidrug resistance ABC transporter ATP-binding/permease protein YheI
937 JPGA01000006.1 GCA000722675_00548 CDS open 188273-190021 _na     582_aa mdlB ABC transporter ATP-binding protein/permease
938 JPGA01000006.1 GCA000722675_00549 CDS open 190136-191395 _na     419_aa TRZ/ATZ family protein
939 JPGA01000006.1 GCA000722675_00550 CDS open 191629-192129 _na     166_aa rplJ 50S ribosomal protein L10
940 JPGA01000006.1 GCA000722675_00551 CDS open 192204-192572 _na     122_aa rplL 50S ribosomal protein L7/L12
941 JPGA01000006.1 GCA000722675_00553 CDS open 192773-192946 _na     57_aa dprA DprA winged helix domain-containing protein
942 JPGA01000006.1 GCA000722675_00554 CDS open 192943-193722 _na     259_aa Replication initiator A N-terminal domain-containing protein
943 JPGA01000006.1 GCA000722675_00555 CDS open 193723-193824 _na     33_aa Holin-like toxin
944 JPGA01000006.1 GCA000722675_00556 CDS open 193821-195179 _na     452_aa Cytosine-specific methyltransferase
945 JPGA01000006.1 GCA000722675_00557 CDS open 195163-195612 _na     149_aa Integrative and conjugative element protein
946 JPGA01000006.1 GCA000722675_00558 CDS open 195605-195985 _na     126_aa arsC Arsenate reductase-like glutaredoxin family protein
947 JPGA01000006.1 GCA000722675_00559 CDS open 195998-196231 _na     77_aa Transcriptional regulator
948 JPGA01000006.1 GCA000722675_00560 CDS open 196234-196821 _na     195_aa ydiL CAAX amino terminal protease self-immunity
949 JPGA01000006.1 GCA000722675_00561 CDS open 197155-197454 _na     99_aa Tn5253 bacteriocine
950 JPGA01000006.1 GCA000722675_00562 CDS open 197444-197932 _na     162_aa Integrative and conjugative element protein
951 JPGA01000006.1 GCA000722675_00563 CDS open 197932-198897 _na     321_aa Type IV secretory system Conjugative DNA transfer family protein
952 JPGA01000006.1 GCA000722675_00564 CDS open 198948-199808 _na     286_aa VirD4-like conjugal transfer protein%2C CD1115 family
953 JPGA01000006.1 GCA000722675_00565 CDS open 199829-200071 _na     80_aa Integrative and conjugative element protein
954 JPGA01000006.1 GCA000722675_00566 CDS open 200088-200942 _na     284_aa trbL Conjugal transfer protein TrbL
955 JPGA01000006.1 GCA000722675_00567 CDS open 200996-201355 _na     119_aa prgI PrgI family protein
956 JPGA01000006.1 GCA000722675_00568 CDS open 201306-203663 _na     785_aa VirB4-like conjugal transfer ATPase%2C CD1110 family
957 JPGA01000006.1 GCA000722675_00569 CDS open 203675-206488 _na     937_aa CHAP domain containing protein
958 JPGA01000006.1 GCA000722675_00570 CDS open 206726-207292 _na     188_aa Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein
959 JPGA01000006.1 GCA000722675_00571 CDS open 207444-207854 _na     136_aa ompA Cell envelope biogenesis protein OmpA
960 JPGA01000006.1 GCA000722675_00572 CDS open 207902-214132 _na     2076_aa Helicase C-terminal domain-containing protein
961 JPGA01000006.1 GCA000722675_00573 CDS open 214207-214491 _na     94_aa Integrative and conjugative element protein
962 JPGA01000006.1 GCA000722675_00574 CDS open 214505-214801 _na     98_aa Integrative and conjugative element protein
963 JPGA01000006.1 GCA000722675_00575 CDS open 215172-215813 _na     213_aa Peptidylprolyl isomerase
964 JPGA01000006.1 GCA000722675_00576 CDS open 215823-216908 _na     361_aa DNA primase
965 JPGA01000006.1 GCA000722675_00577 CDS open 216959-217192 _na     77_aa Integrative and conjugative element protein
966 JPGA01000006.1 GCA000722675_00578 CDS open 217189-217572 _na     127_aa Chemotaxis protein
967 JPGA01000006.1 GCA000722675_00579 CDS open 217610-217885 _na     91_aa ATPases with chaperone activity%2C ATP-binding subunit
968 JPGA01000006.1 GCA000722675_00580 CDS open 218259-218633 _na     124_aa bepR HTH-type transcriptional repressor BepR
969 JPGA01000006.1 GCA000722675_00581 CDS open 218909-219649 _na     246_aa ABC-2 family transporter protein
970 JPGA01000006.1 GCA000722675_00582 CDS open 219684-224744 _na     1686_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
971 JPGA01000006.1 GCA000722675_00583 CDS open 224786-227107 _na     773_aa non-ribosomal peptide synthetase
972 JPGA01000006.1 GCA000722675_00584 CDS open 227227-228087 _na     286_aa condensation domain-containing protein
973 JPGA01000006.1 GCA000722675_00585 CDS open 228032-232873 _na     1613_aa non-ribosomal peptide synthetase
974 JPGA01000006.1 GCA000722675_00586 CDS open 232870-234507 _na     545_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
975 JPGA01000006.1 GCA000722675_00587 CDS open 234510-235229 _na     239_aa ABC transporter%2C ATP-binding protein
976 JPGA01000006.1 GCA000722675_00588 CDS open 235251-236933 _na     560_aa msbA Lipid A export ATP-binding/permease protein MsbA
977 JPGA01000006.1 GCA000722675_00589 CDS open 236933-237589 _na     218_aa 4'-phosphopantetheinyl transferase psf-1
978 JPGA01000006.1 GCA000722675_00590 CDS open 238364-238702 _na     112_aa hypothetical protein
979 JPGA01000006.1 GCA000722675_00591 CDS open 238832-239797 _na     321_aa hypothetical protein
980 JPGA01000006.1 GCA000722675_00592 CDS open 240129-240485 _na     118_aa SAG1252 family conjugative relaxosome accessory protein
981 JPGA01000006.1 GCA000722675_00593 CDS open 240490-240855 _na     121_aa Mobilization protein
982 JPGA01000006.1 GCA000722675_00594 CDS open 240842-242671 _na     609_aa SAG1250 family conjugative relaxase
983 JPGA01000006.1 GCA000722675_00595 CDS open 242775-243002 _na     75_aa HTH cro/C1-type domain-containing protein
984 JPGA01000006.1 GCA000722675_00596 CDS open 243271-243540 _na     89_aa DUF3173 domain-containing protein
985 JPGA01000006.1 GCA000722675_00597 CDS open 243512-244699 _na     395_aa Integrase
986 JPGA01000006.1 GCA000722675_00598 CDS open 244964-246007 _na     347_aa SPFH domain-containing protein
987 JPGA01000006.1 GCA000722675_00599 CDS open 246315-246602 _na     95_aa Lipopolysaccharide assembly protein A domain-containing protein
988 JPGA01000006.1 GCA000722675_00600 CDS open 246599-247243 _na     214_aa Zinc ribbon domain-containing protein
989 JPGA01000006.1 GCA000722675_00601 CDS open 247244-247699 _na     151_aa Zinc ribbon domain-containing protein
990 JPGA01000006.1 GCA000722675_00602 CDS open 247906-248391 _na     161_aa marR MarR family transcriptional regulator
991 JPGA01000006.1 GCA000722675_00603 CDS open 248423-249769 _na     448_aa gdhA NADP-specific glutamate dehydrogenase
992 JPGA01000006.1 GCA000722675_00604 CDS open 249974-250909 _na     311_aa pyrDA dihydroorotate oxidase
993 JPGA01000006.1 GCA000722675_00605 CDS open 250943-251980 _na     345_aa holA DNA polymerase III subunit delta
994 JPGA01000006.1 GCA000722675_00606 CDS open 252050-252655 _na     201_aa sodA Superoxide dismutase [Mn]
995 JPGA01000006.1 GCA000722675_00607 CDS open 252810-253340 _na     176_aa Transcriptional regulator
996 JPGA01000006.1 GCA000722675_00608 CDS open 253361-254446 _na     361_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
997 JPGA01000006.1 GCA000722675_00609 CDS open 254929-256470 _na     513_aa abc-f ribosomal protection-like ABC-F family protein
998 JPGA01000006.1 GCA000722675_00610 CDS open 256514-256753 _na     79_aa Zinc-ribbon 15 domain-containing protein
999 JPGA01000006.1 GCA000722675_00611 CDS open 256781-257587 _na     268_aa ppiB Peptidyl-prolyl cis-trans isomerase
1000 JPGA01000006.1 GCA000722675_00612 CDS open 257696-257857 _na     53_aa hypothetical protein