HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hoylesella buccalis (GCA_000759265.1)

Select a Genome:
BAKTA Annotations for GCA_000759265.1
Genome Selected: Hoylesella buccalis
ContigsBases CDSrRNA tmRNAtRNA
102 2756480 2299 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4710 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4710 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 JRNP01000017.1 GCA000759265_00823 CDS open 161796-167801 _na     2001_aa Secretion system C-terminal sorting domain-containing protein
1502 JRNP01000017.1 GCA000759265_00824 CDS open 167911-168087 _na     58_aa hypothetical protein
1503 JRNP01000017.1 GCA000759265_00825 CDS open 168126-168338 _na     70_aa hypothetical protein
1504 JRNP01000017.1 GCA000759265_00826 CDS open 168560-169438 _na     292_aa araC AraC family transcriptional regulator
1505 JRNP01000017.1 GCA000759265_00827 CDS open 169863-170576 _na     237_aa WG repeat-containing protein
1506 JRNP01000017.1 GCA000759265_00681 gene open 286-657
1507 JRNP01000017.1 GCA000759265_00682 gene open 958-1386
1508 JRNP01000017.1 GCA000759265_00683 gene open 1425-1598
1509 JRNP01000017.1 GCA000759265_00684 gene open 1515-3296 uvrC
1510 JRNP01000017.1 GCA000759265_00685 gene open 3504-4034 apt
1511 JRNP01000017.1 GCA000759265_00686 gene open 4115-5986 mnmG
1512 JRNP01000017.1 GCA000759265_00687 gene open 6001-6090
1513 JRNP01000017.1 GCA000759265_00688 gene open 6307-8868 chb
1514 JRNP01000017.1 GCA000759265_00689 gene open 8954-9874 yitT
1515 JRNP01000017.1 GCA000759265_00690 gene open 10763-11077
1516 JRNP01000017.1 GCA000759265_00691 gene open 11454-12140
1517 JRNP01000017.1 GCA000759265_00692 gene open 12175-14154 sdhA
1518 JRNP01000017.1 GCA000759265_00693 gene open 14251-14610
1519 JRNP01000017.1 GCA000759265_00694 gene open 14741-15499 sdhB
1520 JRNP01000017.1 GCA000759265_00695 gene open 15647-16882 lolE
1521 JRNP01000017.1 GCA000759265_00696 gene open 16915-17250 rbfA
1522 JRNP01000017.1 GCA000759265_00697 gene open 17354-18310
1523 JRNP01000017.1 GCA000759265_00698 gene open 18345-18986 trmR
1524 JRNP01000017.1 GCA000759265_00699 gene open 19128-19544 aroQ
1525 JRNP01000017.1 GCA000759265_00700 gene open 19653-20618 xerA
1526 JRNP01000017.1 GCA000759265_00701 gene open 20623-21543 lysR
1527 JRNP01000017.1 GCA000759265_00702 gene open 22076-23116 yeiH
1528 JRNP01000017.1 GCA000759265_00703 gene open 23212-24093 rbsK
1529 JRNP01000017.1 GCA000759265_00704 gene open 24168-24374
1530 JRNP01000017.1 GCA000759265_00705 gene open 24334-26268 srmB
1531 JRNP01000017.1 GCA000759265_00706 gene open 26320-29142 pqqL
1532 JRNP01000017.1 GCA000759265_00707 gene open 29555-29773
1533 JRNP01000017.1 GCA000759265_00708 gene open 30073-31332 metK
1534 JRNP01000017.1 GCA000759265_00709 gene open 31336-32358
1535 JRNP01000017.1 GCA000759265_00710 gene open 32366-33115 hemD
1536 JRNP01000017.1 GCA000759265_00711 gene open 33124-33537 rnpA
1537 JRNP01000017.1 GCA000759265_00712 gene open 33567-33785 yidD
1538 JRNP01000017.1 GCA000759265_00713 gene open 33847-35148 tyrS
1539 JRNP01000017.1 GCA000759265_00714 gene open 35444-36202
1540 JRNP01000017.1 GCA000759265_00715 gene open 36260-36934 ddpX
1541 JRNP01000017.1 GCA000759265_00716 gene open 36974-38236
1542 JRNP01000017.1 GCA000759265_00717 gene open 38187-38354
1543 JRNP01000017.1 GCA000759265_00718 gene open 38645-39793
1544 JRNP01000017.1 GCA000759265_00719 gene open 39941-41953 gyrB
1545 JRNP01000017.1 GCA000759265_00720 gene open 42024-43595 ctpA
1546 JRNP01000017.1 GCA000759265_00721 gene open 43782-45074 cdsB
1547 JRNP01000017.1 GCA000759265_00722 gene open 45199-47247 dsbD
1548 JRNP01000017.1 GCA000759265_00723 gene open 48285-48485
1549 JRNP01000017.1 GCA000759265_00724 gene open 48585-50618
1550 JRNP01000017.1 GCA000759265_00727 gene open 51219-52892 pilF
1551 JRNP01000017.1 GCA000759265_00728 gene open 52907-53902
1552 JRNP01000017.1 GCA000759265_00729 gene open 53914-55455 yifB
1553 JRNP01000017.1 GCA000759265_00730 gene open 55552-57615 metG
1554 JRNP01000017.1 GCA000759265_00731 gene open 57711-59018
1555 JRNP01000017.1 GCA000759265_00732 gene open 59079-59477
1556 JRNP01000017.1 GCA000759265_00733 gene open 59480-60613 dprA
1557 JRNP01000017.1 GCA000759265_00734 gene open 60716-61705 dusB
1558 JRNP01000017.1 GCA000759265_00735 gene open 61966-65010 secDF
1559 JRNP01000017.1 GCA000759265_00736 gene open 65118-66206 elsH
1560 JRNP01000017.1 GCA000759265_00737 gene open 66218-67132 glpG
1561 JRNP01000017.1 GCA000759265_00738 gene open 67089-67193
1562 JRNP01000017.1 GCA000759265_00739 gene open 67190-67303
1563 JRNP01000017.1 GCA000759265_00740 gene open 67345-67617 hupA
1564 JRNP01000017.1 GCA000759265_00742 gene open 68531-71428 fepA
1565 JRNP01000017.1 GCA000759265_00743 gene open 71454-72659
1566 JRNP01000017.1 GCA000759265_00744 gene open 72740-74326
1567 JRNP01000017.1 GCA000759265_00745 gene open 74419-76587
1568 JRNP01000017.1 GCA000759265_00746 gene open 76580-78079
1569 JRNP01000017.1 GCA000759265_00747 gene open 78076-78471
1570 JRNP01000017.1 GCA000759265_00748 gene open 78678-78854
1571 JRNP01000017.1 GCA000759265_00749 gene open 79195-80601
1572 JRNP01000017.1 GCA000759265_00750 gene open 80621-81304
1573 JRNP01000017.1 GCA000759265_00751 gene open 81345-82088 uppS
1574 JRNP01000017.1 GCA000759265_00752 gene open 82085-84700 bamA
1575 JRNP01000017.1 GCA000759265_00753 gene open 84806-85318 hlpA
1576 JRNP01000017.1 GCA000759265_00754 gene open 85347-85847
1577 JRNP01000017.1 GCA000759265_00755 gene open 86118-86639 hlpA
1578 JRNP01000017.1 GCA000759265_00756 gene open 86656-87495 murI
1579 JRNP01000017.1 GCA000759265_00757 gene open 87592-89109
1580 JRNP01000017.1 GCA000759265_00758 gene open 89187-89291
1581 JRNP01000017.1 GCA000759265_00759 gene open 89689-90882 norV
1582 JRNP01000017.1 GCA000759265_00760 gene open 90921-91865 rbsK
1583 JRNP01000017.1 GCA000759265_00761 gene open 92039-93274 pqqL
1584 JRNP01000017.1 GCA000759265_00762 gene open 93390-93938
1585 JRNP01000017.1 GCA000759265_00763 gene open 94106-94738
1586 JRNP01000017.1 GCA000759265_00764 gene open 94798-95337
1587 JRNP01000017.1 GCA000759265_00765 gene open 95226-96641 lepB
1588 JRNP01000017.1 GCA000759265_00766 gene open 96716-97471 dapB
1589 JRNP01000017.1 GCA000759265_00767 gene open 98193-98627 fur
1590 JRNP01000017.1 GCA000759265_00768 gene open 98632-98865
1591 JRNP01000017.1 GCA000759265_00769 gene open 98878-99843 yfeH
1592 JRNP01000017.1 GCA000759265_00770 gene open 99971-100606
1593 JRNP01000017.1 GCA000759265_00771 gene open 100599-101012
1594 JRNP01000017.1 GCA000759265_00772 gene open 101050-101688 pyrE
1595 JRNP01000017.1 GCA000759265_00773 gene open 101781-102476 comFC
1596 JRNP01000017.1 GCA000759265_00774 gene open 102469-102954 recX
1597 JRNP01000017.1 GCA000759265_00775 gene open 102969-103832 prmC
1598 JRNP01000017.1 GCA000759265_00776 gene open 103862-104806 ribD
1599 JRNP01000017.1 GCA000759265_00777 gene open 105277-107268
1600 JRNP01000017.1 GCA000759265_00778 gene open 107274-108041 fepC
1601 JRNP01000017.1 GCA000759265_00779 gene open 108128-110107 dNA2
1602 JRNP01000017.1 GCA000759265_00780 gene open 110139-110555
1603 JRNP01000017.1 GCA000759265_00781 gene open 110557-111555
1604 JRNP01000017.1 GCA000759265_00782 gene open 111725-112681 frsA
1605 JRNP01000017.1 GCA000759265_00783 gene open 112693-114510
1606 JRNP01000017.1 GCA000759265_00784 gene open 114693-117335 mgtA
1607 JRNP01000017.1 GCA000759265_00785 gene open 117332-117943 yigB
1608 JRNP01000017.1 GCA000759265_00786 gene open 117933-118898 ribF
1609 JRNP01000017.1 GCA000759265_00787 gene open 118895-119740 ydiL
1610 JRNP01000017.1 GCA000759265_00788 gene open 119925-120413
1611 JRNP01000017.1 GCA000759265_00789 gene open 120403-120915 rpoE
1612 JRNP01000017.1 GCA000759265_00790 gene open 121105-122997 speA
1613 JRNP01000017.1 GCA000759265_00791 gene open 123020-123547 aroK
1614 JRNP01000017.1 GCA000759265_00792 gene open 123564-125936 topA
1615 JRNP01000017.1 GCA000759265_00793 gene open 126594-127769 bcp
1616 JRNP01000017.1 GCA000759265_00794 gene open 127875-128699 aes
1617 JRNP01000017.1 GCA000759265_00795 gene open 128966-129907
1618 JRNP01000017.1 GCA000759265_00796 gene open 129970-130827 licD
1619 JRNP01000017.1 GCA000759265_00797 gene open 130814-131872
1620 JRNP01000017.1 GCA000759265_00798 gene open 132009-133082
1621 JRNP01000017.1 GCA000759265_00799 gene open 133089-134432
1622 JRNP01000017.1 GCA000759265_00800 gene open 134547-135560
1623 JRNP01000017.1 GCA000759265_00801 gene open 135561-137555 comEA
1624 JRNP01000017.1 GCA000759265_00802 gene open 137682-139847 bglX
1625 JRNP01000017.1 GCA000759265_00803 gene open 140224-141231 porB
1626 JRNP01000017.1 GCA000759265_00804 gene open 141228-143087 porG
1627 JRNP01000017.1 GCA000759265_00805 gene open 143202-143855
1628 JRNP01000017.1 GCA000759265_00806 gene open 144021-145025 iap
1629 JRNP01000017.1 GCA000759265_00807 gene open 145089-146846
1630 JRNP01000017.1 GCA000759265_00808 gene open 146843-147322 lrp
1631 JRNP01000017.1 GCA000759265_00809 gene open 147612-148523 fkpA
1632 JRNP01000017.1 GCA000759265_00810 gene open 148644-149516 fkpA
1633 JRNP01000017.1 GCA000759265_00811 gene open 149532-150137 fkpA
1634 JRNP01000017.1 GCA000759265_00812 gene open 150304-151008 sIR2
1635 JRNP01000017.1 GCA000759265_00813 gene open 151096-151449
1636 JRNP01000017.1 GCA000759265_00814 gene open 151628-153343 nptA
1637 JRNP01000017.1 GCA000759265_00815 gene open 153359-153475
1638 JRNP01000017.1 GCA000759265_00816 gene open 153441-155102 udk
1639 JRNP01000017.1 GCA000759265_00817 gene open 155339-156511 araJ
1640 JRNP01000017.1 GCA000759265_00818 gene open 156581-157852
1641 JRNP01000017.1 GCA000759265_00819 gene open 158136-159077 yitT
1642 JRNP01000017.1 GCA000759265_00820 gene open 159113-159250
1643 JRNP01000017.1 GCA000759265_00821 gene open 159275-159928 rbr
1644 JRNP01000017.1 GCA000759265_00822 gene open 160186-161493 eno
1645 JRNP01000017.1 GCA000759265_00823 gene open 161796-167801
1646 JRNP01000017.1 GCA000759265_00824 gene open 167911-168087
1647 JRNP01000017.1 GCA000759265_00825 gene open 168126-168338
1648 JRNP01000017.1 GCA000759265_00826 gene open 168560-169438 araC
1649 JRNP01000017.1 GCA000759265_00827 gene open 169863-170576
1650 JRNP01000017.1 GCA000759265_00725 gene open 50938-51010 trnG
1651 JRNP01000017.1 GCA000759265_00726 gene open 51110-51195 trnL
1652 JRNP01000017.1 GCA000759265_00741 gene open 67691-67761 trnQ
1653 JRNP01000017.1 GCA000759265_00725 tRNA open 50938-51010 trnG tRNA-Gly(gcc)
1654 JRNP01000017.1 GCA000759265_00726 tRNA open 51110-51195 trnL tRNA-Leu(taa)
1655 JRNP01000017.1 GCA000759265_00741 tRNA open 67691-67761 trnQ tRNA-Gln(ttg)
1656 JRNP01000018.1 GCA000759265_00828 CDS open 373-1566 _na     397_aa xerC Tyrosine recombinase XerC
1657 JRNP01000018.1 GCA000759265_00828 gene open 373-1566 xerC
1658 JRNP01000019.1 GCA000759265_00829 CDS open 43-318 _na     91_aa hypothetical protein
1659 JRNP01000019.1 GCA000759265_00829 gene open 43-318
1660 JRNP01000020.1 GCA000759265_00871 gene open 39803-39909 Bacteroidales_small_SRP
1661 JRNP01000020.1 GCA000759265_00871 ncRNA open 39803-39909 Bacteroidales small SRP
1662 JRNP01000020.1 repeat_region open 136231-137721 CRISPR array with 23 repeats of length 36%2C consensus sequence GTTGCTTTATATCTTGATTCTACATCAAACCACAAC and spacer length 29
1663 JRNP01000020.1 GCA000759265_00830 CDS open 107-1636 _na     509_aa DNA methylase
1664 JRNP01000020.1 GCA000759265_00831 CDS open 2298-4223 _na     641_aa tet(Q) tetracycline resistance ribosomal protection protein Tet(Q)
1665 JRNP01000020.1 GCA000759265_00832 CDS open 4223-6541 _na     772_aa ompR histidine kinase
1666 JRNP01000020.1 GCA000759265_00833 CDS open 6534-7856 _na     440_aa atoC Sigma-54-dependent Fis family transcriptional regulator
1667 JRNP01000020.1 GCA000759265_00834 CDS open 8139-8561 _na     140_aa Bacterial bifunctional deaminase-reductase C-terminal domain-containing protein
1668 JRNP01000020.1 GCA000759265_00835 CDS open 8801-9418 _na     205_aa rteC RteC protein
1669 JRNP01000020.1 GCA000759265_00836 CDS open 9715-10845 _na     376_aa AAA+ ATPase domain-containing protein
1670 JRNP01000020.1 GCA000759265_00837 CDS open 10866-12647 _na     593_aa ATP-dependent endonuclease
1671 JRNP01000020.1 GCA000759265_00838 CDS open 12652-14433 _na     593_aa UvrD-like helicase ATP-binding domain-containing protein
1672 JRNP01000020.1 GCA000759265_00839 CDS open 14575-16584 _na     669_aa virD4 YWFCY domain-containing protein
1673 JRNP01000020.1 GCA000759265_00840 CDS open 16617-17867 _na     416_aa Relaxase/mobilization nuclease domain protein
1674 JRNP01000020.1 GCA000759265_00841 CDS open 17846-18274 _na     142_aa mobA MobA protein
1675 JRNP01000020.1 GCA000759265_00842 CDS open 18984-19745 _na     253_aa parA ParA family protein
1676 JRNP01000020.1 GCA000759265_00843 CDS open 19742-20188 _na     148_aa DUF3408 domain-containing protein
1677 JRNP01000020.1 GCA000759265_00844 CDS open 20185-20544 _na     119_aa DUF3408 domain-containing protein
1678 JRNP01000020.1 GCA000759265_00845 CDS open 20564-21292 _na     242_aa traD Conjugal transfer protein TraD
1679 JRNP01000020.1 GCA000759265_00846 CDS open 21496-21807 _na     103_aa DUF4134 domain-containing protein
1680 JRNP01000020.1 GCA000759265_00847 CDS open 21818-22150 _na     110_aa traF Conjugative transposon protein TraF
1681 JRNP01000020.1 GCA000759265_00848 CDS open 22147-24651 _na     834_aa traG Conjugation system ATPase%2C TraG family
1682 JRNP01000020.1 GCA000759265_00849 CDS open 24689-25072 _na     127_aa DUF3876 domain-containing protein
1683 JRNP01000020.1 GCA000759265_00850 CDS open 25103-25732 _na     209_aa DUF4141 domain-containing protein
1684 JRNP01000020.1 GCA000759265_00851 CDS open 25736-26740 _na     334_aa traJ conjugative transposon protein TraJ
1685 JRNP01000020.1 GCA000759265_00852 CDS open 26772-27395 _na     207_aa traK conjugative transposon protein TraK
1686 JRNP01000020.1 GCA000759265_00853 CDS open 27401-27709 _na     102_aa DUF3989 domain-containing protein
1687 JRNP01000020.1 GCA000759265_00854 CDS open 27690-29114 _na     474_aa traM conjugative transposon protein TraM
1688 JRNP01000020.1 GCA000759265_00855 CDS open 29182-30240 _na     352_aa traN conjugative transposon protein TraN
1689 JRNP01000020.1 GCA000759265_00856 CDS open 30243-30818 _na     191_aa traO Conjugative transposon protein TraO
1690 JRNP01000020.1 GCA000759265_00857 CDS open 30827-31705 _na     292_aa Zinc finger CHC2-type domain-containing protein
1691 JRNP01000020.1 GCA000759265_00858 CDS open 31724-32230 _na     168_aa DUF3872 domain-containing protein
1692 JRNP01000020.1 GCA000759265_00859 CDS open 32500-32874 _na     124_aa hypothetical protein
1693 JRNP01000020.1 GCA000759265_00860 CDS open 32883-34178 _na     431_aa Phage abortive infection protein
1694 JRNP01000020.1 GCA000759265_00861 CDS open 34481-34789 _na     102_aa yahA YahA
1695 JRNP01000020.1 GCA000759265_00862 CDS open 34843-35091 _na     82_aa DUF6956 domain-containing protein
1696 JRNP01000020.1 GCA000759265_00863 CDS open 35088-35318 _na     76_aa DUF3873 domain-containing protein
1697 JRNP01000020.1 GCA000759265_00864 CDS open 35337-35594 _na     85_aa hypothetical protein
1698 JRNP01000020.1 GCA000759265_00865 CDS open 35619-36902 _na     427_aa PcfJ-like protein
1699 JRNP01000020.1 GCA000759265_00866 CDS open 36899-37327 _na     142_aa PcfK-like protein
1700 JRNP01000020.1 GCA000759265_00867 CDS open 37344-37559 _na     71_aa MATE efflux family protein
1701 JRNP01000020.1 GCA000759265_00868 CDS open 37567-37902 _na     111_aa Molybdenum ABC transporter ATP-binding protein
1702 JRNP01000020.1 GCA000759265_00869 CDS open 38690-38851 _na     53_aa hypothetical protein
1703 JRNP01000020.1 GCA000759265_00870 CDS open 39280-39651 _na     123_aa DUF4377 domain-containing protein
1704 JRNP01000020.1 GCA000759265_00873 CDS open 40175-40630 _na     151_aa Putative 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
1705 JRNP01000020.1 GCA000759265_00874 CDS open 40757-41311 _na     184_aa DUF4199 domain-containing protein
1706 JRNP01000020.1 GCA000759265_00875 CDS open 41508-42470 _na     320_aa wcaA Glycosyltransferase%2C group 2 family protein
1707 JRNP01000020.1 GCA000759265_00876 CDS open 42458-42937 _na     159_aa Lipoprotein
1708 JRNP01000020.1 GCA000759265_00877 CDS open 42888-43580 _na     230_aa Outer membrane protein beta-barrel domain-containing protein
1709 JRNP01000020.1 GCA000759265_00878 CDS open 43693-44808 _na     371_aa apbE FAD:protein FMN transferase
1710 JRNP01000020.1 GCA000759265_00879 CDS open 44805-45464 _na     219_aa crp Cyclic nucleotide-binding domain-containing protein
1711 JRNP01000020.1 GCA000759265_00880 CDS open 45499-48411 _na     970_aa Outer membrane protein beta-barrel domain-containing protein
1712 JRNP01000020.1 GCA000759265_00881 CDS open 48724-50826 _na     700_aa dcp Peptidase family M3
1713 JRNP01000020.1 GCA000759265_00882 CDS open 50886-51326 _na     146_aa comEB Cytidine and deoxycytidylate deaminase zinc-binding region
1714 JRNP01000020.1 GCA000759265_00883 CDS open 51313-53037 _na     574_aa ctpA Peptidase%2C S41 family
1715 JRNP01000020.1 GCA000759265_00884 CDS open 53078-53629 _na     183_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
1716 JRNP01000020.1 GCA000759265_00885 CDS open 53634-53924 _na     96_aa DUF721 domain-containing protein
1717 JRNP01000020.1 GCA000759265_00886 CDS open 53917-55134 _na     405_aa recF DNA replication/repair protein RecF
1718 JRNP01000020.1 GCA000759265_00887 CDS open 55303-56004 _na     233_aa Tetratricopeptide repeat protein
1719 JRNP01000020.1 GCA000759265_00888 CDS open 56010-56486 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
1720 JRNP01000020.1 GCA000759265_00889 CDS open 56537-57034 _na     165_aa dnaQ Putative DNA polymerase III%2C epsilon subunit
1721 JRNP01000020.1 GCA000759265_00890 CDS open 57189-57572 _na     127_aa Toxin-antitoxin system%2C toxin component
1722 JRNP01000020.1 GCA000759265_00891 CDS open 57644-58921 _na     425_aa porT Outer membrane protein beta-barrel domain-containing protein
1723 JRNP01000020.1 GCA000759265_00892 CDS open 58918-59409 _na     163_aa rpoE Sigma-70 region 2
1724 JRNP01000020.1 GCA000759265_00893 CDS open 59453-60028 _na     191_aa DUF4840 domain-containing protein
1725 JRNP01000020.1 GCA000759265_00894 CDS open 60298-60438 _na     46_aa hypothetical protein
1726 JRNP01000020.1 GCA000759265_00895 CDS open 60547-61194 _na     215_aa Outer membrane protein beta-barrel domain-containing protein
1727 JRNP01000020.1 GCA000759265_00896 CDS open 61215-62144 _na     309_aa Lipoprotein
1728 JRNP01000020.1 GCA000759265_00897 CDS open 62177-63424 _na     415_aa Outer membrane insertion signal domain protein
1729 JRNP01000020.1 GCA000759265_00898 CDS open 63428-64252 _na     274_aa tatD Hydrolase%2C TatD family
1730 JRNP01000020.1 GCA000759265_00899 CDS open 64416-65120 _na     234_aa HEPN domain-containing protein
1731 JRNP01000020.1 GCA000759265_00900 CDS open 65199-66173 _na     324_aa ispA Polyprenyl synthetase
1732 JRNP01000020.1 GCA000759265_00901 CDS open 66198-66914 _na     238_aa tonB TonB-dependent receptor
1733 JRNP01000020.1 GCA000759265_00902 CDS open 67064-68008 _na     314_aa porQ type IX secretion system protein PorQ
1734 JRNP01000020.1 GCA000759265_00903 CDS open 68463-68696 _na     77_aa Putative metal-binding protein
1735 JRNP01000020.1 GCA000759265_00904 CDS open 68824-69465 _na     213_aa DKNYY family protein
1736 JRNP01000020.1 GCA000759265_00905 CDS open 69556-70251 _na     231_aa cmk (d)CMP kinase
1737 JRNP01000020.1 GCA000759265_00906 CDS open 70281-70964 _na     227_aa rluA RNA pseudouridine synthase
1738 JRNP01000020.1 GCA000759265_00907 CDS open 71182-71934 _na     250_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
1739 JRNP01000020.1 GCA000759265_00908 CDS open 71983-72555 _na     190_aa acrR TetR family transcriptional regulator
1740 JRNP01000020.1 GCA000759265_00910 CDS open 73445-75160 _na     571_aa glnS glutamine--tRNA ligase/YqeY domain fusion protein
1741 JRNP01000020.1 GCA000759265_00911 CDS open 75197-76633 _na     478_aa tetratricopeptide repeat protein
1742 JRNP01000020.1 GCA000759265_00912 CDS open 76658-77311 _na     217_aa dedA SNARE-like domain protein
1743 JRNP01000020.1 GCA000759265_00915 CDS open 77615-78157 _na     180_aa rimL Acetyltransferase%2C GNAT family
1744 JRNP01000020.1 GCA000759265_00916 CDS open 78173-79372 _na     399_aa wcaE Glycosyl transferase family 2
1745 JRNP01000020.1 GCA000759265_00917 CDS open 79385-79834 _na     149_aa DUF2975 domain-containing protein
1746 JRNP01000020.1 GCA000759265_00918 CDS open 79903-80514 _na     203_aa recR recombination mediator RecR
1747 JRNP01000020.1 GCA000759265_00919 CDS open 80515-81000 _na     161_aa Outer membrane protein beta-barrel domain-containing protein
1748 JRNP01000020.1 GCA000759265_00920 CDS open 81235-82929 _na     564_aa digH Glycosyl hydrolase-like 10 domain-containing protein
1749 JRNP01000020.1 GCA000759265_00921 CDS open 83340-84092 _na     250_aa kdsA 3-deoxy-8-phosphooctulonate synthase
1750 JRNP01000020.1 GCA000759265_00922 CDS open 84123-85097 _na     324_aa Sugar isomerase%2C KpsF/GutQ family
1751 JRNP01000020.1 GCA000759265_00923 CDS open 85118-86377 _na     419_aa cls Phospholipase D domain protein
1752 JRNP01000020.1 GCA000759265_00924 CDS open 86466-87077 _na     203_aa citB Transcriptional regulator%2C LuxR family
1753 JRNP01000020.1 GCA000759265_00925 CDS open 87217-87549 _na     110_aa qdoI Cupin domain protein
1754 JRNP01000020.1 GCA000759265_00926 CDS open 87707-89326 _na     539_aa BACON domain-containing protein
1755 JRNP01000020.1 GCA000759265_00927 CDS open 89366-92635 _na     1089_aa fepA TonB-dependent receptor-like beta-barrel domain-containing protein
1756 JRNP01000020.1 GCA000759265_00928 CDS open 92667-92783 _na     38_aa hypothetical protein
1757 JRNP01000020.1 GCA000759265_00929 CDS open 93509-94381 _na     290_aa rpoD Sigma-70 region 2
1758 JRNP01000020.1 GCA000759265_00930 CDS open 94522-96726 _na     734_aa nrfG Tetratricopeptide repeat protein
1759 JRNP01000020.1 GCA000759265_00931 CDS open 96764-97672 _na     302_aa tauA SsuA/THI5-like domain-containing protein
1760 JRNP01000020.1 GCA000759265_00932 CDS open 97724-99133 _na     469_aa radA DNA repair protein RadA
1761 JRNP01000020.1 GCA000759265_00933 CDS open 99347-102529 _na     1060_aa Collagen-binding protein
1762 JRNP01000020.1 GCA000759265_00934 CDS open 102587-104218 _na     543_aa Glycan metabolism protein
1763 JRNP01000020.1 GCA000759265_00935 CDS open 104547-106757 _na     736_aa bamA Bacterial surface antigen (D15) domain-containing protein
1764 JRNP01000020.1 GCA000759265_00936 CDS open 106772-106870 _na     32_aa hypothetical protein
1765 JRNP01000020.1 GCA000759265_00937 CDS open 107229-108011 _na     260_aa spoU RNA methyltransferase%2C TrmH family
1766 JRNP01000020.1 GCA000759265_00938 CDS open 108027-108932 _na     301_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
1767 JRNP01000020.1 GCA000759265_00939 CDS open 109176-110417 _na     413_aa mltF Transglycosylase SLT domain protein
1768 JRNP01000020.1 GCA000759265_00940 CDS open 110528-111562 _na     344_aa hisC histidinol-phosphate transaminase
1769 JRNP01000020.1 GCA000759265_00941 CDS open 111613-113991 _na     792_aa cirA TonB-dependent receptor
1770 JRNP01000020.1 GCA000759265_00942 CDS open 114033-115277 _na     414_aa plug Type 9 secretion system plug protein N-terminal domain-containing protein
1771 JRNP01000020.1 GCA000759265_00943 CDS open 115595-115792 _na     65_aa hypothetical protein
1772 JRNP01000020.1 GCA000759265_00944 CDS open 116552-118933 _na     793_aa bamA Bacterial surface antigen (D15) domain-containing protein
1773 JRNP01000020.1 GCA000759265_00945 CDS open 118911-123545 _na     1544_aa asmA AsmA family protein
1774 JRNP01000020.1 GCA000759265_00946 CDS open 123666-124151 _na     161_aa hypothetical protein
1775 JRNP01000020.1 GCA000759265_00947 CDS open 124228-125268 _na     346_aa Beta-carotene 15%2C15'-monooxygenase
1776 JRNP01000020.1 GCA000759265_00948 CDS open 125255-127159 _na     634_aa rlhA Protease
1777 JRNP01000020.1 GCA000759265_00949 CDS open 127163-128050 _na     295_aa metA homoserine O-succinyltransferase
1778 JRNP01000020.1 GCA000759265_00950 CDS open 128269-128400 _na     43_aa hypothetical protein
1779 JRNP01000020.1 GCA000759265_00951 CDS open 128758-129033 _na     91_aa DUF4834 domain-containing protein
1780 JRNP01000020.1 GCA000759265_00952 CDS open 129030-129809 _na     259_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1781 JRNP01000020.1 GCA000759265_00953 CDS open 129880-130572 _na     230_aa psd phosphatidylserine decarboxylase family protein
1782 JRNP01000020.1 GCA000759265_00954 CDS open 130700-134407 _na     1235_aa dnaE DNA polymerase III subunit alpha
1783 JRNP01000020.1 GCA000759265_00955 CDS open 134482-134796 _na     104_aa trxA thioredoxin
1784 JRNP01000020.1 GCA000759265_00956 CDS open 134988-135335 _na     115_aa hypothetical protein
1785 JRNP01000020.1 GCA000759265_00957 CDS open 135623-136174 _na     183_aa Lipoprotein
1786 JRNP01000020.1 GCA000759265_00958 CDS open 137803-138108 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
1787 JRNP01000020.1 GCA000759265_00959 CDS open 138138-139025 _na     295_aa cas1 type II CRISPR-associated endonuclease Cas1
1788 JRNP01000020.1 GCA000759265_00960 CDS open 139032-142688 _na     1218_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1789 JRNP01000020.1 GCA000759265_00961 CDS open 143010-144422 _na     470_aa arAAA ATP-binding protein
1790 JRNP01000020.1 GCA000759265_00962 CDS open 144743-144862 _na     39_aa hypothetical protein
1791 JRNP01000020.1 GCA000759265_00963 CDS open 144869-147091 _na     740_aa Lipoprotein
1792 JRNP01000020.1 GCA000759265_00964 CDS open 147206-147409 _na     67_aa hypothetical protein
1793 JRNP01000020.1 GCA000759265_00830 gene open 107-1636
1794 JRNP01000020.1 GCA000759265_00831 gene open 2298-4223 tet(Q)
1795 JRNP01000020.1 GCA000759265_00832 gene open 4223-6541 ompR
1796 JRNP01000020.1 GCA000759265_00833 gene open 6534-7856 atoC
1797 JRNP01000020.1 GCA000759265_00834 gene open 8139-8561
1798 JRNP01000020.1 GCA000759265_00835 gene open 8801-9418 rteC
1799 JRNP01000020.1 GCA000759265_00836 gene open 9715-10845
1800 JRNP01000020.1 GCA000759265_00837 gene open 10866-12647
1801 JRNP01000020.1 GCA000759265_00838 gene open 12652-14433
1802 JRNP01000020.1 GCA000759265_00839 gene open 14575-16584 virD4
1803 JRNP01000020.1 GCA000759265_00840 gene open 16617-17867
1804 JRNP01000020.1 GCA000759265_00841 gene open 17846-18274 mobA
1805 JRNP01000020.1 GCA000759265_00842 gene open 18984-19745 parA
1806 JRNP01000020.1 GCA000759265_00843 gene open 19742-20188
1807 JRNP01000020.1 GCA000759265_00844 gene open 20185-20544
1808 JRNP01000020.1 GCA000759265_00845 gene open 20564-21292 traD
1809 JRNP01000020.1 GCA000759265_00846 gene open 21496-21807
1810 JRNP01000020.1 GCA000759265_00847 gene open 21818-22150 traF
1811 JRNP01000020.1 GCA000759265_00848 gene open 22147-24651 traG
1812 JRNP01000020.1 GCA000759265_00849 gene open 24689-25072
1813 JRNP01000020.1 GCA000759265_00850 gene open 25103-25732
1814 JRNP01000020.1 GCA000759265_00851 gene open 25736-26740 traJ
1815 JRNP01000020.1 GCA000759265_00852 gene open 26772-27395 traK
1816 JRNP01000020.1 GCA000759265_00853 gene open 27401-27709
1817 JRNP01000020.1 GCA000759265_00854 gene open 27690-29114 traM
1818 JRNP01000020.1 GCA000759265_00855 gene open 29182-30240 traN
1819 JRNP01000020.1 GCA000759265_00856 gene open 30243-30818 traO
1820 JRNP01000020.1 GCA000759265_00857 gene open 30827-31705
1821 JRNP01000020.1 GCA000759265_00858 gene open 31724-32230
1822 JRNP01000020.1 GCA000759265_00859 gene open 32500-32874
1823 JRNP01000020.1 GCA000759265_00860 gene open 32883-34178
1824 JRNP01000020.1 GCA000759265_00861 gene open 34481-34789 yahA
1825 JRNP01000020.1 GCA000759265_00862 gene open 34843-35091
1826 JRNP01000020.1 GCA000759265_00863 gene open 35088-35318
1827 JRNP01000020.1 GCA000759265_00864 gene open 35337-35594
1828 JRNP01000020.1 GCA000759265_00865 gene open 35619-36902
1829 JRNP01000020.1 GCA000759265_00866 gene open 36899-37327
1830 JRNP01000020.1 GCA000759265_00867 gene open 37344-37559
1831 JRNP01000020.1 GCA000759265_00868 gene open 37567-37902
1832 JRNP01000020.1 GCA000759265_00869 gene open 38690-38851
1833 JRNP01000020.1 GCA000759265_00870 gene open 39280-39651
1834 JRNP01000020.1 GCA000759265_00873 gene open 40175-40630
1835 JRNP01000020.1 GCA000759265_00874 gene open 40757-41311
1836 JRNP01000020.1 GCA000759265_00875 gene open 41508-42470 wcaA
1837 JRNP01000020.1 GCA000759265_00876 gene open 42458-42937
1838 JRNP01000020.1 GCA000759265_00877 gene open 42888-43580
1839 JRNP01000020.1 GCA000759265_00878 gene open 43693-44808 apbE
1840 JRNP01000020.1 GCA000759265_00879 gene open 44805-45464 crp
1841 JRNP01000020.1 GCA000759265_00880 gene open 45499-48411
1842 JRNP01000020.1 GCA000759265_00881 gene open 48724-50826 dcp
1843 JRNP01000020.1 GCA000759265_00882 gene open 50886-51326 comEB
1844 JRNP01000020.1 GCA000759265_00883 gene open 51313-53037 ctpA
1845 JRNP01000020.1 GCA000759265_00884 gene open 53078-53629 fAU1
1846 JRNP01000020.1 GCA000759265_00885 gene open 53634-53924
1847 JRNP01000020.1 GCA000759265_00886 gene open 53917-55134 recF
1848 JRNP01000020.1 GCA000759265_00887 gene open 55303-56004
1849 JRNP01000020.1 GCA000759265_00888 gene open 56010-56486 ribH
1850 JRNP01000020.1 GCA000759265_00889 gene open 56537-57034 dnaQ
1851 JRNP01000020.1 GCA000759265_00890 gene open 57189-57572
1852 JRNP01000020.1 GCA000759265_00891 gene open 57644-58921 porT
1853 JRNP01000020.1 GCA000759265_00892 gene open 58918-59409 rpoE
1854 JRNP01000020.1 GCA000759265_00893 gene open 59453-60028
1855 JRNP01000020.1 GCA000759265_00894 gene open 60298-60438
1856 JRNP01000020.1 GCA000759265_00895 gene open 60547-61194
1857 JRNP01000020.1 GCA000759265_00896 gene open 61215-62144
1858 JRNP01000020.1 GCA000759265_00897 gene open 62177-63424
1859 JRNP01000020.1 GCA000759265_00898 gene open 63428-64252 tatD
1860 JRNP01000020.1 GCA000759265_00899 gene open 64416-65120
1861 JRNP01000020.1 GCA000759265_00900 gene open 65199-66173 ispA
1862 JRNP01000020.1 GCA000759265_00901 gene open 66198-66914 tonB
1863 JRNP01000020.1 GCA000759265_00902 gene open 67064-68008 porQ
1864 JRNP01000020.1 GCA000759265_00903 gene open 68463-68696
1865 JRNP01000020.1 GCA000759265_00904 gene open 68824-69465
1866 JRNP01000020.1 GCA000759265_00905 gene open 69556-70251 cmk
1867 JRNP01000020.1 GCA000759265_00906 gene open 70281-70964 rluA
1868 JRNP01000020.1 GCA000759265_00907 gene open 71182-71934 fabG
1869 JRNP01000020.1 GCA000759265_00908 gene open 71983-72555 acrR
1870 JRNP01000020.1 GCA000759265_00910 gene open 73445-75160 glnS
1871 JRNP01000020.1 GCA000759265_00911 gene open 75197-76633
1872 JRNP01000020.1 GCA000759265_00912 gene open 76658-77311 dedA
1873 JRNP01000020.1 GCA000759265_00915 gene open 77615-78157 rimL
1874 JRNP01000020.1 GCA000759265_00916 gene open 78173-79372 wcaE
1875 JRNP01000020.1 GCA000759265_00917 gene open 79385-79834
1876 JRNP01000020.1 GCA000759265_00918 gene open 79903-80514 recR
1877 JRNP01000020.1 GCA000759265_00919 gene open 80515-81000
1878 JRNP01000020.1 GCA000759265_00920 gene open 81235-82929 digH
1879 JRNP01000020.1 GCA000759265_00921 gene open 83340-84092 kdsA
1880 JRNP01000020.1 GCA000759265_00922 gene open 84123-85097
1881 JRNP01000020.1 GCA000759265_00923 gene open 85118-86377 cls
1882 JRNP01000020.1 GCA000759265_00924 gene open 86466-87077 citB
1883 JRNP01000020.1 GCA000759265_00925 gene open 87217-87549 qdoI
1884 JRNP01000020.1 GCA000759265_00926 gene open 87707-89326
1885 JRNP01000020.1 GCA000759265_00927 gene open 89366-92635 fepA
1886 JRNP01000020.1 GCA000759265_00928 gene open 92667-92783
1887 JRNP01000020.1 GCA000759265_00929 gene open 93509-94381 rpoD
1888 JRNP01000020.1 GCA000759265_00930 gene open 94522-96726 nrfG
1889 JRNP01000020.1 GCA000759265_00931 gene open 96764-97672 tauA
1890 JRNP01000020.1 GCA000759265_00932 gene open 97724-99133 radA
1891 JRNP01000020.1 GCA000759265_00933 gene open 99347-102529
1892 JRNP01000020.1 GCA000759265_00934 gene open 102587-104218
1893 JRNP01000020.1 GCA000759265_00935 gene open 104547-106757 bamA
1894 JRNP01000020.1 GCA000759265_00936 gene open 106772-106870
1895 JRNP01000020.1 GCA000759265_00937 gene open 107229-108011 spoU
1896 JRNP01000020.1 GCA000759265_00938 gene open 108027-108932
1897 JRNP01000020.1 GCA000759265_00939 gene open 109176-110417 mltF
1898 JRNP01000020.1 GCA000759265_00940 gene open 110528-111562 hisC
1899 JRNP01000020.1 GCA000759265_00941 gene open 111613-113991 cirA
1900 JRNP01000020.1 GCA000759265_00942 gene open 114033-115277 plug
1901 JRNP01000020.1 GCA000759265_00943 gene open 115595-115792
1902 JRNP01000020.1 GCA000759265_00944 gene open 116552-118933 bamA
1903 JRNP01000020.1 GCA000759265_00945 gene open 118911-123545 asmA
1904 JRNP01000020.1 GCA000759265_00946 gene open 123666-124151
1905 JRNP01000020.1 GCA000759265_00947 gene open 124228-125268
1906 JRNP01000020.1 GCA000759265_00948 gene open 125255-127159 rlhA
1907 JRNP01000020.1 GCA000759265_00949 gene open 127163-128050 metA
1908 JRNP01000020.1 GCA000759265_00950 gene open 128269-128400
1909 JRNP01000020.1 GCA000759265_00951 gene open 128758-129033
1910 JRNP01000020.1 GCA000759265_00952 gene open 129030-129809 pssA
1911 JRNP01000020.1 GCA000759265_00953 gene open 129880-130572 psd
1912 JRNP01000020.1 GCA000759265_00954 gene open 130700-134407 dnaE
1913 JRNP01000020.1 GCA000759265_00955 gene open 134482-134796 trxA
1914 JRNP01000020.1 GCA000759265_00956 gene open 134988-135335
1915 JRNP01000020.1 GCA000759265_00957 gene open 135623-136174
1916 JRNP01000020.1 GCA000759265_00958 gene open 137803-138108 cas2
1917 JRNP01000020.1 GCA000759265_00959 gene open 138138-139025 cas1
1918 JRNP01000020.1 GCA000759265_00960 gene open 139032-142688 cas9
1919 JRNP01000020.1 GCA000759265_00961 gene open 143010-144422 arAAA
1920 JRNP01000020.1 GCA000759265_00962 gene open 144743-144862
1921 JRNP01000020.1 GCA000759265_00963 gene open 144869-147091
1922 JRNP01000020.1 GCA000759265_00964 gene open 147206-147409
1923 JRNP01000020.1 GCA000759265_00872 gene open 39910-39983 trnT
1924 JRNP01000020.1 GCA000759265_00909 gene open 73107-73182 trnfM
1925 JRNP01000020.1 GCA000759265_00913 gene open 77460-77532 trnT
1926 JRNP01000020.1 GCA000759265_00914 gene open 77538-77608 trnG
1927 JRNP01000020.1 GCA000759265_00872 tRNA open 39910-39983 trnT tRNA-Thr(tgt)
1928 JRNP01000020.1 GCA000759265_00909 tRNA open 73107-73182 trnfM tRNA-fMet(cat)
1929 JRNP01000020.1 GCA000759265_00913 tRNA open 77460-77532 trnT tRNA-Thr(cgt)
1930 JRNP01000020.1 GCA000759265_00914 tRNA open 77538-77608 trnG tRNA-Gly(ccc)
1931 JRNP01000021.1 GCA000759265_00966 CDS open 202-348 _na     48_aa hypothetical protein
1932 JRNP01000021.1 GCA000759265_00967 CDS open 411-2465 _na     684_aa htpG molecular chaperone HtpG
1933 JRNP01000021.1 GCA000759265_00968 CDS open 2694-3998 _na     434_aa lpdA dihydrolipoyl dehydrogenase
1934 JRNP01000021.1 GCA000759265_00969 CDS open 3985-5427 _na     480_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
1935 JRNP01000021.1 GCA000759265_00970 CDS open 5424-6740 _na     438_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
1936 JRNP01000021.1 GCA000759265_00971 CDS open 6746-7126 _na     126_aa gcvH glycine cleavage system protein GcvH
1937 JRNP01000021.1 GCA000759265_00972 CDS open 7165-7290 _na     41_aa hypothetical protein
1938 JRNP01000021.1 GCA000759265_00973 CDS open 7292-8386 _na     364_aa gcvT glycine cleavage system aminomethyltransferase GcvT
1939 JRNP01000021.1 GCA000759265_00974 CDS open 8481-9455 _na     324_aa lplA lipoate--protein ligase
1940 JRNP01000021.1 GCA000759265_00975 CDS open 9678-12623 _na     981_aa Carboxypeptidase regulatory-like domain-containing protein
1941 JRNP01000021.1 GCA000759265_00976 CDS open 13439-15874 _na     811_aa thrA bifunctional aspartate kinase/homoserine dehydrogenase I
1942 JRNP01000021.1 GCA000759265_00977 CDS open 16236-17843 _na     535_aa FAD-binding protein
1943 JRNP01000021.1 GCA000759265_00978 CDS open 17960-19594 _na     544_aa Lipocalin-like domain-containing protein
1944 JRNP01000021.1 GCA000759265_00979 CDS open 20059-20436 _na     125_aa DUF1573 domain-containing protein
1945 JRNP01000021.1 GCA000759265_00980 CDS open 20515-20676 _na     53_aa hypothetical protein
1946 JRNP01000021.1 GCA000759265_00981 CDS open 20728-21270 _na     180_aa DUF4375 domain-containing protein
1947 JRNP01000021.1 GCA000759265_00982 CDS open 21273-21752 _na     159_aa smpB SsrA-binding protein SmpB
1948 JRNP01000021.1 GCA000759265_00983 CDS open 21807-22724 _na     305_aa map type I methionyl aminopeptidase
1949 JRNP01000021.1 GCA000759265_00984 CDS open 22818-23846 _na     342_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1950 JRNP01000021.1 GCA000759265_00985 CDS open 23911-24435 _na     174_aa pncC Competence/damage-inducible protein CinA
1951 JRNP01000021.1 GCA000759265_00986 CDS open 24586-24849 _na     87_aa rpmB 50S ribosomal protein L28
1952 JRNP01000021.1 GCA000759265_00987 CDS open 24855-25043 _na     62_aa rpmG 50S ribosomal protein L33
1953 JRNP01000021.1 GCA000759265_00988 CDS open 25059-25217 _na     52_aa DUF4295 domain-containing protein
1954 JRNP01000021.1 GCA000759265_00989 CDS open 25263-25412 _na     49_aa hypothetical protein
1955 JRNP01000021.1 GCA000759265_00990 CDS open 25428-25958 _na     176_aa bcp Antioxidant%2C AhpC/TSA family
1956 JRNP01000021.1 GCA000759265_00991 CDS open 25971-26909 _na     312_aa prsA ribose-phosphate diphosphokinase
1957 JRNP01000021.1 GCA000759265_00992 CDS open 26974-27582 _na     202_aa thiE Thiamine monophosphate synthase/TENI
1958 JRNP01000021.1 GCA000759265_00993 CDS open 27660-28856 _na     398_aa nspC carboxynorspermidine decarboxylase
1959 JRNP01000021.1 GCA000759265_00998 CDS open 29395-29949 _na     184_aa virE VirE N-terminal domain protein
1960 JRNP01000021.1 GCA000759265_00999 CDS open 29990-30400 _na     136_aa ssb Single-stranded DNA-binding protein
1961 JRNP01000021.1 GCA000759265_01000 CDS open 30403-31749 _na     448_aa mpfA Gliding motility-associated protein GldE
1962 JRNP01000021.1 GCA000759265_01001 CDS open 31752-32345 _na     197_aa sfp 4'-phosphopantetheinyl transferase domain-containing protein
1963 JRNP01000021.1 GCA000759265_01002 CDS open 33048-33407 _na     119_aa DUF3592 domain-containing protein
1964 JRNP01000021.1 GCA000759265_01003 CDS open 33509-34339 _na     276_aa Lipoprotein
1965 JRNP01000021.1 GCA000759265_01004 CDS open 34850-35374 _na     174_aa hypothetical protein
1966 JRNP01000021.1 GCA000759265_01005 CDS open 35381-35725 _na     114_aa Gram-positive signal peptide protein%2C YSIRK family
1967 JRNP01000021.1 GCA000759265_01006 CDS open 35751-35879 _na     42_aa hypothetical protein
1968 JRNP01000021.1 GCA000759265_00966 gene open 202-348
1969 JRNP01000021.1 GCA000759265_00967 gene open 411-2465 htpG
1970 JRNP01000021.1 GCA000759265_00968 gene open 2694-3998 lpdA
1971 JRNP01000021.1 GCA000759265_00969 gene open 3985-5427 gcvPB
1972 JRNP01000021.1 GCA000759265_00970 gene open 5424-6740 gcvPA
1973 JRNP01000021.1 GCA000759265_00971 gene open 6746-7126 gcvH
1974 JRNP01000021.1 GCA000759265_00972 gene open 7165-7290
1975 JRNP01000021.1 GCA000759265_00973 gene open 7292-8386 gcvT
1976 JRNP01000021.1 GCA000759265_00974 gene open 8481-9455 lplA
1977 JRNP01000021.1 GCA000759265_00975 gene open 9678-12623
1978 JRNP01000021.1 GCA000759265_00976 gene open 13439-15874 thrA
1979 JRNP01000021.1 GCA000759265_00977 gene open 16236-17843
1980 JRNP01000021.1 GCA000759265_00978 gene open 17960-19594
1981 JRNP01000021.1 GCA000759265_00979 gene open 20059-20436
1982 JRNP01000021.1 GCA000759265_00980 gene open 20515-20676
1983 JRNP01000021.1 GCA000759265_00981 gene open 20728-21270
1984 JRNP01000021.1 GCA000759265_00982 gene open 21273-21752 smpB
1985 JRNP01000021.1 GCA000759265_00983 gene open 21807-22724 map
1986 JRNP01000021.1 GCA000759265_00984 gene open 22818-23846 tsaD
1987 JRNP01000021.1 GCA000759265_00985 gene open 23911-24435 pncC
1988 JRNP01000021.1 GCA000759265_00986 gene open 24586-24849 rpmB
1989 JRNP01000021.1 GCA000759265_00987 gene open 24855-25043 rpmG
1990 JRNP01000021.1 GCA000759265_00988 gene open 25059-25217
1991 JRNP01000021.1 GCA000759265_00989 gene open 25263-25412
1992 JRNP01000021.1 GCA000759265_00990 gene open 25428-25958 bcp
1993 JRNP01000021.1 GCA000759265_00991 gene open 25971-26909 prsA
1994 JRNP01000021.1 GCA000759265_00992 gene open 26974-27582 thiE
1995 JRNP01000021.1 GCA000759265_00993 gene open 27660-28856 nspC
1996 JRNP01000021.1 GCA000759265_00998 gene open 29395-29949 virE
1997 JRNP01000021.1 GCA000759265_00999 gene open 29990-30400 ssb
1998 JRNP01000021.1 GCA000759265_01000 gene open 30403-31749 mpfA
1999 JRNP01000021.1 GCA000759265_01001 gene open 31752-32345 sfp
2000 JRNP01000021.1 GCA000759265_01002 gene open 33048-33407