HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Bifidobacterium subtile (GCA_000771185.1)

Select a Genome:
BAKTA Annotations for GCA_000771185.1
Genome Selected: Bifidobacterium subtile
ContigsBases CDSrRNA tmRNAtRNA
75 2,761,997 2239 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4601 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4601 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 JDTX01000037.1 GCA000771185_01963 CDS open 8-586 _na     192_aa hypothetical protein
4502 JDTX01000037.1 GCA000771185_01964 CDS open 599-1234 _na     211_aa hypothetical protein
4503 JDTX01000037.1 GCA000771185_01965 CDS open 1221-1538 _na     105_aa trbC Conjugal transfer protein TrbC
4504 JDTX01000037.1 GCA000771185_01966 CDS open 1649-2287 _na     212_aa hypothetical protein
4505 JDTX01000037.1 GCA000771185_01967 CDS open 2305-3420 _na     371_aa Tail protein
4506 JDTX01000037.1 GCA000771185_01968 CDS open 3417-3725 _na     102_aa hypothetical protein
4507 JDTX01000037.1 GCA000771185_01969 CDS open 3743-4180 _na     145_aa Transmembrane protein
4508 JDTX01000037.1 GCA000771185_01970 CDS open 4177-4812 _na     211_aa hypothetical protein
4509 JDTX01000037.1 GCA000771185_01963 gene open 8-586
4510 JDTX01000037.1 GCA000771185_01964 gene open 599-1234
4511 JDTX01000037.1 GCA000771185_01965 gene open 1221-1538 trbC
4512 JDTX01000037.1 GCA000771185_01966 gene open 1649-2287
4513 JDTX01000037.1 GCA000771185_01967 gene open 2305-3420
4514 JDTX01000037.1 GCA000771185_01968 gene open 3417-3725
4515 JDTX01000037.1 GCA000771185_01969 gene open 3743-4180
4516 JDTX01000037.1 GCA000771185_01970 gene open 4177-4812
4517 JDTX01000038.1 GCA000771185_01971 CDS open 206-4492 _na     1428_aa Putative surface-anchored fimbrial subunit
4518 JDTX01000038.1 GCA000771185_01971 gene open 206-4492
4519 JDTX01000039.1 GCA000771185_01972 CDS open 49-1551 _na     500_aa Sortase-anchored surface protein
4520 JDTX01000039.1 GCA000771185_01973 CDS open 1969-2991 _na     340_aa Collagen adhesin
4521 JDTX01000039.1 GCA000771185_01974 CDS open 2991-4067 _na     358_aa Sortase
4522 JDTX01000039.1 GCA000771185_01972 gene open 49-1551
4523 JDTX01000039.1 GCA000771185_01973 gene open 1969-2991
4524 JDTX01000039.1 GCA000771185_01974 gene open 2991-4067
4525 JDTX01000040.1 GCA000771185_02013 CDS open 1-327 _na     108_aa hypothetical protein
4526 JDTX01000040.1 GCA000771185_02013 gene open 1-327
4527 JDTX01000041.1 GCA000771185_02014 CDS open 480-986 _na     168_aa Antitoxin SocA-like Panacea domain-containing protein
4528 JDTX01000041.1 GCA000771185_02015 CDS open 1498-1899 _na     133_aa DUF2513 domain-containing protein
4529 JDTX01000041.1 GCA000771185_02016 CDS open 2740-3330 _na     196_aa hypothetical protein
4530 JDTX01000041.1 GCA000771185_02014 gene open 480-986
4531 JDTX01000041.1 GCA000771185_02015 gene open 1498-1899
4532 JDTX01000041.1 GCA000771185_02016 gene open 2740-3330
4533 JDTX01000042.1 GCA000771185_02017 CDS open 377-2212 _na     611_aa Chemotaxis protein
4534 JDTX01000042.1 GCA000771185_02018 CDS open 2217-2837 _na     206_aa Putative low molecular weight protein-tyrosine-phosphatase
4535 JDTX01000042.1 GCA000771185_02019 CDS open 3339-3572 _na     77_aa Transposase subunit B
4536 JDTX01000042.1 GCA000771185_02017 gene open 377-2212
4537 JDTX01000042.1 GCA000771185_02018 gene open 2217-2837
4538 JDTX01000042.1 GCA000771185_02019 gene open 3339-3572
4539 JDTX01000044.1 GCA000771185_02020 CDS open 258-1442 _na     394_aa Glycosyltransferase%2C group 1 family protein
4540 JDTX01000044.1 GCA000771185_02021 CDS open 1454-2989 _na     511_aa rfbX Polysaccharide biosynthesis protein
4541 JDTX01000044.1 GCA000771185_02020 gene open 258-1442
4542 JDTX01000044.1 GCA000771185_02021 gene open 1454-2989 rfbX
4543 JDTX01000045.1 GCA000771185_02022 CDS open 115-1299 _na     394_aa Na-driven multidrug efflux pump
4544 JDTX01000045.1 GCA000771185_02023 CDS open 1345-1980 _na     211_aa polysaccharide pyruvyl transferase family protein
4545 JDTX01000045.1 GCA000771185_02024 CDS open 2077-2451 _na     124_aa polysaccharide pyruvyl transferase family protein
4546 JDTX01000045.1 GCA000771185_02025 CDS open 2494-2622 _na     42_aa Transposase
4547 JDTX01000045.1 GCA000771185_02022 gene open 115-1299
4548 JDTX01000045.1 GCA000771185_02023 gene open 1345-1980
4549 JDTX01000045.1 GCA000771185_02024 gene open 2077-2451
4550 JDTX01000045.1 GCA000771185_02025 gene open 2494-2622
4551 JDTX01000046.1 GCA000771185_02026 CDS open 72-176 _na     34_aa hypothetical protein
4552 JDTX01000046.1 GCA000771185_02027 CDS open 798-2294 _na     498_aa Mannose-1-phosphate guanylyltransferase (GDP)
4553 JDTX01000046.1 GCA000771185_02028 CDS open 2397-2606 _na     69_aa hypothetical protein
4554 JDTX01000046.1 GCA000771185_02026 gene open 72-176
4555 JDTX01000046.1 GCA000771185_02027 gene open 798-2294
4556 JDTX01000046.1 GCA000771185_02028 gene open 2397-2606
4557 JDTX01000047.1 GCA000771185_02029 CDS open 215-1630 _na     471_aa istA IS21 family transposase
4558 JDTX01000047.1 GCA000771185_02030 CDS open 1627-2412 _na     261_aa istB IS21-like element helper ATPase IstB
4559 JDTX01000047.1 GCA000771185_02029 gene open 215-1630 istA
4560 JDTX01000047.1 GCA000771185_02030 gene open 1627-2412 istB
4561 JDTX01000048.1 GCA000771185_02031 CDS open 110-397 _na     95_aa Putative general stress protein 30
4562 JDTX01000048.1 GCA000771185_02032 CDS open 416-946 _na     176_aa Serine acetyltransferase
4563 JDTX01000048.1 GCA000771185_02033 CDS open 958-2067 _na     369_aa Putative general stress protein 30
4564 JDTX01000048.1 GCA000771185_02031 gene open 110-397
4565 JDTX01000048.1 GCA000771185_02032 gene open 416-946
4566 JDTX01000048.1 GCA000771185_02033 gene open 958-2067
4567 JDTX01000049.1 GCA000771185_02034 CDS open 533-1999 _na     488_aa istA IS21 family transposase
4568 JDTX01000049.1 GCA000771185_02034 gene open 533-1999 istA
4569 JDTX01000050.1 GCA000771185_02151 CDS open 117-230 _na     37_aa hypothetical protein
4570 JDTX01000050.1 GCA000771185_02152 CDS open 869-1135 _na     88_aa DNA-damage-inducible protein J
4571 JDTX01000050.1 GCA000771185_02153 CDS open 1138-1428 _na     96_aa relE Translation repressor RelE
4572 JDTX01000050.1 GCA000771185_02151 gene open 117-230
4573 JDTX01000050.1 GCA000771185_02152 gene open 869-1135
4574 JDTX01000050.1 GCA000771185_02153 gene open 1138-1428 relE
4575 JDTX01000051.1 GCA000771185_02154 CDS open 213-1604 _na     463_aa IS3 family transposase
4576 JDTX01000051.1 GCA000771185_02154 gene open 213-1604
4577 JDTX01000052.1 repeat_region open 58-1589 CRISPR array with 24 repeats of length 31%2C consensus sequence GTCGCTCCCTCACGGGAGCGTGGATTGAAAT and spacer length 34
4578 JDTX01000053.1 GCA000771185_02155 CDS open 68-1426 _na     452_aa IS256 family transposase
4579 JDTX01000053.1 GCA000771185_02155 gene open 68-1426
4580 JDTX01000054.1 GCA000771185_02156 CDS open 51-1406 _na     451_aa IS3 family transposase
4581 JDTX01000054.1 GCA000771185_02156 gene open 51-1406
4582 JDTX01000055.1 GCA000771185_02157 CDS open 247-576 _na     109_aa DUF4258 domain-containing protein
4583 JDTX01000055.1 GCA000771185_02158 CDS open 603-944 _na     113_aa Toxin-antitoxin system protein
4584 JDTX01000055.1 GCA000771185_02159 CDS open 981-1169 _na     62_aa hypothetical protein
4585 JDTX01000055.1 GCA000771185_02157 gene open 247-576
4586 JDTX01000055.1 GCA000771185_02158 gene open 603-944
4587 JDTX01000055.1 GCA000771185_02159 gene open 981-1169
4588 JDTX01000056.1 GCA000771185_02160 CDS open 334-510 _na     58_aa YHS domain-containing protein
4589 JDTX01000056.1 GCA000771185_02161 CDS open 691-1053 _na     120_aa yccF YccF domain-containing protein
4590 JDTX01000056.1 GCA000771185_02160 gene open 334-510
4591 JDTX01000056.1 GCA000771185_02161 gene open 691-1053 yccF
4592 JDTX01000057.1 GCA000771185_02162 CDS open 169-780 _na     203_aa hypothetical protein
4593 JDTX01000057.1 GCA000771185_02163 CDS open 811-1119 _na     102_aa hypothetical protein
4594 JDTX01000057.1 GCA000771185_02162 gene open 169-780
4595 JDTX01000057.1 GCA000771185_02163 gene open 811-1119
4596 JDTX01000059.1 GCA000771185_02164 CDS open 17-550 _na     177_aa IS3 family transposase
4597 JDTX01000059.1 GCA000771185_02164 gene open 17-550
4598 JDTX01000062.1 GCA000771185_02235 CDS open 51-536 _na     161_aa Transposase
4599 JDTX01000062.1 GCA000771185_02235 gene open 51-536
4600 JDTX01000067.1 GCA000771185_02236 CDS open 8-253 _na     81_aa IstB-like ATP-binding protein
4601 JDTX01000067.1 GCA000771185_02236 gene open 8-253