BAKTAGenome Explorer: Gardnerella vaginalis (GCA_001042655.1)
Select a Genome:
|
BAKTA Annotations for GCA_001042655.1
|
Search & Sort all 2655 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP012332.1 | GCA001042655_00441 | gene | open | 580610-581004 | ssrA | ||
| 2 | AP012332.1 | GCA001042655_00441 | tmRNA | open | 580610-581004 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP012332.1 | rep_origin | open | 1609-2033 | ||||
| 4 | AP012332.1 | GCA001042655_00080 | gene | open | 96442-97969 | rrs | ||
| 5 | AP012332.1 | GCA001042655_00081 | gene | open | 98343-101405 | rrl | ||
| 6 | AP012332.1 | GCA001042655_00082 | gene | open | 101571-101687 | rrf | ||
| 7 | AP012332.1 | GCA001042655_00136 | gene | open | 177285-177381 | Bacteria_small_SRP | ||
| 8 | AP012332.1 | GCA001042655_00165 | gene | open | 219583-221110 | rrs | ||
| 9 | AP012332.1 | GCA001042655_00166 | gene | open | 221484-224546 | rrl | ||
| 10 | AP012332.1 | GCA001042655_00167 | gene | open | 224712-224828 | rrf | ||
| 11 | AP012332.1 | GCA001042655_00458 | gene | open | 601887-602258 | RNaseP_bact_a | ||
| 12 | AP012332.1 | GCA001042655_00136 | ncRNA | open | 177285-177381 | Bacterial small signal recognition particle RNA | ||
| 13 | AP012332.1 | GCA001042655_00458 | ncRNA | open | 601887-602258 | Bacterial RNase P class A | ||
| 14 | AP012332.1 | regulatory_region | open | 102004-102096 | TPP riboswitch aptamer (THI element) | |||
| 15 | AP012332.1 | regulatory_region | open | 487207-487309 | TPP riboswitch aptamer (THI element) | |||
| 16 | AP012332.1 | regulatory_region | open | 545090-545182 | TPP riboswitch aptamer (THI element) | |||
| 17 | AP012332.1 | regulatory_region | open | 642804-642911 | TPP riboswitch aptamer (THI element) | |||
| 18 | AP012332.1 | regulatory_region | open | 749075-749177 | TPP riboswitch aptamer (THI element) | |||
| 19 | AP012332.1 | regulatory_region | open | 756767-756958 | Lysine riboswitch aptamer | |||
| 20 | AP012332.1 | regulatory_region | open | 892296-892447 | FMN riboswitch aptamer (RFN element) | |||
| 21 | AP012332.1 | regulatory_region | open | 1351961-1352121 | M-box riboswitch aptamer (ykoK leader) | |||
| 22 | AP012332.1 | regulatory_region | open | 1643825-1643883 | msiK RNA | |||
| 23 | AP012332.1 | GCA001042655_00080 | rRNA | open | 96442-97969 | rrs | 16S ribosomal RNA | |
| 24 | AP012332.1 | GCA001042655_00081 | rRNA | open | 98343-101405 | rrl | 23S ribosomal RNA | |
| 25 | AP012332.1 | GCA001042655_00082 | rRNA | open | 101571-101687 | rrf | 5S ribosomal RNA | |
| 26 | AP012332.1 | GCA001042655_00165 | rRNA | open | 219583-221110 | rrs | 16S ribosomal RNA | |
| 27 | AP012332.1 | GCA001042655_00166 | rRNA | open | 221484-224546 | rrl | 23S ribosomal RNA | |
| 28 | AP012332.1 | GCA001042655_00167 | rRNA | open | 224712-224828 | rrf | 5S ribosomal RNA | |
| 29 | AP012332.1 | repeat_region | open | 279088-279248 | CRISPR array with 3 repeats of length 24%2C consensus sequence CCTCGTCAGGGCGGCGGTAATGGC and spacer length 33 | |||
| 30 | AP012332.1 | repeat_region | open | 697301-699107 | CRISPR array with 22 repeats of length 28%2C consensus sequence GTATTTCCCGCATACGCGGGGGTGATCC and spacer length 56 | |||
| 31 | AP012332.1 | repeat_region | open | 698582-699105 | CRISPR array with 9 repeats of length 26%2C consensus sequence GTATTTCCCGCATACGCGGGGGTGAT and spacer length 35 | |||
| 32 | AP012332.1 | GCA001042655_00001 | CDS | open | 1-1608 | _na 535_aa | dnaA | chromosomal replication initiator protein DnaA |
| 33 | AP012332.1 | GCA001042655_00002 | CDS | open | 2034-3152 | _na 372_aa | dnaN | DNA polymerase III subunit beta |
| 34 | AP012332.1 | GCA001042655_00003 | CDS | open | 3163-4431 | _na 422_aa | recF | DNA replication/repair protein RecF |
| 35 | AP012332.1 | GCA001042655_00004 | CDS | open | 4442-4933 | _na 163_aa | DUF721 domain-containing protein | |
| 36 | AP012332.1 | GCA001042655_00005 | CDS | open | 5084-7159 | _na 691_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 37 | AP012332.1 | GCA001042655_00006 | CDS | open | 7229-9868 | _na 879_aa | gyrA | DNA gyrase subunit A |
| 38 | AP012332.1 | GCA001042655_00007 | CDS | open | 9861-10352 | _na 163_aa | DUF3566 domain-containing protein | |
| 39 | AP012332.1 | GCA001042655_00008 | CDS | open | 10444-10851 | _na 135_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 40 | AP012332.1 | GCA001042655_00009 | CDS | open | 10865-11545 | _na 226_aa | pgpB | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein |
| 41 | AP012332.1 | GCA001042655_00010 | CDS | open | 11747-12439 | _na 230_aa | fHA | FHA domain-containing protein |
| 42 | AP012332.1 | GCA001042655_00011 | CDS | open | 12473-12997 | _na 174_aa | fHA | FHA domain-containing protein |
| 43 | AP012332.1 | GCA001042655_00012 | CDS | open | 13002-14681 | _na 559_aa | pTC1 | Protein phosphatase 2C |
| 44 | AP012332.1 | GCA001042655_00013 | CDS | open | 14678-16102 | _na 474_aa | ftsW | Cell division protein FtsW |
| 45 | AP012332.1 | GCA001042655_00014 | CDS | open | 16095-17561 | _na 488_aa | ftsI | Penicillin-binding protein A |
| 46 | AP012332.1 | GCA001042655_00015 | CDS | open | 17558-18523 | _na 321_aa | non-specific serine/threonine protein kinase | |
| 47 | AP012332.1 | GCA001042655_00016 | CDS | open | 18520-20604 | _na 694_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 48 | AP012332.1 | GCA001042655_00017 | CDS | open | 20838-21953 | _na 371_aa | srtA | Sortase family protein |
| 49 | AP012332.1 | GCA001042655_00018 | CDS | open | 21963-22760 | _na 265_aa | ylxW | DUF881 domain-containing protein |
| 50 | AP012332.1 | GCA001042655_00019 | CDS | open | 22837-23238 | _na 133_aa | crgA | cell division protein CrgA |
| 51 | AP012332.1 | GCA001042655_00020 | CDS | open | 23302-24609 | _na 435_aa | SAM-dependent methyltransferase | |
| 52 | AP012332.1 | GCA001042655_00021 | CDS | open | 24823-25524 | _na 233_aa | glpG | Peptidase%2C S54 family |
| 53 | AP012332.1 | GCA001042655_00022 | CDS | open | 25695-25907 | _na 70_aa | Secreted protein | |
| 54 | AP012332.1 | GCA001042655_00023 | CDS | open | 26109-28592 | _na 827_aa | glgP | Alpha-1%2C4 glucan phosphorylase |
| 55 | AP012332.1 | GCA001042655_00024 | CDS | open | 28869-29312 | _na 147_aa | Bacterial SCP orthologue domain-containing protein | |
| 56 | AP012332.1 | GCA001042655_00025 | CDS | open | 29367-29774 | _na 135_aa | DUF3073 domain-containing protein | |
| 57 | AP012332.1 | GCA001042655_00026 | CDS | open | 29931-31022 | _na 363_aa | trpS | tryptophan--tRNA ligase |
| 58 | AP012332.1 | GCA001042655_00027 | CDS | open | 31149-32921 | _na 590_aa | yjjB | Threonine/serine exporter family protein |
| 59 | AP012332.1 | GCA001042655_00028 | CDS | open | 33115-35871 | _na 918_aa | ppc | Phosphoenolpyruvate carboxylase |
| 60 | AP012332.1 | GCA001042655_00029 | CDS | open | 36060-36719 | _na 219_aa | cynT | Carbonic anhydrase |
| 61 | AP012332.1 | GCA001042655_00030 | CDS | open | 36713-37807 | _na 364_aa | yraQ | Putative permease |
| 62 | AP012332.1 | GCA001042655_00031 | CDS | open | 37804-38634 | _na 276_aa | ycgQ | TIGR03943 family putative permease subunit |
| 63 | AP012332.1 | GCA001042655_00032 | CDS | open | 38677-40005 | _na 442_aa | mpfA | CBS domain protein |
| 64 | AP012332.1 | GCA001042655_00033 | CDS | open | 40056-40535 | _na 159_aa | dps | DNA-binding ferritin-like protein for protection from oxidative damage |
| 65 | AP012332.1 | GCA001042655_00036 | CDS | open | 41085-43457 | _na 790_aa | zntA | Heavy metal translocating P-type ATPase |
| 66 | AP012332.1 | GCA001042655_00037 | CDS | open | 43669-45150 | _na 493_aa | ferredoxin--NADP(+) reductase | |
| 67 | AP012332.1 | GCA001042655_00038 | CDS | open | 45327-46400 | _na 357_aa | htpX | Peptidase%2C M48 family |
| 68 | AP012332.1 | GCA001042655_00040 | CDS | open | 46827-47081 | _na 84_aa | abiF | Abi-like protein |
| 69 | AP012332.1 | GCA001042655_00041 | CDS | open | 47086-47301 | _na 71_aa | hypothetical protein | |
| 70 | AP012332.1 | GCA001042655_00042 | CDS | open | 47301-47477 | _na 58_aa | hypothetical protein | |
| 71 | AP012332.1 | GCA001042655_00043 | CDS | open | 47537-48094 | _na 185_aa | DUF2599 domain-containing protein | |
| 72 | AP012332.1 | GCA001042655_00044 | CDS | open | 48112-48423 | _na 103_aa | Peptidase A8 | |
| 73 | AP012332.1 | GCA001042655_00045 | CDS | open | 48816-49706 | _na 296_aa | DNA binding domain%2C excisionase family | |
| 74 | AP012332.1 | GCA001042655_00046 | CDS | open | 50042-51358 | _na 438_aa | AAA family ATPase | |
| 75 | AP012332.1 | GCA001042655_00047 | CDS | open | 51795-52448 | _na 217_aa | LPXTG-motif cell wall anchor domain protein | |
| 76 | AP012332.1 | GCA001042655_00048 | CDS | open | 53011-54201 | _na 396_aa | Fungal lipase-type domain-containing protein | |
| 77 | AP012332.1 | GCA001042655_00049 | CDS | open | 54784-55716 | _na 310_aa | UDP-N-acetylglucosamine diphosphorylase | |
| 78 | AP012332.1 | GCA001042655_00050 | CDS | open | 55760-56758 | _na 332_aa | nagC | ROK family protein |
| 79 | AP012332.1 | GCA001042655_00051 | CDS | open | 56821-57489 | _na 222_aa | nanE | Putative N-acetylmannosamine-6-phosphate 2-epimerase |
| 80 | AP012332.1 | GCA001042655_00052 | CDS | open | 57779-59344 | _na 521_aa | ddpA | ABC transporter%2C substrate-binding protein%2C family 5 |
| 81 | AP012332.1 | GCA001042655_00053 | CDS | open | 59492-60448 | _na 318_aa | dppB | Binding-protein-dependent transport systems inner membrane component |
| 82 | AP012332.1 | GCA001042655_00054 | CDS | open | 60450-62474 | _na 674_aa | dppC | ABC transporter%2C ATP-binding protein |
| 83 | AP012332.1 | GCA001042655_00055 | CDS | open | 62471-63331 | _na 286_aa | dppD | Oligopeptide ABC transporter%2C ATP-binding protein AppF family protein |
| 84 | AP012332.1 | GCA001042655_00056 | CDS | open | 63503-64462 | _na 319_aa | dapA | Dihydrodipicolinate synthetase family |
| 85 | AP012332.1 | GCA001042655_00057 | CDS | open | 64634-65446 | _na 270_aa | nagB | glucosamine-6-phosphate deaminase |
| 86 | AP012332.1 | GCA001042655_00058 | CDS | open | 65522-66781 | _na 419_aa | nagA | N-acetylglucosamine-6-phosphate deacetylase |
| 87 | AP012332.1 | GCA001042655_00059 | CDS | open | 67293-68090 | _na 265_aa | fadR | Transcriptional regulator%2C GntR family |
| 88 | AP012332.1 | GCA001042655_00060 | CDS | open | 68074-70797 | _na 907_aa | nanH | exo-alpha-sialidase |
| 89 | AP012332.1 | GCA001042655_00062 | CDS | open | 71681-73006 | _na 441_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 90 | AP012332.1 | GCA001042655_00063 | CDS | open | 73348-75198 | _na 616_aa | degQ | Trypsin |
| 91 | AP012332.1 | GCA001042655_00064 | CDS | open | 75208-75918 | _na 236_aa | nfnB | Nitroreductase family protein |
| 92 | AP012332.1 | GCA001042655_00065 | CDS | open | 75943-77652 | _na 569_aa | ABC transporter permease | |
| 93 | AP012332.1 | GCA001042655_00066 | CDS | open | 77685-78767 | _na 360_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 94 | AP012332.1 | GCA001042655_00067 | CDS | open | 78894-81851 | _na 985_aa | mgtA | Putative calcium-translocating P-type ATPase%2C PMCA-type |
| 95 | AP012332.1 | GCA001042655_00068 | CDS | open | 81942-82523 | _na 193_aa | dcd | dCTP deaminase |
| 96 | AP012332.1 | GCA001042655_00069 | CDS | open | 82796-83635 | _na 279_aa | Phospholipase/carboxylesterase/thioesterase domain-containing protein | |
| 97 | AP012332.1 | GCA001042655_00070 | CDS | open | 83632-84096 | _na 154_aa | tadA | tRNA-specific adenosine deaminase |
| 98 | AP012332.1 | GCA001042655_00071 | CDS | open | 84582-85592 | _na 336_aa | purR | Transcriptional regulator%2C LacI family |
| 99 | AP012332.1 | GCA001042655_00072 | CDS | open | 85855-87348 | _na 497_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 100 | AP012332.1 | GCA001042655_00073 | CDS | open | 87521-88522 | _na 333_aa | araH | Branched-chain amino acid ABC transporter%2C permease protein |
| 101 | AP012332.1 | GCA001042655_00074 | CDS | open | 88821-89759 | _na 312_aa | rbsB | Putative D-ribose-binding periplasmic protein |
| 102 | AP012332.1 | GCA001042655_00075 | CDS | open | 90149-90544 | _na 131_aa | rbsD | D-ribose pyranase |
| 103 | AP012332.1 | GCA001042655_00076 | CDS | open | 90613-91677 | _na 354_aa | rbsK | Ribokinase |
| 104 | AP012332.1 | GCA001042655_00077 | CDS | open | 91935-92903 | _na 322_aa | panE | 2-dehydropantoate 2-reductase |
| 105 | AP012332.1 | GCA001042655_00078 | CDS | open | 93117-95060 | _na 647_aa | amyA | Alpha amylase%2C catalytic domain protein |
| 106 | AP012332.1 | GCA001042655_00079 | CDS | open | 95089-95922 | _na 277_aa | sIR2 | Transcriptional regulator%2C Sir2 family |
| 107 | AP012332.1 | GCA001042655_00083 | CDS | open | 102018-103601 | _na 527_aa | thiM | hydroxyethylthiazole kinase |
| 108 | AP012332.1 | GCA001042655_00084 | CDS | open | 103607-105304 | _na 565_aa | tenA | bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase |
| 109 | AP012332.1 | GCA001042655_00085 | CDS | open | 105896-106309 | _na 137_aa | Transcriptional regulator | |
| 110 | AP012332.1 | GCA001042655_00086 | CDS | open | 106490-106861 | _na 123_aa | ABC transporter permease | |
| 111 | AP012332.1 | GCA001042655_00087 | CDS | open | 107023-108183 | _na 386_aa | Histidine kinase | |
| 112 | AP012332.1 | GCA001042655_00088 | CDS | open | 108180-108851 | _na 223_aa | citB | Response regulator receiver domain protein |
| 113 | AP012332.1 | GCA001042655_00089 | CDS | open | 109328-110230 | _na 300_aa | Efflux RND transporter periplasmic adaptor subunit | |
| 114 | AP012332.1 | GCA001042655_00090 | CDS | open | 110227-110937 | _na 236_aa | lolD | ABC transporter%2C ATP-binding protein |
| 115 | AP012332.1 | GCA001042655_00091 | CDS | open | 110921-112132 | _na 403_aa | salY | ABC transporter permease |
| 116 | AP012332.1 | GCA001042655_00092 | CDS | open | 112160-112684 | _na 174_aa | Lipoprotein | |
| 117 | AP012332.1 | GCA001042655_00093 | CDS | open | 112729-113991 | _na 420_aa | Major facilitator superfamily MFS_1 | |
| 118 | AP012332.1 | GCA001042655_00094 | CDS | open | 114455-114580 | _na 41_aa | hypothetical protein | |
| 119 | AP012332.1 | GCA001042655_00095 | CDS | open | 114788-116059 | _na 423_aa | ugpB | ABC-type sugar transport system%2C periplasmic component |
| 120 | AP012332.1 | GCA001042655_00096 | CDS | open | 116144-117049 | _na 301_aa | ugpA | ABC transporter%2C permease protein |
| 121 | AP012332.1 | GCA001042655_00097 | CDS | open | 117049-117870 | _na 273_aa | ugpE | Carbohydrate ABC transporter permease |
| 122 | AP012332.1 | GCA001042655_00098 | CDS | open | 117903-119282 | _na 459_aa | amyA | Putative neopullulanase |
| 123 | AP012332.1 | GCA001042655_00099 | CDS | open | 119312-120370 | _na 352_aa | purR | Sugar-binding domain protein |
| 124 | AP012332.1 | GCA001042655_00100 | CDS | open | 120516-122042 | _na 508_aa | aspB | alanine transaminase |
| 125 | AP012332.1 | GCA001042655_00101 | CDS | open | 122414-124477 | _na 687_aa | nhaP | Putative Na+/H+ antiporter |
| 126 | AP012332.1 | GCA001042655_00102 | CDS | open | 124773-125123 | _na 116_aa | hypothetical protein | |
| 127 | AP012332.1 | GCA001042655_00103 | CDS | open | 125150-125965 | _na 271_aa | nfnB | NADPH-flavin oxidoreductase |
| 128 | AP012332.1 | GCA001042655_00104 | CDS | open | 126039-126623 | _na 194_aa | DUF4235 domain-containing protein | |
| 129 | AP012332.1 | GCA001042655_00105 | CDS | open | 126807-127565 | _na 252_aa | phoE | phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent) |
| 130 | AP012332.1 | GCA001042655_00106 | CDS | open | 127720-129063 | _na 447_aa | ugpB | ABC transporter%2C solute-binding protein |
| 131 | AP012332.1 | GCA001042655_00107 | CDS | open | 129315-130334 | _na 339_aa | purR | Transcriptional regulator%2C LacI family |
| 132 | AP012332.1 | GCA001042655_00108 | CDS | open | 130684-131538 | _na 284_aa | ugpA | ABC transporter%2C permease protein |
| 133 | AP012332.1 | GCA001042655_00109 | CDS | open | 131535-132368 | _na 277_aa | ugpE | ABC transporter%2C permease protein |
| 134 | AP012332.1 | GCA001042655_00110 | CDS | open | 132516-133130 | _na 204_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 135 | AP012332.1 | GCA001042655_00111 | CDS | open | 133523-135715 | _na 730_aa | malQ | 4-alpha-glucanotransferase |
| 136 | AP012332.1 | GCA001042655_00112 | CDS | open | 135967-138564 | _na 865_aa | mDN1 | M protein repeat protein |
| 137 | AP012332.1 | GCA001042655_00113 | CDS | open | 139010-141001 | _na 663_aa | pulA | type I pullulanase |
| 138 | AP012332.1 | GCA001042655_00114 | CDS | open | 141107-142027 | _na 306_aa | malG | Sugar ABC transporter permease |
| 139 | AP012332.1 | GCA001042655_00115 | CDS | open | 142024-143427 | _na 467_aa | ugpA | Maltose/maltodextrin transport system permease protein |
| 140 | AP012332.1 | GCA001042655_00116 | CDS | open | 143586-144815 | _na 409_aa | malE | ABC transporter%2C solute-binding protein |
| 141 | AP012332.1 | GCA001042655_00117 | CDS | open | 145298-147004 | _na 568_aa | amyA | Glycosyl hydrolase family 13 catalytic domain-containing protein |
| 142 | AP012332.1 | GCA001042655_00118 | CDS | open | 147318-148091 | _na 257_aa | Endonuclease VII | |
| 143 | AP012332.1 | GCA001042655_00119 | CDS | open | 148075-149091 | _na 338_aa | purR | Transcriptional regulator%2C LacI family |
| 144 | AP012332.1 | GCA001042655_00120 | CDS | open | 149350-150738 | _na 462_aa | ugpB | ABC transporter%2C solute-binding protein |
| 145 | AP012332.1 | GCA001042655_00121 | CDS | open | 150809-151744 | _na 311_aa | ugpA | ABC transporter%2C permease protein |
| 146 | AP012332.1 | GCA001042655_00122 | CDS | open | 151741-152574 | _na 277_aa | ugpE | ABC transporter%2C permease protein |
| 147 | AP012332.1 | GCA001042655_00123 | CDS | open | 152590-155373 | _na 927_aa | yicI | Alpha-glucosidase |
| 148 | AP012332.1 | GCA001042655_00124 | CDS | open | 156388-164055 | _na 2555_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 149 | AP012332.1 | GCA001042655_00125 | CDS | open | 164588-165658 | _na 356_aa | thiO | glycine oxidase ThiO |
| 150 | AP012332.1 | GCA001042655_00126 | CDS | open | 165729-165935 | _na 68_aa | thiS | sulfur carrier protein ThiS |
| 151 | AP012332.1 | GCA001042655_00127 | CDS | open | 166004-166825 | _na 273_aa | thiG | Thiazole synthase |
| 152 | AP012332.1 | GCA001042655_00128 | CDS | open | 166868-167596 | _na 242_aa | thiF | HesA/MoeB/ThiF family protein |
| 153 | AP012332.1 | GCA001042655_00129 | CDS | open | 167796-169697 | _na 633_aa | dnaK | molecular chaperone DnaK |
| 154 | AP012332.1 | GCA001042655_00130 | CDS | open | 169697-170467 | _na 256_aa | grpE | nucleotide exchange factor GrpE |
| 155 | AP012332.1 | GCA001042655_00131 | CDS | open | 170677-171729 | _na 350_aa | dnaJ | Heat shock protein DnaJ domain protein |
| 156 | AP012332.1 | GCA001042655_00132 | CDS | open | 171770-172384 | _na 204_aa | soxR | heat shock protein transcriptional repressor HspR |
| 157 | AP012332.1 | GCA001042655_00133 | CDS | open | 172514-173227 | _na 237_aa | ycjU | HAD-superfamily hydrolase%2C subfamily IA%2C variant 3 |
| 158 | AP012332.1 | GCA001042655_00134 | CDS | open | 173589-175940 | _na 783_aa | peptidoglycan glycosyltransferase | |
| 159 | AP012332.1 | GCA001042655_00135 | CDS | open | 176075-177217 | _na 380_aa | iNO1 | Inositol-3-phosphate synthase |
| 160 | AP012332.1 | GCA001042655_00137 | CDS | open | 177998-179119 | _na 373_aa | Phosphoesterase | |
| 161 | AP012332.1 | GCA001042655_00138 | CDS | open | 179290-182148 | _na 952_aa | topA | type I DNA topoisomerase |
| 162 | AP012332.1 | GCA001042655_00139 | CDS | open | 182170-182871 | _na 233_aa | tmk | dTMP kinase |
| 163 | AP012332.1 | GCA001042655_00140 | CDS | open | 182898-184085 | _na 395_aa | dnaX | DNA polymerase III subunit delta' |
| 164 | AP012332.1 | GCA001042655_00141 | CDS | open | 184421-184972 | _na 183_aa | ybhB | Phospholipid-binding protein |
| 165 | AP012332.1 | GCA001042655_00142 | CDS | open | 185181-186788 | _na 535_aa | pepD | C69 family dipeptidase |
| 166 | AP012332.1 | GCA001042655_00143 | CDS | open | 186986-188518 | _na 510_aa | mIS1 | formate--tetrahydrofolate ligase |
| 167 | AP012332.1 | GCA001042655_00144 | CDS | open | 189014-191944 | _na 976_aa | tonB | Cna protein B-type domain protein |
| 168 | AP012332.1 | GCA001042655_00145 | CDS | open | 192489-192722 | _na 77_aa | hypothetical protein | |
| 169 | AP012332.1 | GCA001042655_00146 | CDS | open | 192616-193461 | _na 281_aa | aes | BD-FAE-like domain-containing protein |
| 170 | AP012332.1 | GCA001042655_00147 | CDS | open | 193617-194510 | _na 297_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 171 | AP012332.1 | GCA001042655_00148 | CDS | open | 194505-194816 | _na 103_aa | hypothetical protein | |
| 172 | AP012332.1 | GCA001042655_00149 | CDS | open | 194806-195660 | _na 284_aa | hypothetical protein | |
| 173 | AP012332.1 | GCA001042655_00150 | CDS | open | 195870-197735 | _na 621_aa | metG | Methionine--tRNA ligase |
| 174 | AP012332.1 | GCA001042655_00151 | CDS | open | 198588-200027 | _na 479_aa | pepC | Aminopeptidase |
| 175 | AP012332.1 | GCA001042655_00152 | CDS | open | 200514-201497 | _na 327_aa | dppB | ABC transporter%2C permease protein |
| 176 | AP012332.1 | GCA001042655_00153 | CDS | open | 201523-202470 | _na 315_aa | dppC | ABC transporter permease |
| 177 | AP012332.1 | GCA001042655_00154 | CDS | open | 202491-204386 | _na 631_aa | oppF | murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF |
| 178 | AP012332.1 | GCA001042655_00155 | CDS | open | 204712-206460 | _na 582_aa | ddpA | ABC transporter%2C substrate-binding protein%2C family 5 |
| 179 | AP012332.1 | GCA001042655_00156 | CDS | open | 206793-208619 | _na 608_aa | ABC transporter%2C ATP-binding protein | |
| 180 | AP012332.1 | GCA001042655_00157 | CDS | open | 208621-210417 | _na 598_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 181 | AP012332.1 | GCA001042655_00158 | CDS | open | 210483-211463 | _na 326_aa | tatD | Hydrolase TatD |
| 182 | AP012332.1 | GCA001042655_00159 | CDS | open | 211646-214165 | _na 839_aa | kup | putative potassium transport system protein Kup |
| 183 | AP012332.1 | GCA001042655_00160 | CDS | open | 214235-215068 | _na 277_aa | HD domain-containing protein | |
| 184 | AP012332.1 | GCA001042655_00161 | CDS | open | 215098-215838 | _na 246_aa | fadR | FCD domain protein |
| 185 | AP012332.1 | GCA001042655_00162 | CDS | open | 216000-216527 | _na 175_aa | gntK | Gluconokinase |
| 186 | AP012332.1 | GCA001042655_00163 | CDS | open | 216708-218048 | _na 446_aa | gntT | Transporter%2C gluconate:H+ symporter family |
| 187 | AP012332.1 | GCA001042655_00164 | CDS | open | 218146-219021 | _na 291_aa | gnd | phosphogluconate dehydrogenase (NAD(+)-dependent%2C decarboxylating) |
| 188 | AP012332.1 | GCA001042655_00168 | CDS | open | 225010-225564 | _na 184_aa | pncA | Isochorismatase family protein |
| 189 | AP012332.1 | GCA001042655_00169 | CDS | open | 225798-228197 | _na 799_aa | Surface-anchored protein | |
| 190 | AP012332.1 | GCA001042655_00170 | CDS | open | 228211-229599 | _na 462_aa | Cell surface protein | |
| 191 | AP012332.1 | GCA001042655_00171 | CDS | open | 229592-232039 | _na 815_aa | Putative ABC transporter-associated repeat protein | |
| 192 | AP012332.1 | GCA001042655_00172 | CDS | open | 232065-233909 | _na 614_aa | znuA | anchored repeat ABC transporter%2C substrate-binding protein |
| 193 | AP012332.1 | GCA001042655_00173 | CDS | open | 233952-234773 | _na 273_aa | znuC | anchored repeat-type ABC transporter ATP-binding subunit |
| 194 | AP012332.1 | GCA001042655_00174 | CDS | open | 234773-235645 | _na 290_aa | znuB | anchored repeat-type ABC transporter permease subunit |
| 195 | AP012332.1 | GCA001042655_00175 | CDS | open | 235680-236561 | _na 293_aa | plsC | Phospholipid/glycerol acyltransferase domain-containing protein |
| 196 | AP012332.1 | GCA001042655_00176 | CDS | open | 236768-237763 | _na 331_aa | gpsA | Glycerol-3-phosphate dehydrogenase [NAD(P)+] |
| 197 | AP012332.1 | GCA001042655_00177 | CDS | open | 237857-239002 | _na 381_aa | ddlA | D-alanine--D-alanine ligase |
| 198 | AP012332.1 | GCA001042655_00178 | CDS | open | 239144-240136 | _na 330_aa | ydiL | Metal-dependent membrane protease |
| 199 | AP012332.1 | GCA001042655_00179 | CDS | open | 240242-241630 | _na 462_aa | thrA | Homoserine dehydrogenase |
| 200 | AP012332.1 | GCA001042655_00180 | CDS | open | 241695-242726 | _na 343_aa | thrB | homoserine kinase |
| 201 | AP012332.1 | GCA001042655_00181 | CDS | open | 242760-244193 | _na 477_aa | yjhB | Nucleoside triphosphate pyrophosphatase |
| 202 | AP012332.1 | GCA001042655_00182 | CDS | open | 244742-246109 | _na 455_aa | hypothetical protein | |
| 203 | AP012332.1 | GCA001042655_00183 | CDS | open | 246645-247586 | _na 313_aa | yfdV | Auxin Efflux Carrier |
| 204 | AP012332.1 | GCA001042655_00184 | CDS | open | 247900-251373 | _na 1157_aa | cafA | Ribonuclease%2C Rne/Rng family |
| 205 | AP012332.1 | GCA001042655_00185 | CDS | open | 251555-251863 | _na 102_aa | rplU | 50S ribosomal protein L21 |
| 206 | AP012332.1 | GCA001042655_00186 | CDS | open | 251897-252148 | _na 83_aa | rpmA | 50S ribosomal protein L27 |
| 207 | AP012332.1 | GCA001042655_00187 | CDS | open | 252513-254177 | _na 554_aa | obgE | GTPase ObgE |
| 208 | AP012332.1 | GCA001042655_00188 | CDS | open | 254178-255323 | _na 381_aa | proB | Glutamate 5-kinase |
| 209 | AP012332.1 | GCA001042655_00189 | CDS | open | 255685-256968 | _na 427_aa | aspB | Aminotransferase |
| 210 | AP012332.1 | GCA001042655_00191 | CDS | open | 257247-257462 | _na 71_aa | secE | preprotein translocase subunit SecE |
| 211 | AP012332.1 | GCA001042655_00192 | CDS | open | 257491-258345 | _na 284_aa | nusG | transcription termination/antitermination protein NusG |
| 212 | AP012332.1 | GCA001042655_00193 | CDS | open | 258827-260236 | _na 469_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 213 | AP012332.1 | GCA001042655_00194 | CDS | open | 260325-261683 | _na 452_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 214 | AP012332.1 | GCA001042655_00195 | CDS | open | 261859-263850 | _na 663_aa | non-specific serine/threonine protein kinase | |
| 215 | AP012332.1 | GCA001042655_00197 | CDS | open | 264398-265045 | _na 215_aa | Teichoic acid transporter | |
| 216 | AP012332.1 | GCA001042655_00198 | CDS | open | 265423-266103 | _na 226_aa | dedA | VTT domain-containing protein |
| 217 | AP012332.1 | GCA001042655_00199 | CDS | open | 266249-266518 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 218 | AP012332.1 | GCA001042655_00200 | CDS | open | 266953-269697 | _na 914_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 219 | AP012332.1 | GCA001042655_00201 | CDS | open | 269824-270681 | _na 285_aa | pdxI | Oxidoreductase%2C aldo/keto reductase family protein |
| 220 | AP012332.1 | GCA001042655_00202 | CDS | open | 270736-271701 | _na 321_aa | yfiH | Copper oxidase |
| 221 | AP012332.1 | GCA001042655_00203 | CDS | open | 271733-272404 | _na 223_aa | pcp | Pyroglutamyl-peptidase I |
| 222 | AP012332.1 | GCA001042655_00204 | CDS | open | 272514-273905 | _na 463_aa | Cell division protein | |
| 223 | AP012332.1 | GCA001042655_00205 | CDS | open | 274084-275418 | _na 444_aa | pepC | Aminopeptidase |
| 224 | AP012332.1 | GCA001042655_00206 | CDS | open | 275865-276818 | _na 317_aa | Lipoprotein | |
| 225 | AP012332.1 | GCA001042655_00207 | CDS | open | 277040-278089 | _na 349_aa | nusA | Transcription termination/antitermination protein NusA |
| 226 | AP012332.1 | GCA001042655_00208 | CDS | open | 281280-281861 | _na 193_aa | rbfA | 30S ribosome-binding factor RbfA |
| 227 | AP012332.1 | GCA001042655_00209 | CDS | open | 281898-283100 | _na 400_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 228 | AP012332.1 | GCA001042655_00210 | CDS | open | 283190-284527 | _na 445_aa | ribF | Riboflavin kinase |
| 229 | AP012332.1 | GCA001042655_00211 | CDS | open | 284641-285900 | _na 419_aa | aroG1 | 3-deoxy-7-phosphoheptulonate synthase |
| 230 | AP012332.1 | GCA001042655_00212 | CDS | open | 286664-287140 | _na 158_aa | Permease | |
| 231 | AP012332.1 | GCA001042655_00213 | CDS | open | 287149-287850 | _na 233_aa | mtnN | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase |
| 232 | AP012332.1 | GCA001042655_00214 | CDS | open | 288134-289315 | _na 393_aa | pstS | phosphate ABC transporter substrate-binding protein PstS |
| 233 | AP012332.1 | GCA001042655_00215 | CDS | open | 289398-290384 | _na 328_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 234 | AP012332.1 | GCA001042655_00216 | CDS | open | 290381-291388 | _na 335_aa | pstA | phosphate ABC transporter permease PstA |
| 235 | AP012332.1 | GCA001042655_00217 | CDS | open | 291418-292197 | _na 259_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 236 | AP012332.1 | GCA001042655_00218 | CDS | open | 292491-293885 | _na 464_aa | nCS2 | Putative permease |
| 237 | AP012332.1 | GCA001042655_00219 | CDS | open | 294333-294854 | _na 173_aa | rplJ | 50S ribosomal protein L10 |
| 238 | AP012332.1 | GCA001042655_00220 | CDS | open | 294950-295333 | _na 127_aa | rplL | 50S ribosomal protein L7/L12 |
| 239 | AP012332.1 | GCA001042655_00221 | CDS | open | 295597-296061 | _na 154_aa | rplK | 50S ribosomal protein L11 |
| 240 | AP012332.1 | GCA001042655_00222 | CDS | open | 296077-296772 | _na 231_aa | rplA | 50S ribosomal protein L1 |
| 241 | AP012332.1 | GCA001042655_00223 | CDS | open | 296860-298149 | _na 429_aa | pucR | PucR C-terminal helix-turn-helix domain-containing protein |
| 242 | AP012332.1 | GCA001042655_00224 | CDS | open | 298146-300284 | _na 712_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 243 | AP012332.1 | GCA001042655_00225 | CDS | open | 300394-301386 | _na 330_aa | birA2 | Putative biotin--[acetyl-CoA-carboxylase] ligase |
| 244 | AP012332.1 | GCA001042655_00226 | CDS | open | 302058-303272 | _na 404_aa | Peptidase | |
| 245 | AP012332.1 | GCA001042655_00227 | CDS | open | 303616-304455 | _na 279_aa | nupO | ABC transporter%2C ATP-binding protein |
| 246 | AP012332.1 | GCA001042655_00228 | CDS | open | 304511-305017 | _na 168_aa | nagC | ROK family protein |
| 247 | AP012332.1 | GCA001042655_00229 | CDS | open | 305126-305689 | _na 187_aa | nagC | ROK family protein |
| 248 | AP012332.1 | GCA001042655_00230 | CDS | open | 305961-307115 | _na 384_aa | xylF | Sugar ABC transporter substrate-binding protein |
| 249 | AP012332.1 | GCA001042655_00231 | CDS | open | 307215-308759 | _na 514_aa | mglA | ABC transporter%2C ATP-binding protein |
| 250 | AP012332.1 | GCA001042655_00232 | CDS | open | 308767-309987 | _na 406_aa | mmsB | multiple monosaccharide ABC transporter permease |
| 251 | AP012332.1 | GCA001042655_00233 | CDS | open | 310124-310354 | _na 76_aa | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase | |
| 252 | AP012332.1 | GCA001042655_00234 | CDS | open | 310428-312041 | _na 537_aa | xylB | FGGY-family carbohydrate kinase |
| 253 | AP012332.1 | GCA001042655_00235 | CDS | open | 312132-312824 | _na 230_aa | araD | L-ribulose-5-phosphate 4-epimerase |
| 254 | AP012332.1 | GCA001042655_00236 | CDS | open | 312876-314390 | _na 504_aa | araA | L-arabinose isomerase |
| 255 | AP012332.1 | GCA001042655_00237 | CDS | open | 314484-315344 | _na 286_aa | aRA1 | Oxidoreductase%2C aldo/keto reductase family protein |
| 256 | AP012332.1 | GCA001042655_00238 | CDS | open | 315619-316443 | _na 274_aa | glnQ | ABC transporter%2C ATP-binding protein |
| 257 | AP012332.1 | GCA001042655_00239 | CDS | open | 316443-317336 | _na 297_aa | hisM | ABC transporter%2C permease protein |
| 258 | AP012332.1 | GCA001042655_00240 | CDS | open | 317490-318359 | _na 289_aa | hisJ | ABC transporter%2C substrate-binding protein%2C family 3 |
| 259 | AP012332.1 | GCA001042655_00241 | CDS | open | 318626-319516 | _na 296_aa | mtnN | Phosphorylase family |
| 260 | AP012332.1 | GCA001042655_00242 | CDS | open | 319529-320077 | _na 182_aa | cFF1 | DUF985 domain-containing protein |
| 261 | AP012332.1 | GCA001042655_00243 | CDS | open | 320155-321576 | _na 473_aa | ssnA | Amidohydrolase family protein |
| 262 | AP012332.1 | GCA001042655_00244 | CDS | open | 321669-323183 | _na 504_aa | sAM1 | adenosylhomocysteinase |
| 263 | AP012332.1 | GCA001042655_00245 | CDS | open | 323218-324663 | _na 481_aa | radA | DNA repair protein RadA |
| 264 | AP012332.1 | GCA001042655_00246 | CDS | open | 324757-325386 | _na 209_aa | DUF4245 domain-containing protein | |
| 265 | AP012332.1 | GCA001042655_00248 | CDS | open | 325797-326495 | _na 232_aa | rpiA | ribose-5-phosphate isomerase RpiA |
| 266 | AP012332.1 | GCA001042655_00249 | CDS | open | 326612-327625 | _na 337_aa | ribonuclease H | |
| 267 | AP012332.1 | GCA001042655_00250 | CDS | open | 327708-329381 | _na 557_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 268 | AP012332.1 | GCA001042655_00251 | CDS | open | 329412-330545 | _na 377_aa | lCB5 | DAGKc domain-containing protein |
| 269 | AP012332.1 | GCA001042655_00252 | CDS | open | 330794-332383 | _na 529_aa | erfK | L%2CD-TPase catalytic domain-containing protein |
| 270 | AP012332.1 | GCA001042655_00253 | CDS | open | 332448-333767 | _na 439_aa | app1 | Phosphatidate phosphatase APP1 catalytic domain-containing protein |
| 271 | AP012332.1 | GCA001042655_00254 | CDS | open | 333836-336337 | _na 833_aa | ptrB | Peptidase%2C S9A/B/C family%2C catalytic domain protein |
| 272 | AP012332.1 | GCA001042655_00255 | CDS | open | 336368-337087 | _na 239_aa | crp | Crp/Fnr family transcriptional regulator |
| 273 | AP012332.1 | GCA001042655_00256 | CDS | open | 337140-339530 | _na 796_aa | mrcB | peptidoglycan glycosyltransferase |
| 274 | AP012332.1 | GCA001042655_00257 | CDS | open | 339649-340803 | _na 384_aa | pyrD | quinone-dependent dihydroorotate dehydrogenase |
| 275 | AP012332.1 | GCA001042655_00258 | CDS | open | 341013-343046 | _na 677_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 276 | AP012332.1 | GCA001042655_00259 | CDS | open | 343133-343897 | _na 254_aa | rph | ribonuclease PH |
| 277 | AP012332.1 | GCA001042655_00260 | CDS | open | 343952-344644 | _na 230_aa | rdgB | dITP/XTP pyrophosphatase |
| 278 | AP012332.1 | GCA001042655_00261 | CDS | open | 344702-345601 | _na 299_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 279 | AP012332.1 | GCA001042655_00262 | CDS | open | 345616-347058 | _na 480_aa | rfbC | dTDP-4-dehydrorhamnose reductase |
| 280 | AP012332.1 | GCA001042655_00263 | CDS | open | 347157-348191 | _na 344_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 281 | AP012332.1 | GCA001042655_00264 | CDS | open | 348249-349022 | _na 257_aa | tagH | ABC transporter ATP-binding protein |
| 282 | AP012332.1 | GCA001042655_00265 | CDS | open | 349073-349936 | _na 287_aa | tagG | Transport permease protein |
| 283 | AP012332.1 | GCA001042655_00266 | CDS | open | 350229-351071 | _na 280_aa | wcaG | NAD dependent epimerase/dehydratase family protein |
| 284 | AP012332.1 | GCA001042655_00267 | CDS | open | 351137-352108 | _na 323_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 285 | AP012332.1 | GCA001042655_00268 | CDS | open | 352148-353842 | _na 564_aa | ATP synthase F0%2C A subunit | |
| 286 | AP012332.1 | GCA001042655_00269 | CDS | open | 354006-355292 | _na 428_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 287 | AP012332.1 | GCA001042655_00270 | CDS | open | 355381-357294 | _na 637_aa | rgpF | Rhamnan synthesis protein F |
| 288 | AP012332.1 | GCA001042655_00271 | CDS | open | 357287-358384 | _na 365_aa | Acyltransferase 3 domain-containing protein | |
| 289 | AP012332.1 | GCA001042655_00272 | CDS | open | 358386-359267 | _na 293_aa | wcaE | Glycosyltransferase%2C group 2 family protein |
| 290 | AP012332.1 | GCA001042655_00273 | CDS | open | 359278-360405 | _na 375_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 291 | AP012332.1 | GCA001042655_00274 | CDS | open | 360462-361688 | _na 408_aa | glf | UDP-galactopyranose mutase |
| 292 | AP012332.1 | GCA001042655_00275 | CDS | open | 361904-363190 | _na 428_aa | serS | serine--tRNA ligase |
| 293 | AP012332.1 | GCA001042655_00276 | CDS | open | 363269-363655 | _na 128_aa | trxA | thioredoxin |
| 294 | AP012332.1 | GCA001042655_00277 | CDS | open | 363790-364794 | _na 334_aa | yabE | G5 domain-containing protein |
| 295 | AP012332.1 | GCA001042655_00278 | CDS | open | 364996-366654 | _na 552_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 296 | AP012332.1 | GCA001042655_00279 | CDS | open | 367452-368252 | _na 266_aa | glpR | Transcriptional regulator%2C DeoR family |
| 297 | AP012332.1 | GCA001042655_00280 | CDS | open | 368522-370363 | _na 613_aa | srmB | DEAD/DEAH box helicase |
| 298 | AP012332.1 | GCA001042655_00281 | CDS | open | 370662-371186 | _na 174_aa | DUF3052 domain-containing protein | |
| 299 | AP012332.1 | GCA001042655_00282 | CDS | open | 371368-373821 | _na 817_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 300 | AP012332.1 | GCA001042655_00283 | CDS | open | 374016-374729 | _na 237_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 301 | AP012332.1 | GCA001042655_00284 | CDS | open | 375158-377038 | _na 626_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 302 | AP012332.1 | GCA001042655_00285 | CDS | open | 377041-379092 | _na 683_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 303 | AP012332.1 | GCA001042655_00288 | CDS | open | 379551-380450 | _na 299_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 304 | AP012332.1 | GCA001042655_00290 | CDS | open | 380867-382279 | _na 470_aa | glmM | phosphoglucosamine mutase |
| 305 | AP012332.1 | GCA001042655_00291 | CDS | open | 382581-383234 | _na 217_aa | def | Peptide deformylase |
| 306 | AP012332.1 | GCA001042655_00292 | CDS | open | 383304-384740 | _na 478_aa | glnA | type I glutamate--ammonia ligase |
| 307 | AP012332.1 | GCA001042655_00293 | CDS | open | 384914-386506 | _na 530_aa | perM | AI-2E family transporter |
| 308 | AP012332.1 | GCA001042655_00294 | CDS | open | 386503-387729 | _na 408_aa | bcsA | Glycosyltransferase 2-like domain-containing protein |
| 309 | AP012332.1 | GCA001042655_00295 | CDS | open | 388238-389116 | _na 292_aa | rbbA | ABC transporter |
| 310 | AP012332.1 | GCA001042655_00296 | CDS | open | 389132-389539 | _na 135_aa | hypothetical protein | |
| 311 | AP012332.1 | GCA001042655_00297 | CDS | open | 389567-390784 | _na 405_aa | ABC transporter permease | |
| 312 | AP012332.1 | GCA001042655_00298 | CDS | open | 390939-392723 | _na 594_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 313 | AP012332.1 | GCA001042655_00299 | CDS | open | 392904-393995 | _na 363_aa | ttcA | tRNA(Ile)-lysidine synthase |
| 314 | AP012332.1 | GCA001042655_00300 | CDS | open | 394065-394619 | _na 184_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 315 | AP012332.1 | GCA001042655_00301 | CDS | open | 394811-397066 | _na 751_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 316 | AP012332.1 | GCA001042655_00302 | CDS | open | 397164-398225 | _na 353_aa | Dihydroneopterin aldolase | |
| 317 | AP012332.1 | GCA001042655_00303 | CDS | open | 398225-398734 | _na 169_aa | DUF3180 domain-containing protein | |
| 318 | AP012332.1 | GCA001042655_00304 | CDS | open | 398877-400553 | _na 558_aa | ettA | energy-dependent translational throttle protein EttA |
| 319 | AP012332.1 | GCA001042655_00305 | CDS | open | 400624-401622 | _na 332_aa | fmhB | FemAB family protein |
| 320 | AP012332.1 | GCA001042655_00306 | CDS | open | 402181-408450 | _na 2089_aa | smc | Putative ATP synthase F1%2C delta subunit |
| 321 | AP012332.1 | GCA001042655_00307 | CDS | open | 408948-409115 | _na 55_aa | hypothetical protein | |
| 322 | AP012332.1 | GCA001042655_00308 | CDS | open | 409156-409986 | _na 276_aa | ugpE | ABC transporter%2C permease protein |
| 323 | AP012332.1 | GCA001042655_00309 | CDS | open | 409986-410930 | _na 314_aa | ugpA | ABC transporter%2C permease protein |
| 324 | AP012332.1 | GCA001042655_00310 | CDS | open | 411074-412327 | _na 417_aa | ugpB | MalE-type ABC sugar transport system periplasmic component |
| 325 | AP012332.1 | GCA001042655_00311 | CDS | open | 412638-414257 | _na 539_aa | yicI | Glycosyl hydrolase%2C family 31 |
| 326 | AP012332.1 | GCA001042655_00312 | CDS | open | 414352-415464 | _na 370_aa | purR | Transcriptional regulator%2C LacI family |
| 327 | AP012332.1 | GCA001042655_00313 | CDS | open | 415511-416245 | _na 244_aa | Sugar ABC transporter substrate-binding protein | |
| 328 | AP012332.1 | GCA001042655_00314 | CDS | open | 416232-418961 | _na 909_aa | mgtA | E1-E2 ATPase |
| 329 | AP012332.1 | GCA001042655_00315 | CDS | open | 419107-420591 | _na 494_aa | sdaA | L-serine ammonia-lyase |
| 330 | AP012332.1 | GCA001042655_00316 | CDS | open | 420827-421234 | _na 135_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 331 | AP012332.1 | GCA001042655_00317 | CDS | open | 421301-421780 | _na 159_aa | greA | Transcription elongation factor GreA |
| 332 | AP012332.1 | GCA001042655_00318 | CDS | open | 421948-422667 | _na 239_aa | lexA | transcriptional repressor LexA |
| 333 | AP012332.1 | GCA001042655_00319 | CDS | open | 422839-423207 | _na 122_aa | lysM | LysM domain-containing protein |
| 334 | AP012332.1 | GCA001042655_00320 | CDS | open | 423253-423444 | _na 63_aa | GNAT family acetyltransferase | |
| 335 | AP012332.1 | GCA001042655_00321 | CDS | open | 423498-423947 | _na 149_aa | nrdR | transcriptional regulator NrdR |
| 336 | AP012332.1 | GCA001042655_00322 | CDS | open | 424022-426298 | _na 758_aa | helD | DNA 3'-5' helicase |
| 337 | AP012332.1 | GCA001042655_00323 | CDS | open | 426527-427300 | _na 257_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 338 | AP012332.1 | GCA001042655_00324 | CDS | open | 427297-428373 | _na 358_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 339 | AP012332.1 | GCA001042655_00325 | CDS | open | 428373-429005 | _na 210_aa | ftsL | Cell division protein FtsL |
| 340 | AP012332.1 | GCA001042655_00326 | CDS | open | 429005-431098 | _na 697_aa | Cell division protein | |
| 341 | AP012332.1 | GCA001042655_00327 | CDS | open | 431127-432371 | _na 414_aa | UDP-N-acetylmuramyl peptide synthase | |
| 342 | AP012332.1 | GCA001042655_00328 | CDS | open | 432465-434195 | _na 576_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 343 | AP012332.1 | GCA001042655_00329 | CDS | open | 434192-435295 | _na 367_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 344 | AP012332.1 | GCA001042655_00330 | CDS | open | 435374-436951 | _na 525_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 345 | AP012332.1 | GCA001042655_00331 | CDS | open | 436938-438266 | _na 442_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 346 | AP012332.1 | GCA001042655_00332 | CDS | open | 438399-439625 | _na 408_aa | murG | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase |
| 347 | AP012332.1 | GCA001042655_00333 | CDS | open | 439640-441139 | _na 499_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 348 | AP012332.1 | GCA001042655_00334 | CDS | open | 441204-442337 | _na 377_aa | ftsQ | POTRA domain protein%2C FtsQ-type |
| 349 | AP012332.1 | GCA001042655_00335 | CDS | open | 442617-442988 | _na 123_aa | rpsL | 30S ribosomal protein S12 |
| 350 | AP012332.1 | GCA001042655_00336 | CDS | open | 442992-443462 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 351 | AP012332.1 | GCA001042655_00337 | CDS | open | 443505-445634 | _na 709_aa | fusA | elongation factor G |
| 352 | AP012332.1 | GCA001042655_00338 | CDS | open | 445805-447004 | _na 399_aa | tuf | elongation factor Tu |
| 353 | AP012332.1 | GCA001042655_00340 | CDS | open | 448288-451827 | _na 1179_aa | aprE | Peptidase |
| 354 | AP012332.1 | GCA001042655_00341 | CDS | open | 451942-454302 | _na 786_aa | hypothetical protein | |
| 355 | AP012332.1 | GCA001042655_00342 | CDS | open | 454395-455810 | _na 471_aa | xseA | exodeoxyribonuclease VII large subunit |
| 356 | AP012332.1 | GCA001042655_00343 | CDS | open | 455920-456228 | _na 102_aa | xseB | exodeoxyribonuclease VII small subunit |
| 357 | AP012332.1 | GCA001042655_00345 | CDS | open | 456607-460017 | _na 1136_aa | ileS | mupirocin-resistant isoleucine--tRNA ligase |
| 358 | AP012332.1 | GCA001042655_00346 | CDS | open | 460300-461187 | _na 295_aa | dppC | Putative dipeptide transport system permease protein DppC |
| 359 | AP012332.1 | GCA001042655_00347 | CDS | open | 461184-462191 | _na 335_aa | dppB | ABC transporter%2C permease protein |
| 360 | AP012332.1 | GCA001042655_00348 | CDS | open | 462334-464082 | _na 582_aa | ddpA | ABC transporter%2C substrate-binding protein%2C family 5 |
| 361 | AP012332.1 | GCA001042655_00349 | CDS | open | 464099-465724 | _na 541_aa | nikD | nickel import ATP-binding protein NikD |
| 362 | AP012332.1 | GCA001042655_00350 | CDS | open | 465775-466557 | _na 260_aa | murI | glutamate racemase |
| 363 | AP012332.1 | GCA001042655_00351 | CDS | open | 466635-467339 | _na 234_aa | Vitamin K epoxide reductase domain-containing protein | |
| 364 | AP012332.1 | GCA001042655_00352 | CDS | open | 467421-468308 | _na 295_aa | yciV | PHP domain protein |
| 365 | AP012332.1 | GCA001042655_00353 | CDS | open | 468317-468541 | _na 74_aa | ATP-binding protein | |
| 366 | AP012332.1 | GCA001042655_00354 | CDS | open | 468624-470168 | _na 514_aa | ycbJ | Aminoglycoside phosphotransferase domain-containing protein |
| 367 | AP012332.1 | GCA001042655_00355 | CDS | open | 470320-471903 | _na 527_aa | uvrD | DNA 3'-5' helicase |
| 368 | AP012332.1 | GCA001042655_00356 | CDS | open | 472029-473855 | _na 608_aa | zincin | Hydrolase |
| 369 | AP012332.1 | GCA001042655_00357 | CDS | open | 474075-475016 | _na 313_aa | sdrC | endopeptidase La |
| 370 | AP012332.1 | GCA001042655_00358 | CDS | open | 475638-480452 | _na 1604_aa | Long Rib domain-containing protein | |
| 371 | AP012332.1 | GCA001042655_00359 | CDS | open | 480489-481154 | _na 221_aa | LPXTG-motif cell wall anchor domain protein | |
| 372 | AP012332.1 | GCA001042655_00360 | CDS | open | 481437-483089 | _na 550_aa | LPXTG-motif cell wall anchor domain protein | |
| 373 | AP012332.1 | GCA001042655_00361 | CDS | open | 483286-484437 | _na 383_aa | srtA | Sortase family protein |
| 374 | AP012332.1 | GCA001042655_00363 | CDS | open | 484778-486304 | _na 508_aa | DivIVA domain repeat protein | |
| 375 | AP012332.1 | GCA001042655_00364 | CDS | open | 486351-487085 | _na 244_aa | recO | DNA repair protein RecO |
| 376 | AP012332.1 | GCA001042655_00365 | CDS | open | 487345-487965 | _na 206_aa | ykoE | ABC transporter permease |
| 377 | AP012332.1 | GCA001042655_00366 | CDS | open | 488156-489079 | _na 307_aa | tauA | Thiamine pyrimidine synthase |
| 378 | AP012332.1 | GCA001042655_00367 | CDS | open | 489209-490426 | _na 405_aa | srkA | Phosphotransferase enzyme family |
| 379 | AP012332.1 | GCA001042655_00368 | CDS | open | 490531-491325 | _na 264_aa | uppS | isoprenyl transferase |
| 380 | AP012332.1 | GCA001042655_00369 | CDS | open | 491352-492581 | _na 409_aa | abgB | Peptidase M20 dimerisation domain-containing protein |
| 381 | AP012332.1 | GCA001042655_00370 | CDS | open | 492646-493020 | _na 124_aa | yqgV | Thiamine-binding protein domain-containing protein |
| 382 | AP012332.1 | GCA001042655_00371 | CDS | open | 493191-494711 | _na 506_aa | gRS1 | glycine--tRNA ligase |
| 383 | AP012332.1 | GCA001042655_00372 | CDS | open | 494781-495935 | _na 384_aa | dusB | tRNA dihydrouridine synthase DusB |
| 384 | AP012332.1 | GCA001042655_00373 | CDS | open | 496162-497364 | _na 400_aa | ftsZ | cell division protein FtsZ |
| 385 | AP012332.1 | GCA001042655_00374 | CDS | open | 497389-497856 | _na 155_aa | sepF | Cell division protein SepF |
| 386 | AP012332.1 | GCA001042655_00375 | CDS | open | 498042-498338 | _na 98_aa | ycf19 | Hemolysin-like protein |
| 387 | AP012332.1 | GCA001042655_00376 | CDS | open | 498512-499828 | _na 438_aa | Cell wall synthesis protein Wag31 | |
| 388 | AP012332.1 | GCA001042655_00377 | CDS | open | 499877-500356 | _na 159_aa | lspA | Lipoprotein signal peptidase |
| 389 | AP012332.1 | GCA001042655_00378 | CDS | open | 500366-501298 | _na 310_aa | rluA | Pseudouridine synthase |
| 390 | AP012332.1 | GCA001042655_00379 | CDS | open | 501351-504902 | _na 1183_aa | dnaE | DNA polymerase III subunit alpha |
| 391 | AP012332.1 | GCA001042655_00380 | CDS | open | 504964-505659 | _na 231_aa | sseB | SseB protein N-terminal domain-containing protein |
| 392 | AP012332.1 | GCA001042655_00381 | CDS | open | 505813-507150 | _na 445_aa | glnA | type I glutamate--ammonia ligase |
| 393 | AP012332.1 | GCA001042655_00382 | CDS | open | 507550-508506 | _na 318_aa | uRH1 | Inosine-uridine preferring nucleoside hydrolase |
| 394 | AP012332.1 | GCA001042655_00383 | CDS | open | 508617-510020 | _na 467_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 395 | AP012332.1 | GCA001042655_00384 | CDS | open | 510121-514188 | _na 1355_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 396 | AP012332.1 | GCA001042655_00385 | CDS | open | 514217-514918 | _na 233_aa | rsmC | Methyltransferase small domain-containing protein |
| 397 | AP012332.1 | GCA001042655_00386 | CDS | open | 515040-516557 | _na 505_aa | hflX | GTPase HflX |
| 398 | AP012332.1 | GCA001042655_00387 | CDS | open | 516691-517653 | _na 320_aa | mdh | L-lactate dehydrogenase |
| 399 | AP012332.1 | GCA001042655_00388 | CDS | open | 517812-519158 | _na 448_aa | csdA | Cysteine desulfurase |
| 400 | AP012332.1 | GCA001042655_00389 | CDS | open | 519225-519872 | _na 215_aa | sufU | Fe-S cluster assembly sulfur transfer protein SufU |
| 401 | AP012332.1 | GCA001042655_00390 | CDS | open | 519926-520366 | _na 146_aa | paaD | MIP18 family-like domain-containing protein |
| 402 | AP012332.1 | GCA001042655_00391 | CDS | open | 520380-521042 | _na 220_aa | Alpha/beta hydrolase | |
| 403 | AP012332.1 | GCA001042655_00392 | CDS | open | 521068-521697 | _na 209_aa | DUF4125 domain-containing protein | |
| 404 | AP012332.1 | GCA001042655_00393 | CDS | open | 521697-523754 | _na 685_aa | Tetratricopeptide repeat protein | |
| 405 | AP012332.1 | GCA001042655_00395 | CDS | open | 524390-526063 | _na 557_aa | lysS | lysine--tRNA ligase |
| 406 | AP012332.1 | GCA001042655_00396 | CDS | open | 526191-526931 | _na 246_aa | phosphoglyceromutase | |
| 407 | AP012332.1 | GCA001042655_00397 | CDS | open | 527041-527721 | _na 226_aa | phoU | phosphate signaling complex protein PhoU |
| 408 | AP012332.1 | GCA001042655_00398 | CDS | open | 527889-529316 | _na 475_aa | baeS | Sensor-like histidine kinase SenX3 |
| 409 | AP012332.1 | GCA001042655_00399 | CDS | open | 529340-529606 | _na 88_aa | DUF2530 domain-containing protein | |
| 410 | AP012332.1 | GCA001042655_00400 | CDS | open | 529793-530797 | _na 334_aa | CHAP domain protein | |
| 411 | AP012332.1 | GCA001042655_00401 | CDS | open | 530974-531714 | _na 246_aa | nlpC | NlpC/P60 domain-containing protein |
| 412 | AP012332.1 | GCA001042655_00402 | CDS | open | 531659-531772 | _na 37_aa | hypothetical protein | |
| 413 | AP012332.1 | GCA001042655_00403 | CDS | open | 531927-532970 | _na 347_aa | uspA | Universal stress family protein |
| 414 | AP012332.1 | GCA001042655_00404 | CDS | open | 533104-534342 | _na 412_aa | rfaB | Glycosyltransferase%2C group 1 family protein |
| 415 | AP012332.1 | GCA001042655_00405 | CDS | open | 534434-534853 | _na 139_aa | yhfA | OsmC-like protein |
| 416 | AP012332.1 | GCA001042655_00406 | CDS | open | 535048-535920 | _na 290_aa | thyA | thymidylate synthase |
| 417 | AP012332.1 | GCA001042655_00407 | CDS | open | 535969-536601 | _na 210_aa | folA | dihydrofolate reductase |
| 418 | AP012332.1 | GCA001042655_00408 | CDS | open | 536610-537155 | _na 181_aa | wzb | protein-tyrosine-phosphatase |
| 419 | AP012332.1 | GCA001042655_00409 | CDS | open | 537263-538048 | _na 261_aa | DUF4191 domain-containing protein | |
| 420 | AP012332.1 | GCA001042655_00410 | CDS | open | 538176-538832 | _na 218_aa | DUF3043 domain-containing protein | |
| 421 | AP012332.1 | GCA001042655_00411 | CDS | open | 538949-540316 | _na 455_aa | argE | Peptidase M20 dimerisation domain-containing protein |
| 422 | AP012332.1 | GCA001042655_00412 | CDS | open | 540781-543393 | _na 870_aa | ecfA2 | Cobalt transport protein |
| 423 | AP012332.1 | GCA001042655_00414 | CDS | open | 543561-545168 | _na 535_aa | thiM | hydroxyethylthiazole kinase |
| 424 | AP012332.1 | GCA001042655_00415 | CDS | open | 545344-545553 | _na 69_aa | hypothetical protein | |
| 425 | AP012332.1 | GCA001042655_00416 | CDS | open | 545743-546369 | _na 208_aa | ABC transporter | |
| 426 | AP012332.1 | GCA001042655_00417 | CDS | open | 546491-547072 | _na 193_aa | mreD | Rod shape-determining protein MreD |
| 427 | AP012332.1 | GCA001042655_00418 | CDS | open | 547181-548998 | _na 605_aa | yejF | energy-coupling factor transporter ATPase |
| 428 | AP012332.1 | GCA001042655_00419 | CDS | open | 549017-549790 | _na 257_aa | ecfT | Cobalt transport protein |
| 429 | AP012332.1 | GCA001042655_00420 | CDS | open | 549848-550930 | _na 360_aa | menA | 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase |
| 430 | AP012332.1 | GCA001042655_00421 | CDS | open | 551158-551946 | _na 262_aa | amiR | Response regulator |
| 431 | AP012332.1 | GCA001042655_00422 | CDS | open | 552069-555170 | _na 1033_aa | polA | DNA polymerase I |
| 432 | AP012332.1 | GCA001042655_00423 | CDS | open | 555240-556097 | _na 285_aa | nIF3 | Nif3-like dinuclear metal center hexameric protein |
| 433 | AP012332.1 | GCA001042655_00425 | CDS | open | 556335-558326 | _na 663_aa | sdhA | succinate dehydrogenase |
| 434 | AP012332.1 | GCA001042655_00426 | CDS | open | 558356-559870 | _na 504_aa | dprA | DNA-processing protein DprA |
| 435 | AP012332.1 | GCA001042655_00427 | CDS | open | 559867-561552 | _na 561_aa | yifB | AAA+ ATPase domain-containing protein |
| 436 | AP012332.1 | GCA001042655_00428 | CDS | open | 561552-562013 | _na 153_aa | yraN | UPF0102 protein CG405_02295 |
| 437 | AP012332.1 | GCA001042655_00429 | CDS | open | 562246-564384 | _na 712_aa | glgX | glycogen debranching protein GlgX |
| 438 | AP012332.1 | GCA001042655_00430 | CDS | open | 564458-565555 | _na 365_aa | ABC transporter permease | |
| 439 | AP012332.1 | GCA001042655_00432 | CDS | open | 566110-566712 | _na 200_aa | ykoE | ABC transporter permease |
| 440 | AP012332.1 | GCA001042655_00433 | CDS | open | 566910-568499 | _na 529_aa | ecfA2 | energy-coupling factor transporter ATPase |
| 441 | AP012332.1 | GCA001042655_00434 | CDS | open | 568502-569395 | _na 297_aa | ecfT | Cobalt transport protein |
| 442 | AP012332.1 | GCA001042655_00435 | CDS | open | 569458-570828 | _na 456_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 443 | AP012332.1 | GCA001042655_00436 | CDS | open | 570941-572170 | _na 409_aa | ackA | Acetate kinase |
| 444 | AP012332.1 | GCA001042655_00437 | CDS | open | 572310-573974 | _na 554_aa | pta | phosphate acetyltransferase |
| 445 | AP012332.1 | GCA001042655_00438 | CDS | open | 574226-576703 | _na 825_aa | xFP | phosphoketolase |
| 446 | AP012332.1 | GCA001042655_00439 | CDS | open | 577119-578681 | _na 520_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 447 | AP012332.1 | GCA001042655_00440 | CDS | open | 578769-580454 | _na 561_aa | amyA | Alpha-amylase |
| 448 | AP012332.1 | GCA001042655_00442 | CDS | open | 581245-581991 | _na 248_aa | gepA | Antitoxin SocA-like Panacea domain-containing protein |
| 449 | AP012332.1 | GCA001042655_00443 | CDS | open | 582363-583352 | _na 329_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 450 | AP012332.1 | GCA001042655_00444 | CDS | open | 583504-584505 | _na 333_aa | czcD | Cation diffusion facilitator family transporter |
| 451 | AP012332.1 | GCA001042655_00445 | CDS | open | 584574-585539 | _na 321_aa | spoU | RNA methyltransferase%2C TrmH family |
| 452 | AP012332.1 | GCA001042655_00446 | CDS | open | 585558-586667 | _na 369_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 453 | AP012332.1 | GCA001042655_00447 | CDS | open | 586673-589297 | _na 874_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 454 | AP012332.1 | GCA001042655_00448 | CDS | open | 589492-590115 | _na 207_aa | argR | Arginine repressor |
| 455 | AP012332.1 | GCA001042655_00449 | CDS | open | 590401-591615 | _na 404_aa | argG | argininosuccinate synthase |
| 456 | AP012332.1 | GCA001042655_00450 | CDS | open | 591646-593151 | _na 501_aa | argH | argininosuccinate lyase |
| 457 | AP012332.1 | GCA001042655_00451 | CDS | open | 593218-594537 | _na 439_aa | tyrS | tyrosine--tRNA ligase |
| 458 | AP012332.1 | GCA001042655_00452 | CDS | open | 594621-596186 | _na 521_aa | Tetratricopeptide repeat protein | |
| 459 | AP012332.1 | GCA001042655_00453 | CDS | open | 596285-597382 | _na 365_aa | nagD | HAD family hydrolase |
| 460 | AP012332.1 | GCA001042655_00454 | CDS | open | 597421-598200 | _na 259_aa | yqxC | Ribosomal RNA large subunit methyltransferase J |
| 461 | AP012332.1 | GCA001042655_00455 | CDS | open | 598309-599337 | _na 342_aa | nadK | NAD kinase |
| 462 | AP012332.1 | GCA001042655_00456 | CDS | open | 599347-601125 | _na 592_aa | recN | DNA repair protein RecN |
| 463 | AP012332.1 | GCA001042655_00457 | CDS | open | 601190-601888 | _na 232_aa | ycjU | HAD hydrolase%2C family IA%2C variant 3 |
| 464 | AP012332.1 | GCA001042655_00459 | CDS | open | 602415-603089 | _na 224_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 465 | AP012332.1 | GCA001042655_00460 | CDS | open | 603302-606073 | _na 923_aa | secA | preprotein translocase subunit SecA |
| 466 | AP012332.1 | GCA001042655_00461 | CDS | open | 606173-606715 | _na 180_aa | Membrane associated protein | |
| 467 | AP012332.1 | GCA001042655_00462 | CDS | open | 606792-607481 | _na 229_aa | plsC | Acyltransferase |
| 468 | AP012332.1 | GCA001042655_00463 | CDS | open | 607615-609936 | _na 773_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 469 | AP012332.1 | GCA001042655_00464 | CDS | open | 610027-611127 | _na 366_aa | ispA | Polyprenyl synthetase |
| 470 | AP012332.1 | GCA001042655_00465 | CDS | open | 611288-612238 | _na 316_aa | DUF4192 domain-containing protein | |
| 471 | AP012332.1 | GCA001042655_00466 | CDS | open | 612369-613673 | _na 434_aa | rpoD | RNA polymerase sigma factor |
| 472 | AP012332.1 | GCA001042655_00467 | CDS | open | 613782-616142 | _na 786_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) |
| 473 | AP012332.1 | GCA001042655_00468 | CDS | open | 616361-616564 | _na 67_aa | priA | Primosome assembly protein PriA |
| 474 | AP012332.1 | GCA001042655_00469 | CDS | open | 616939-618540 | _na 533_aa | Repeat protein | |
| 475 | AP012332.1 | GCA001042655_00470 | CDS | open | 618748-619047 | _na 99_aa | DUF3791 domain-containing protein | |
| 476 | AP012332.1 | GCA001042655_00471 | CDS | open | 619007-619234 | _na 75_aa | DUF3791 domain-containing protein | |
| 477 | AP012332.1 | GCA001042655_00472 | CDS | open | 619354-619533 | _na 59_aa | priA | Primosome assembly protein PriA |
| 478 | AP012332.1 | GCA001042655_00473 | CDS | open | 619665-621548 | _na 627_aa | LPXTG-motif cell wall anchor domain protein | |
| 479 | AP012332.1 | GCA001042655_00474 | CDS | open | 621693-622802 | _na 369_aa | gepA | Antitoxin SocA-like Panacea domain-containing protein |
| 480 | AP012332.1 | GCA001042655_00475 | CDS | open | 622860-623267 | _na 135_aa | hypothetical protein | |
| 481 | AP012332.1 | GCA001042655_00476 | CDS | open | 623577-623753 | _na 58_aa | hypothetical protein | |
| 482 | AP012332.1 | GCA001042655_00477 | CDS | open | 623746-624924 | _na 392_aa | fucP | Major facilitator superfamily (MFS) profile domain-containing protein |
| 483 | AP012332.1 | GCA001042655_00478 | CDS | open | 625143-625358 | _na 71_aa | priA | Primosome assembly protein PriA |
| 484 | AP012332.1 | GCA001042655_00479 | CDS | open | 626015-627349 | _na 444_aa | Ig-like domain-containing protein | |
| 485 | AP012332.1 | GCA001042655_00480 | CDS | open | 627593-630247 | _na 884_aa | Repeat protein | |
| 486 | AP012332.1 | GCA001042655_00481 | CDS | open | 630513-633182 | _na 889_aa | gyrA | DNA topoisomerase (ATP-hydrolyzing) |
| 487 | AP012332.1 | GCA001042655_00482 | CDS | open | 633330-634532 | _na 400_aa | ataC | Nucleotide pyrophosphatase |
| 488 | AP012332.1 | GCA001042655_00483 | CDS | open | 634544-635875 | _na 443_aa | sepH | septation protein SepH |
| 489 | AP012332.1 | GCA001042655_00484 | CDS | open | 636081-636374 | _na 97_aa | dUTPase | |
| 490 | AP012332.1 | GCA001042655_00485 | CDS | open | 636374-636871 | _na 165_aa | dut | dUTP diphosphatase |
| 491 | AP012332.1 | GCA001042655_00486 | CDS | open | 637032-639371 | _na 779_aa | spoT | GTP diphosphokinase |
| 492 | AP012332.1 | GCA001042655_00487 | CDS | open | 639475-640014 | _na 179_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 493 | AP012332.1 | GCA001042655_00488 | CDS | open | 640162-642807 | _na 881_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 494 | AP012332.1 | GCA001042655_00489 | CDS | open | 643083-643766 | _na 227_aa | metP | Metal ABC transporter permease |
| 495 | AP012332.1 | GCA001042655_00490 | CDS | open | 643769-644593 | _na 274_aa | abcC | ABC transporter%2C ATP-binding protein |
| 496 | AP012332.1 | GCA001042655_00491 | CDS | open | 644698-645546 | _na 282_aa | nlpA | Lipoprotein |
| 497 | AP012332.1 | GCA001042655_00492 | CDS | open | 645837-647552 | _na 571_aa | nit1 | NAD+ synthase |
| 498 | AP012332.1 | GCA001042655_00493 | CDS | open | 647794-648462 | _na 222_aa | Formate C-acetyltransferase | |
| 499 | AP012332.1 | GCA001042655_00494 | CDS | open | 648514-650169 | _na 551_aa | Formate acetyltransferase | |
| 500 | AP012332.1 | GCA001042655_00495 | CDS | open | 650291-651172 | _na 293_aa | pflA | pyruvate formate-lyase-activating protein |

