HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium striatum (GCA_001053435.1)

Select a Genome:
BAKTA Annotations for GCA_001053435.1
Genome Selected: Corynebacterium striatum
ContigsBases CDSrRNA tmRNAtRNA
94 2905202 2693 6 1 56
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5526 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 5526 [12 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 JVTL01000070.1 GCA001053435_01147 gene open 62897-64381 gatA
4502 JVTL01000070.1 GCA001053435_01148 gene open 64387-65172
4503 JVTL01000070.1 GCA001053435_01149 gene open 65292-65615
4504 JVTL01000070.1 GCA001053435_01150 gene open 65645-67063
4505 JVTL01000070.1 GCA001053435_01151 gene open 67038-68105
4506 JVTL01000070.1 GCA001053435_01152 gene open 68250-69755 gatB
4507 JVTL01000070.1 GCA001053435_01153 gene open 69840-70892
4508 JVTL01000070.1 GCA001053435_01154 gene open 71046-72476 ykvI
4509 JVTL01000070.1 GCA001053435_01155 gene open 72482-73756
4510 JVTL01000070.1 GCA001053435_01156 gene open 73908-74576
4511 JVTL01000070.1 GCA001053435_01157 gene open 74646-75506
4512 JVTL01000070.1 GCA001053435_01158 gene open 75520-76611
4513 JVTL01000070.1 GCA001053435_01159 gene open 76849-78057 doxX
4514 JVTL01000070.1 GCA001053435_01160 gene open 78177-78449
4515 JVTL01000070.1 GCA001053435_01161 gene open 78442-78735 marR
4516 JVTL01000070.1 GCA001053435_01162 gene open 78728-80014
4517 JVTL01000070.1 GCA001053435_01163 gene open 80072-81925 ilvD
4518 JVTL01000070.1 GCA001053435_01164 gene open 81990-82553
4519 JVTL01000070.1 GCA001053435_01165 gene open 82952-84799
4520 JVTL01000070.1 GCA001053435_01166 gene open 84805-85320 ilvN
4521 JVTL01000070.1 GCA001053435_01167 gene open 85410-86423 ilvC
4522 JVTL01000070.1 GCA001053435_01168 gene open 87021-87287
4523 JVTL01000070.1 GCA001053435_01169 gene open 87737-87922
4524 JVTL01000070.1 GCA001053435_01170 gene open 88274-88456
4525 JVTL01000071.1 GCA001053435_01171 gene open 82-199 rrf
4526 JVTL01000071.1 GCA001053435_01171 rRNA open 82-199 rrf 5S ribosomal RNA
4527 JVTL01000071.1 GCA001053435_01172 CDS open 610-1005 _na     131_aa Secreted protein
4528 JVTL01000071.1 GCA001053435_01173 CDS open 1002-1661 _na     219_aa TPR-repeat-containing protein
4529 JVTL01000071.1 GCA001053435_01174 CDS open 1664-2647 _na     327_aa HAD-IIA family hydrolase
4530 JVTL01000071.1 GCA001053435_01175 CDS open 2638-2799 _na     53_aa Peptide chain release factor 2
4531 JVTL01000071.1 GCA001053435_01176 CDS open 2799-3608 _na     269_aa putative rRNA methylase
4532 JVTL01000071.1 GCA001053435_01177 CDS open 3605-4486 _na     293_aa NAD kinase
4533 JVTL01000071.1 GCA001053435_01178 CDS open 4515-6191 _na     558_aa recN DNA repair protein RecN
4534 JVTL01000071.1 GCA001053435_01179 CDS open 6218-7402 _na     394_aa steA putative cytokinetic ring protein SteA
4535 JVTL01000071.1 GCA001053435_01180 CDS open 7402-8322 _na     306_aa Copper transporter
4536 JVTL01000071.1 GCA001053435_01181 CDS open 8324-8962 _na     212_aa NTP pyrophosphohydrolase
4537 JVTL01000071.1 GCA001053435_01182 CDS open 8959-9855 _na     298_aa xerD site-specific tyrosine recombinase XerD
4538 JVTL01000071.1 GCA001053435_01183 CDS open 10148-11026 _na     292_aa Partitioning protein
4539 JVTL01000071.1 GCA001053435_01184 CDS open 11038-11835 _na     265_aa Segregation and condensation protein A
4540 JVTL01000071.1 GCA001053435_01185 CDS open 11929-12474 _na     181_aa scpB SMC-Scp complex subunit ScpB
4541 JVTL01000071.1 GCA001053435_01186 CDS open 12613-13533 _na     306_aa Pseudouridine synthase
4542 JVTL01000071.1 GCA001053435_01187 CDS open 13545-14240 _na     231_aa cmk (d)CMP kinase
4543 JVTL01000071.1 GCA001053435_01188 CDS open 14233-15858 _na     541_aa der ribosome biogenesis GTPase Der
4544 JVTL01000071.1 GCA001053435_01189 CDS open 16035-17420 _na     461_aa Anaerobic C4-dicarboxylate transporter
4545 JVTL01000071.1 GCA001053435_01190 CDS open 17417-18226 _na     269_aa Methyltransferase
4546 JVTL01000071.1 GCA001053435_01191 CDS open 18294-18653 _na     119_aa hypothetical protein
4547 JVTL01000071.1 GCA001053435_01192 CDS open 18688-19764 _na     358_aa ABC transporter ATP-binding protein
4548 JVTL01000071.1 GCA001053435_01193 CDS open 19767-21542 _na     591_aa ABC transporter ATP-binding protein
4549 JVTL01000071.1 GCA001053435_01194 CDS open 21684-22523 _na     279_aa Secreted esterase B
4550 JVTL01000071.1 GCA001053435_01195 CDS open 22520-23833 _na     437_aa Adenine-specific DNA methyltransferase
4551 JVTL01000071.1 GCA001053435_01196 CDS open 24167-24346 _na     59_aa Antitoxin
4552 JVTL01000071.1 GCA001053435_01197 CDS open 24745-25797 _na     350_aa istA IS21 family transposase
4553 JVTL01000071.1 GCA001053435_01172 gene open 610-1005
4554 JVTL01000071.1 GCA001053435_01173 gene open 1002-1661
4555 JVTL01000071.1 GCA001053435_01174 gene open 1664-2647
4556 JVTL01000071.1 GCA001053435_01175 gene open 2638-2799
4557 JVTL01000071.1 GCA001053435_01176 gene open 2799-3608
4558 JVTL01000071.1 GCA001053435_01177 gene open 3605-4486
4559 JVTL01000071.1 GCA001053435_01178 gene open 4515-6191 recN
4560 JVTL01000071.1 GCA001053435_01179 gene open 6218-7402 steA
4561 JVTL01000071.1 GCA001053435_01180 gene open 7402-8322
4562 JVTL01000071.1 GCA001053435_01181 gene open 8324-8962
4563 JVTL01000071.1 GCA001053435_01182 gene open 8959-9855 xerD
4564 JVTL01000071.1 GCA001053435_01183 gene open 10148-11026
4565 JVTL01000071.1 GCA001053435_01184 gene open 11038-11835
4566 JVTL01000071.1 GCA001053435_01185 gene open 11929-12474 scpB
4567 JVTL01000071.1 GCA001053435_01186 gene open 12613-13533
4568 JVTL01000071.1 GCA001053435_01187 gene open 13545-14240 cmk
4569 JVTL01000071.1 GCA001053435_01188 gene open 14233-15858 der
4570 JVTL01000071.1 GCA001053435_01189 gene open 16035-17420
4571 JVTL01000071.1 GCA001053435_01190 gene open 17417-18226
4572 JVTL01000071.1 GCA001053435_01191 gene open 18294-18653
4573 JVTL01000071.1 GCA001053435_01192 gene open 18688-19764
4574 JVTL01000071.1 GCA001053435_01193 gene open 19767-21542
4575 JVTL01000071.1 GCA001053435_01194 gene open 21684-22523
4576 JVTL01000071.1 GCA001053435_01195 gene open 22520-23833
4577 JVTL01000071.1 GCA001053435_01196 gene open 24167-24346
4578 JVTL01000071.1 GCA001053435_01197 gene open 24745-25797 istA
4579 JVTL01000072.1 GCA001053435_01198 CDS open 816-1382 _na     188_aa gcrR GcrR
4580 JVTL01000072.1 GCA001053435_01199 CDS open 1772-2152 _na     126_aa Transcriptional regulator
4581 JVTL01000072.1 GCA001053435_01198 gene open 816-1382 gcrR
4582 JVTL01000072.1 GCA001053435_01199 gene open 1772-2152
4583 JVTL01000073.1 GCA001053435_01200 CDS open 650-1810 _na     386_aa rtcB 3'-phosphate/5'-hydroxy nucleic acid ligase
4584 JVTL01000073.1 GCA001053435_01201 CDS open 1948-3225 _na     425_aa Fido domain-containing protein
4585 JVTL01000073.1 GCA001053435_01202 CDS open 3631-3972 _na     113_aa IS3 family transposase
4586 JVTL01000073.1 GCA001053435_01203 CDS open 3979-4527 _na     182_aa IS3 family transposase
4587 JVTL01000073.1 GCA001053435_01200 gene open 650-1810 rtcB
4588 JVTL01000073.1 GCA001053435_01201 gene open 1948-3225
4589 JVTL01000073.1 GCA001053435_01202 gene open 3631-3972
4590 JVTL01000073.1 GCA001053435_01203 gene open 3979-4527
4591 JVTL01000074.1 GCA001053435_01204 CDS open 590-1288 _na     232_aa Abi family protein
4592 JVTL01000074.1 GCA001053435_01205 CDS open 1521-2525 _na     334_aa tnpB RNA-guided endonuclease TnpB family protein
4593 JVTL01000074.1 GCA001053435_01206 CDS open 2779-3075 _na     98_aa helix-turn-helix domain-containing protein
4594 JVTL01000074.1 GCA001053435_01207 CDS open 3779-4987 _na     402_aa IS110 family transposase
4595 JVTL01000074.1 GCA001053435_01208 CDS open 5381-5635 _na     84_aa hypothetical protein
4596 JVTL01000074.1 GCA001053435_01209 CDS open 5722-5940 _na     72_aa hypothetical protein
4597 JVTL01000074.1 GCA001053435_01204 gene open 590-1288
4598 JVTL01000074.1 GCA001053435_01205 gene open 1521-2525 tnpB
4599 JVTL01000074.1 GCA001053435_01206 gene open 2779-3075
4600 JVTL01000074.1 GCA001053435_01207 gene open 3779-4987
4601 JVTL01000074.1 GCA001053435_01208 gene open 5381-5635
4602 JVTL01000074.1 GCA001053435_01209 gene open 5722-5940
4603 JVTL01000075.1 GCA001053435_01210 CDS open 203-520 _na     105_aa transposase
4604 JVTL01000075.1 GCA001053435_01210 gene open 203-520
4605 JVTL01000076.1 GCA001053435_01211 gene open 224-1741 rrs
4606 JVTL01000076.1 GCA001053435_01211 rRNA open 224-1741 rrs 16S ribosomal RNA
4607 JVTL01000077.1 GCA001053435_01212 CDS open 93-332 _na     79_aa hypothetical protein
4608 JVTL01000077.1 GCA001053435_01213 CDS open 833-1150 _na     105_aa Transposase
4609 JVTL01000077.1 GCA001053435_01214 CDS open 1317-2321 _na     334_aa ccsB c-type cytochrome biogenesis protein CcsB
4610 JVTL01000077.1 GCA001053435_01215 CDS open 2612-4291 _na     559_aa ABC transporter ATP-binding protein
4611 JVTL01000077.1 GCA001053435_01216 CDS open 4306-5259 _na     317_aa hypothetical protein
4612 JVTL01000077.1 GCA001053435_01217 CDS open 5640-5900 _na     86_aa pqqD PqqD family protein
4613 JVTL01000077.1 GCA001053435_01218 CDS open 5897-7666 _na     589_aa asparagine synthase C-terminal domain-containing protein
4614 JVTL01000077.1 GCA001053435_01219 CDS open 7690-7818 _na     42_aa hypothetical protein
4615 JVTL01000077.1 GCA001053435_01220 CDS open 9213-10832 _na     539_aa istA IS21 family transposase
4616 JVTL01000077.1 GCA001053435_01221 CDS open 10840-11637 _na     265_aa IstB-like ATP-binding protein
4617 JVTL01000077.1 GCA001053435_01212 gene open 93-332
4618 JVTL01000077.1 GCA001053435_01213 gene open 833-1150
4619 JVTL01000077.1 GCA001053435_01214 gene open 1317-2321 ccsB
4620 JVTL01000077.1 GCA001053435_01215 gene open 2612-4291
4621 JVTL01000077.1 GCA001053435_01216 gene open 4306-5259
4622 JVTL01000077.1 GCA001053435_01217 gene open 5640-5900 pqqD
4623 JVTL01000077.1 GCA001053435_01218 gene open 5897-7666
4624 JVTL01000077.1 GCA001053435_01219 gene open 7690-7818
4625 JVTL01000077.1 GCA001053435_01220 gene open 9213-10832 istA
4626 JVTL01000077.1 GCA001053435_01221 gene open 10840-11637
4627 JVTL01000078.1 GCA001053435_01222 CDS open 256-1176 _na     306_aa IS3 family transposase
4628 JVTL01000078.1 GCA001053435_01223 CDS open 1196-2068 _na     290_aa mmeI type IIL restriction-modification enzyme MmeI
4629 JVTL01000078.1 GCA001053435_01224 CDS open 2205-2468 _na     87_aa hypothetical protein
4630 JVTL01000078.1 GCA001053435_01225 CDS open 2609-3202 _na     197_aa Resolvase%2C N-terminal domain protein
4631 JVTL01000078.1 GCA001053435_01226 CDS open 4052-5611 _na     519_aa Sulfate permease
4632 JVTL01000078.1 GCA001053435_01227 CDS open 5781-6185 _na     134_aa merR MerR family transcriptional regulator
4633 JVTL01000078.1 GCA001053435_01228 CDS open 7089-7424 _na     111_aa hypothetical protein
4634 JVTL01000078.1 GCA001053435_01229 CDS open 7669-7923 _na     84_aa hypothetical protein
4635 JVTL01000078.1 GCA001053435_01230 CDS open 7936-8061 _na     41_aa hypothetical protein
4636 JVTL01000078.1 GCA001053435_01222 gene open 256-1176
4637 JVTL01000078.1 GCA001053435_01223 gene open 1196-2068 mmeI
4638 JVTL01000078.1 GCA001053435_01224 gene open 2205-2468
4639 JVTL01000078.1 GCA001053435_01225 gene open 2609-3202
4640 JVTL01000078.1 GCA001053435_01226 gene open 4052-5611
4641 JVTL01000078.1 GCA001053435_01227 gene open 5781-6185 merR
4642 JVTL01000078.1 GCA001053435_01228 gene open 7089-7424
4643 JVTL01000078.1 GCA001053435_01229 gene open 7669-7923
4644 JVTL01000078.1 GCA001053435_01230 gene open 7936-8061
4645 JVTL01000079.1 GCA001053435_01231 CDS open 256-1176 _na     306_aa IS3 family transposase
4646 JVTL01000079.1 GCA001053435_01233 CDS open 1379-2233 _na     284_aa erm(X) 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(X)
4647 JVTL01000079.1 GCA001053435_01234 CDS open 2398-2988 _na     196_aa TnpcX
4648 JVTL01000079.1 GCA001053435_01235 CDS open 3169-3432 _na     87_aa ORF2
4649 JVTL01000079.1 GCA001053435_01236 CDS open 3712-3861 _na     49_aa ORF1
4650 JVTL01000079.1 GCA001053435_01237 CDS open 4294-4533 _na     79_aa Helix-turn-helix domain-containing protein
4651 JVTL01000079.1 GCA001053435_01231 gene open 256-1176
4652 JVTL01000079.1 GCA001053435_01233 gene open 1379-2233 erm(X)
4653 JVTL01000079.1 GCA001053435_01234 gene open 2398-2988
4654 JVTL01000079.1 GCA001053435_01235 gene open 3169-3432
4655 JVTL01000079.1 GCA001053435_01236 gene open 3712-3861
4656 JVTL01000079.1 GCA001053435_01237 gene open 4294-4533
4657 JVTL01000080.1 GCA001053435_01238 CDS open 402-1631 _na     409_aa Cell surface protein
4658 JVTL01000080.1 GCA001053435_01239 CDS open 1621-2802 _na     393_aa htaA HtaA domain-containing protein
4659 JVTL01000080.1 GCA001053435_01240 CDS open 2887-3558 _na     223_aa phoU PhoU family transcriptional regulator
4660 JVTL01000080.1 GCA001053435_01238 gene open 402-1631
4661 JVTL01000080.1 GCA001053435_01239 gene open 1621-2802 htaA
4662 JVTL01000080.1 GCA001053435_01240 gene open 2887-3558 phoU
4663 JVTL01000081.1 repeat_region open 36-4893 CRISPR array with 80 repeats of length 28%2C consensus sequence GTCCGCCCCGCGTAAGCGGGGATGAGCC and spacer length 33
4664 JVTL01000081.1 GCA001053435_01241 CDS open 5514-6779 _na     421_aa Carboxylic ester hydrolase
4665 JVTL01000081.1 GCA001053435_01242 CDS open 7049-7225 _na     58_aa Secreted protein
4666 JVTL01000081.1 GCA001053435_01243 CDS open 7218-9350 _na     710_aa malQ 4-alpha-glucanotransferase
4667 JVTL01000081.1 GCA001053435_01244 CDS open 9424-11265 _na     613_aa Acyl-CoA synthetase
4668 JVTL01000081.1 GCA001053435_01245 CDS open 11420-12106 _na     228_aa DUF222 domain-containing protein
4669 JVTL01000081.1 GCA001053435_01246 CDS open 12212-13057 _na     281_aa DUF559 domain-containing protein
4670 JVTL01000081.1 GCA001053435_01247 CDS open 13179-14237 _na     352_aa CNNM transmembrane domain-containing protein
4671 JVTL01000081.1 GCA001053435_01248 CDS open 14237-15625 _na     462_aa Transporter
4672 JVTL01000081.1 GCA001053435_01249 CDS open 15778-16911 _na     377_aa hemW radical SAM family heme chaperone HemW
4673 JVTL01000081.1 GCA001053435_01250 CDS open 16932-17984 _na     350_aa hrcA heat-inducible transcriptional repressor HrcA
4674 JVTL01000081.1 GCA001053435_01251 CDS open 18036-19181 _na     381_aa dnaJ molecular chaperone DnaJ
4675 JVTL01000081.1 GCA001053435_01252 CDS open 19181-19903 _na     240_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
4676 JVTL01000081.1 GCA001053435_01253 CDS open 19913-20911 _na     332_aa PhoH-like protein
4677 JVTL01000081.1 GCA001053435_01254 CDS open 20912-21517 _na     201_aa ybeY rRNA maturation RNase YbeY
4678 JVTL01000081.1 GCA001053435_01255 CDS open 21577-22323 _na     248_aa PH domain-containing protein
4679 JVTL01000081.1 GCA001053435_01256 CDS open 22320-23018 _na     232_aa HTH merR-type domain-containing protein
4680 JVTL01000081.1 GCA001053435_01257 CDS open 23211-24059 _na     282_aa pdxY pyridoxal kinase PdxY
4681 JVTL01000081.1 GCA001053435_01258 CDS open 24243-25136 _na     297_aa Restriction endonuclease type II-like domain-containing protein
4682 JVTL01000081.1 GCA001053435_01259 CDS open 25325-26314 _na     329_aa era GTPase Era
4683 JVTL01000081.1 GCA001053435_01260 CDS open 26319-27038 _na     239_aa recO DNA repair protein RecO
4684 JVTL01000081.1 GCA001053435_01261 CDS open 27049-27801 _na     250_aa isoprenyl transferase
4685 JVTL01000081.1 GCA001053435_01262 CDS open 27879-28292 _na     137_aa Transcriptional regulator%2C FUR family
4686 JVTL01000081.1 GCA001053435_01263 CDS open 28326-28628 _na     100_aa Cadmium efflux system accessory protein
4687 JVTL01000081.1 GCA001053435_01264 CDS open 28809-30188 _na     459_aa glycine--tRNA ligase
4688 JVTL01000081.1 GCA001053435_01265 CDS open 30188-30703 _na     171_aa Secreted protein
4689 JVTL01000081.1 GCA001053435_01266 CDS open 30730-31197 _na     155_aa FHA domain-containing protein
4690 JVTL01000081.1 GCA001053435_01267 CDS open 31214-33253 _na     679_aa Chromosome segregation ATPase
4691 JVTL01000081.1 GCA001053435_01268 CDS open 33284-33943 _na     219_aa DUF218 domain-containing protein
4692 JVTL01000081.1 GCA001053435_01269 CDS open 34079-34189 _na     36_aa hypothetical protein
4693 JVTL01000081.1 GCA001053435_01270 CDS open 34283-35605 _na     440_aa deoxyguanosinetriphosphate triphosphohydrolase
4694 JVTL01000081.1 GCA001053435_01271 CDS open 35781-36029 _na     82_aa hypothetical protein
4695 JVTL01000081.1 GCA001053435_01272 CDS open 36019-36525 _na     168_aa Ribonuclease
4696 JVTL01000081.1 GCA001053435_01273 CDS open 36763-38703 _na     646_aa DNA primase
4697 JVTL01000081.1 GCA001053435_01274 CDS open 38700-38969 _na     89_aa ytxH YtxH domain-containing protein
4698 JVTL01000081.1 GCA001053435_01277 CDS open 40751-41176 _na     141_aa Integral membrane protein
4699 JVTL01000081.1 GCA001053435_01278 CDS open 41226-42362 _na     378_aa jetD Wadjet protein JetD C-terminal domain-containing protein
4700 JVTL01000081.1 GCA001053435_01279 CDS open 42349-45717 _na     1122_aa ATP-binding protein
4701 JVTL01000081.1 GCA001053435_01280 CDS open 45710-46642 _na     310_aa IS256 family transposase
4702 JVTL01000081.1 GCA001053435_01281 CDS open 46659-47615 _na     318_aa Transposase IS204/IS1001/IS1096/IS1165 family protein
4703 JVTL01000081.1 GCA001053435_01241 gene open 5514-6779
4704 JVTL01000081.1 GCA001053435_01242 gene open 7049-7225
4705 JVTL01000081.1 GCA001053435_01243 gene open 7218-9350 malQ
4706 JVTL01000081.1 GCA001053435_01244 gene open 9424-11265
4707 JVTL01000081.1 GCA001053435_01245 gene open 11420-12106
4708 JVTL01000081.1 GCA001053435_01246 gene open 12212-13057
4709 JVTL01000081.1 GCA001053435_01247 gene open 13179-14237
4710 JVTL01000081.1 GCA001053435_01248 gene open 14237-15625
4711 JVTL01000081.1 GCA001053435_01249 gene open 15778-16911 hemW
4712 JVTL01000081.1 GCA001053435_01250 gene open 16932-17984 hrcA
4713 JVTL01000081.1 GCA001053435_01251 gene open 18036-19181 dnaJ
4714 JVTL01000081.1 GCA001053435_01252 gene open 19181-19903
4715 JVTL01000081.1 GCA001053435_01253 gene open 19913-20911
4716 JVTL01000081.1 GCA001053435_01254 gene open 20912-21517 ybeY
4717 JVTL01000081.1 GCA001053435_01255 gene open 21577-22323
4718 JVTL01000081.1 GCA001053435_01256 gene open 22320-23018
4719 JVTL01000081.1 GCA001053435_01257 gene open 23211-24059 pdxY
4720 JVTL01000081.1 GCA001053435_01258 gene open 24243-25136
4721 JVTL01000081.1 GCA001053435_01259 gene open 25325-26314 era
4722 JVTL01000081.1 GCA001053435_01260 gene open 26319-27038 recO
4723 JVTL01000081.1 GCA001053435_01261 gene open 27049-27801
4724 JVTL01000081.1 GCA001053435_01262 gene open 27879-28292
4725 JVTL01000081.1 GCA001053435_01263 gene open 28326-28628
4726 JVTL01000081.1 GCA001053435_01264 gene open 28809-30188
4727 JVTL01000081.1 GCA001053435_01265 gene open 30188-30703
4728 JVTL01000081.1 GCA001053435_01266 gene open 30730-31197
4729 JVTL01000081.1 GCA001053435_01267 gene open 31214-33253
4730 JVTL01000081.1 GCA001053435_01268 gene open 33284-33943
4731 JVTL01000081.1 GCA001053435_01269 gene open 34079-34189
4732 JVTL01000081.1 GCA001053435_01270 gene open 34283-35605
4733 JVTL01000081.1 GCA001053435_01271 gene open 35781-36029
4734 JVTL01000081.1 GCA001053435_01272 gene open 36019-36525
4735 JVTL01000081.1 GCA001053435_01273 gene open 36763-38703
4736 JVTL01000081.1 GCA001053435_01274 gene open 38700-38969 ytxH
4737 JVTL01000081.1 GCA001053435_01277 gene open 40751-41176
4738 JVTL01000081.1 GCA001053435_01278 gene open 41226-42362 jetD
4739 JVTL01000081.1 GCA001053435_01279 gene open 42349-45717
4740 JVTL01000081.1 GCA001053435_01280 gene open 45710-46642
4741 JVTL01000081.1 GCA001053435_01281 gene open 46659-47615
4742 JVTL01000081.1 GCA001053435_01275 gene open 39631-39703 trnN
4743 JVTL01000081.1 GCA001053435_01276 gene open 40202-40275 trnI
4744 JVTL01000081.1 GCA001053435_01275 tRNA open 39631-39703 trnN tRNA-Asn(gtt)
4745 JVTL01000081.1 GCA001053435_01276 tRNA open 40202-40275 trnI tRNA-Ile2(cat)
4746 JVTL01000082.1 GCA001053435_01282 CDS open 627-863 _na     78_aa hypothetical protein
4747 JVTL01000082.1 GCA001053435_01283 CDS open 964-1983 _na     339_aa trpS tryptophan--tRNA ligase
4748 JVTL01000082.1 GCA001053435_01284 CDS open 2073-3155 _na     360_aa Ribonuclease BN-like family
4749 JVTL01000082.1 GCA001053435_01285 CDS open 3206-4060 _na     284_aa RDD domain-containing protein
4750 JVTL01000082.1 GCA001053435_01286 CDS open 4029-5300 _na     423_aa D-alanyl-D-alanine carboxypeptidase
4751 JVTL01000082.1 GCA001053435_01287 CDS open 5328-6233 _na     301_aa Adenosine deaminase
4752 JVTL01000082.1 GCA001053435_01288 CDS open 6234-7244 _na     336_aa Alpha/beta hydrolase
4753 JVTL01000082.1 GCA001053435_01289 CDS open 7241-8503 _na     420_aa Primosomal protein
4754 JVTL01000082.1 GCA001053435_01290 CDS open 8528-9436 _na     302_aa C40 family peptidase
4755 JVTL01000082.1 GCA001053435_01291 CDS open 9433-9711 _na     92_aa Chemotaxis protein
4756 JVTL01000082.1 GCA001053435_01292 CDS open 9837-10472 _na     211_aa upp uracil phosphoribosyltransferase
4757 JVTL01000082.1 GCA001053435_01293 CDS open 10521-10871 _na     116_aa HTH cro/C1-type domain-containing protein
4758 JVTL01000082.1 GCA001053435_01294 CDS open 11062-12243 _na     393_aa Amidohydrolase
4759 JVTL01000082.1 GCA001053435_01295 CDS open 12316-13764 _na     482_aa NAD(P)H-quinone dehydrogenase
4760 JVTL01000082.1 GCA001053435_01296 CDS open 13781-14608 _na     275_aa Putative host cell surface-exposed lipoprotein Ltp-like HTH region domain-containing protein
4761 JVTL01000082.1 GCA001053435_01297 CDS open 14741-16054 _na     437_aa XRE family transcriptional regulator
4762 JVTL01000082.1 GCA001053435_01298 CDS open 16266-17795 _na     509_aa prpD 2-methylcitrate dehydratase PrpD
4763 JVTL01000082.1 GCA001053435_01299 CDS open 17796-18725 _na     309_aa prpB methylisocitrate lyase
4764 JVTL01000082.1 GCA001053435_01300 CDS open 18821-19972 _na     383_aa bifunctional 2-methylcitrate synthase/citrate synthase
4765 JVTL01000082.1 GCA001053435_01301 CDS open 19969-22404 _na     811_aa ABC transporter permease
4766 JVTL01000082.1 GCA001053435_01302 CDS open 22394-23080 _na     228_aa ABC transporter ATP-binding protein
4767 JVTL01000082.1 GCA001053435_01303 CDS open 23791-27222 _na     1143_aa pyruvate carboxylase
4768 JVTL01000082.1 GCA001053435_01304 CDS open 27312-27875 _na     187_aa GNAT family N-acetyltransferase
4769 JVTL01000082.1 GCA001053435_01305 CDS open 27894-29663 _na     589_aa biotin carboxylase
4770 JVTL01000082.1 GCA001053435_01306 CDS open 29835-30698 _na     287_aa thiosulfate sulfurtransferase
4771 JVTL01000082.1 GCA001053435_01307 CDS open 30842-30988 _na     48_aa hypothetical protein
4772 JVTL01000082.1 GCA001053435_01308 CDS open 31033-32139 _na     368_aa DUF6815 domain-containing protein
4773 JVTL01000082.1 GCA001053435_01309 CDS open 32328-33443 _na     371_aa DUF4282 domain-containing protein
4774 JVTL01000082.1 GCA001053435_01310 CDS open 33610-33948 _na     112_aa YdhG-like domain-containing protein
4775 JVTL01000082.1 GCA001053435_01311 CDS open 33958-34365 _na     135_aa DUF3151 domain-containing protein
4776 JVTL01000082.1 GCA001053435_01312 CDS open 34427-35023 _na     198_aa Nucleoside triphosphate pyrophosphatase
4777 JVTL01000082.1 GCA001053435_01313 CDS open 35038-35262 _na     74_aa Acetyl-CoA carboxylase subunit
4778 JVTL01000082.1 GCA001053435_01314 CDS open 35274-36806 _na     510_aa Acyl-CoA carboxylase subunit beta
4779 JVTL01000082.1 GCA001053435_01315 CDS open 36833-38410 _na     525_aa Methylmalonyl-CoA carboxyltransferase
4780 JVTL01000082.1 GCA001053435_01316 CDS open 38702-38953 _na     83_aa hypothetical protein
4781 JVTL01000082.1 GCA001053435_01317 CDS open 39129-39431 _na     100_aa DUF4190 domain-containing protein
4782 JVTL01000082.1 GCA001053435_01318 CDS open 39441-40871 _na     476_aa Phosphate transporter
4783 JVTL01000082.1 GCA001053435_01319 CDS open 41059-42588 _na     509_aa Maltose alpha-D-glucosyltransferase
4784 JVTL01000082.1 GCA001053435_01320 CDS open 42585-42770 _na     61_aa Secreted protein
4785 JVTL01000082.1 GCA001053435_01321 CDS open 42770-43138 _na     122_aa Secreted protein
4786 JVTL01000082.1 GCA001053435_01322 CDS open 43138-43959 _na     273_aa ABC transmembrane type-1 domain-containing protein
4787 JVTL01000082.1 GCA001053435_01323 CDS open 43959-44939 _na     326_aa Maltose transport system permease
4788 JVTL01000082.1 GCA001053435_01324 CDS open 45104-46393 _na     429_aa ABC transporter substrate-binding protein
4789 JVTL01000082.1 GCA001053435_01325 CDS open 46555-47547 _na     330_aa ABC transporter ATP-binding protein
4790 JVTL01000082.1 GCA001053435_01326 CDS open 47950-48195 _na     81_aa hypothetical protein
4791 JVTL01000082.1 GCA001053435_01327 CDS open 48270-49100 _na     276_aa biotin--[biotin carboxyl-carrier protein] ligase
4792 JVTL01000082.1 GCA001053435_01328 CDS open 49418-49843 _na     141_aa DUF304 domain-containing protein
4793 JVTL01000082.1 GCA001053435_01329 CDS open 49840-50523 _na     227_aa budA acetolactate decarboxylase
4794 JVTL01000082.1 GCA001053435_01330 CDS open 50545-51762 _na     405_aa 5-(carboxyamino)imidazole ribonucleotide synthase
4795 JVTL01000082.1 GCA001053435_01331 CDS open 51772-52272 _na     166_aa N5-carboxyaminoimidazole ribonucleotide mutase
4796 JVTL01000082.1 GCA001053435_01332 CDS open 52378-53361 _na     327_aa Transcriptional regulator
4797 JVTL01000082.1 GCA001053435_01333 CDS open 53461-53862 _na     133_aa DUF218 domain-containing protein
4798 JVTL01000082.1 GCA001053435_01334 CDS open 53986-54852 _na     288_aa Aldose 1-epimerase
4799 JVTL01000082.1 GCA001053435_01335 CDS open 54871-56526 _na     551_aa Solute:sodium symporter (SSS) family transporter
4800 JVTL01000082.1 GCA001053435_01336 CDS open 56540-56821 _na     93_aa Cell wall anchor protein
4801 JVTL01000082.1 GCA001053435_01337 CDS open 56821-57912 _na     363_aa galT galactose-1-phosphate uridylyltransferase
4802 JVTL01000082.1 GCA001053435_01338 CDS open 57905-59143 _na     412_aa galK galactokinase
4803 JVTL01000082.1 GCA001053435_01339 CDS open 59248-59640 _na     130_aa Secreted protein
4804 JVTL01000082.1 GCA001053435_01340 CDS open 59948-60388 _na     146_aa hypothetical protein
4805 JVTL01000082.1 GCA001053435_01341 CDS open 60398-61438 _na     346_aa RNase H type-1 domain-containing protein
4806 JVTL01000082.1 GCA001053435_01342 CDS open 61648-62157 _na     169_aa RNA polymerase sigma factor
4807 JVTL01000082.1 GCA001053435_01343 CDS open 62150-63211 _na     353_aa Secreted protein
4808 JVTL01000082.1 GCA001053435_01344 CDS open 63215-63772 _na     185_aa tetR TetR family transcriptional regulator
4809 JVTL01000082.1 GCA001053435_01345 CDS open 63867-65042 _na     391_aa Acyl-CoA dehydrogenase
4810 JVTL01000082.1 GCA001053435_01346 CDS open 65373-66323 _na     316_aa DUF559 domain-containing protein
4811 JVTL01000082.1 GCA001053435_01347 CDS open 66409-68592 _na     727_aa 3-hydroxyacyl-CoA dehydrogenase
4812 JVTL01000082.1 GCA001053435_01348 CDS open 68593-69768 _na     391_aa putative acetyl-CoA acetyltransferase
4813 JVTL01000082.1 GCA001053435_01349 CDS open 69962-70819 _na     285_aa mmuM homocysteine S-methyltransferase
4814 JVTL01000082.1 GCA001053435_01350 CDS open 70988-72205 _na     405_aa Divalent metal cation transporter
4815 JVTL01000082.1 GCA001053435_01351 CDS open 72219-73013 _na     264_aa putative hydro-lyase
4816 JVTL01000082.1 GCA001053435_01352 CDS open 73230-73844 _na     204_aa Fatty acid metabolism regulator protein
4817 JVTL01000082.1 GCA001053435_01353 CDS open 73902-75656 _na     584_aa biotin carboxylase
4818 JVTL01000082.1 GCA001053435_01354 CDS open 75659-77209 _na     516_aa Allophanate hydrolase subunit 2
4819 JVTL01000082.1 GCA001053435_01355 CDS open 77209-77970 _na     253_aa LamB/YcsF family protein
4820 JVTL01000082.1 GCA001053435_01356 CDS open 78160-78420 _na     86_aa Transcriptional regulator
4821 JVTL01000082.1 GCA001053435_01357 CDS open 78420-80036 _na     538_aa FAD-dependent oxidoreductase
4822 JVTL01000082.1 GCA001053435_01358 CDS open 80052-80216 _na     54_aa Transposase
4823 JVTL01000082.1 GCA001053435_01359 CDS open 80348-81466 _na     372_aa Amidohydrolase
4824 JVTL01000082.1 GCA001053435_01360 CDS open 81463-82383 _na     306_aa Ribokinase
4825 JVTL01000082.1 GCA001053435_01361 CDS open 82631-83998 _na     455_aa Secreted protein
4826 JVTL01000082.1 GCA001053435_01362 CDS open 84520-85071 _na     183_aa 2'-5' RNA ligase
4827 JVTL01000082.1 GCA001053435_01363 CDS open 85114-87012 _na     632_aa PTS mannose transporter subunit IIABC
4828 JVTL01000082.1 GCA001053435_01364 CDS open 87216-87464 _na     82_aa DUF2283 domain-containing protein
4829 JVTL01000082.1 GCA001053435_01365 CDS open 87718-88128 _na     136_aa Secreted protein
4830 JVTL01000082.1 GCA001053435_01366 CDS open 88140-88661 _na     173_aa Gluconokinase
4831 JVTL01000082.1 GCA001053435_01367 CDS open 88712-90115 _na     467_aa Gluconate permease
4832 JVTL01000082.1 GCA001053435_01368 CDS open 90413-93769 _na     1118_aa DNA polymerase III subunit
4833 JVTL01000082.1 GCA001053435_01369 CDS open 93912-95183 _na     423_aa Cell filamentation protein Fic
4834 JVTL01000082.1 GCA001053435_01370 CDS open 95407-96246 _na     279_aa Ascorbate-specific PTS system EIIA component
4835 JVTL01000082.1 GCA001053435_01371 CDS open 96256-97833 _na     525_aa Ascorbate-specific PTS system EIIC component
4836 JVTL01000082.1 GCA001053435_01372 CDS open 97873-98124 _na     83_aa hypothetical protein
4837 JVTL01000082.1 GCA001053435_01373 CDS open 98121-99437 _na     438_aa Septum formation initiator
4838 JVTL01000082.1 GCA001053435_01374 CDS open 99453-100733 _na     426_aa Arginine deiminase
4839 JVTL01000082.1 GCA001053435_01375 CDS open 100981-102120 _na     379_aa pucR PucR C-terminal helix-turn-helix domain-containing protein
4840 JVTL01000082.1 GCA001053435_01376 CDS open 102232-103479 _na     415_aa M20 family metallo-hydrolase
4841 JVTL01000082.1 GCA001053435_01377 CDS open 103627-103929 _na     100_aa DUF3040 domain-containing protein
4842 JVTL01000082.1 GCA001053435_01378 CDS open 104336-104899 _na     187_aa Mutator family transposase
4843 JVTL01000082.1 GCA001053435_01379 CDS open 105112-106302 _na     396_aa Oxidoreductase
4844 JVTL01000082.1 GCA001053435_01380 CDS open 106362-107771 _na     469_aa 2-oxoadipate dioxygenase/decarboxylase
4845 JVTL01000082.1 GCA001053435_01381 CDS open 107802-109325 _na     507_aa aldehyde dehydrogenase (NAD(+))
4846 JVTL01000082.1 GCA001053435_01382 CDS open 109387-109893 _na     168_aa aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
4847 JVTL01000082.1 GCA001053435_01383 CDS open 110043-110492 _na     149_aa Putative transposase
4848 JVTL01000082.1 GCA001053435_01282 gene open 627-863
4849 JVTL01000082.1 GCA001053435_01283 gene open 964-1983 trpS
4850 JVTL01000082.1 GCA001053435_01284 gene open 2073-3155
4851 JVTL01000082.1 GCA001053435_01285 gene open 3206-4060
4852 JVTL01000082.1 GCA001053435_01286 gene open 4029-5300
4853 JVTL01000082.1 GCA001053435_01287 gene open 5328-6233
4854 JVTL01000082.1 GCA001053435_01288 gene open 6234-7244
4855 JVTL01000082.1 GCA001053435_01289 gene open 7241-8503
4856 JVTL01000082.1 GCA001053435_01290 gene open 8528-9436
4857 JVTL01000082.1 GCA001053435_01291 gene open 9433-9711
4858 JVTL01000082.1 GCA001053435_01292 gene open 9837-10472 upp
4859 JVTL01000082.1 GCA001053435_01293 gene open 10521-10871
4860 JVTL01000082.1 GCA001053435_01294 gene open 11062-12243
4861 JVTL01000082.1 GCA001053435_01295 gene open 12316-13764
4862 JVTL01000082.1 GCA001053435_01296 gene open 13781-14608
4863 JVTL01000082.1 GCA001053435_01297 gene open 14741-16054
4864 JVTL01000082.1 GCA001053435_01298 gene open 16266-17795 prpD
4865 JVTL01000082.1 GCA001053435_01299 gene open 17796-18725 prpB
4866 JVTL01000082.1 GCA001053435_01300 gene open 18821-19972
4867 JVTL01000082.1 GCA001053435_01301 gene open 19969-22404
4868 JVTL01000082.1 GCA001053435_01302 gene open 22394-23080
4869 JVTL01000082.1 GCA001053435_01303 gene open 23791-27222
4870 JVTL01000082.1 GCA001053435_01304 gene open 27312-27875
4871 JVTL01000082.1 GCA001053435_01305 gene open 27894-29663
4872 JVTL01000082.1 GCA001053435_01306 gene open 29835-30698
4873 JVTL01000082.1 GCA001053435_01307 gene open 30842-30988
4874 JVTL01000082.1 GCA001053435_01308 gene open 31033-32139
4875 JVTL01000082.1 GCA001053435_01309 gene open 32328-33443
4876 JVTL01000082.1 GCA001053435_01310 gene open 33610-33948
4877 JVTL01000082.1 GCA001053435_01311 gene open 33958-34365
4878 JVTL01000082.1 GCA001053435_01312 gene open 34427-35023
4879 JVTL01000082.1 GCA001053435_01313 gene open 35038-35262
4880 JVTL01000082.1 GCA001053435_01314 gene open 35274-36806
4881 JVTL01000082.1 GCA001053435_01315 gene open 36833-38410
4882 JVTL01000082.1 GCA001053435_01316 gene open 38702-38953
4883 JVTL01000082.1 GCA001053435_01317 gene open 39129-39431
4884 JVTL01000082.1 GCA001053435_01318 gene open 39441-40871
4885 JVTL01000082.1 GCA001053435_01319 gene open 41059-42588
4886 JVTL01000082.1 GCA001053435_01320 gene open 42585-42770
4887 JVTL01000082.1 GCA001053435_01321 gene open 42770-43138
4888 JVTL01000082.1 GCA001053435_01322 gene open 43138-43959
4889 JVTL01000082.1 GCA001053435_01323 gene open 43959-44939
4890 JVTL01000082.1 GCA001053435_01324 gene open 45104-46393
4891 JVTL01000082.1 GCA001053435_01325 gene open 46555-47547
4892 JVTL01000082.1 GCA001053435_01326 gene open 47950-48195
4893 JVTL01000082.1 GCA001053435_01327 gene open 48270-49100
4894 JVTL01000082.1 GCA001053435_01328 gene open 49418-49843
4895 JVTL01000082.1 GCA001053435_01329 gene open 49840-50523 budA
4896 JVTL01000082.1 GCA001053435_01330 gene open 50545-51762
4897 JVTL01000082.1 GCA001053435_01331 gene open 51772-52272
4898 JVTL01000082.1 GCA001053435_01332 gene open 52378-53361
4899 JVTL01000082.1 GCA001053435_01333 gene open 53461-53862
4900 JVTL01000082.1 GCA001053435_01334 gene open 53986-54852
4901 JVTL01000082.1 GCA001053435_01335 gene open 54871-56526
4902 JVTL01000082.1 GCA001053435_01336 gene open 56540-56821
4903 JVTL01000082.1 GCA001053435_01337 gene open 56821-57912 galT
4904 JVTL01000082.1 GCA001053435_01338 gene open 57905-59143 galK
4905 JVTL01000082.1 GCA001053435_01339 gene open 59248-59640
4906 JVTL01000082.1 GCA001053435_01340 gene open 59948-60388
4907 JVTL01000082.1 GCA001053435_01341 gene open 60398-61438
4908 JVTL01000082.1 GCA001053435_01342 gene open 61648-62157
4909 JVTL01000082.1 GCA001053435_01343 gene open 62150-63211
4910 JVTL01000082.1 GCA001053435_01344 gene open 63215-63772 tetR
4911 JVTL01000082.1 GCA001053435_01345 gene open 63867-65042
4912 JVTL01000082.1 GCA001053435_01346 gene open 65373-66323
4913 JVTL01000082.1 GCA001053435_01347 gene open 66409-68592
4914 JVTL01000082.1 GCA001053435_01348 gene open 68593-69768
4915 JVTL01000082.1 GCA001053435_01349 gene open 69962-70819 mmuM
4916 JVTL01000082.1 GCA001053435_01350 gene open 70988-72205
4917 JVTL01000082.1 GCA001053435_01351 gene open 72219-73013
4918 JVTL01000082.1 GCA001053435_01352 gene open 73230-73844
4919 JVTL01000082.1 GCA001053435_01353 gene open 73902-75656
4920 JVTL01000082.1 GCA001053435_01354 gene open 75659-77209
4921 JVTL01000082.1 GCA001053435_01355 gene open 77209-77970
4922 JVTL01000082.1 GCA001053435_01356 gene open 78160-78420
4923 JVTL01000082.1 GCA001053435_01357 gene open 78420-80036
4924 JVTL01000082.1 GCA001053435_01358 gene open 80052-80216
4925 JVTL01000082.1 GCA001053435_01359 gene open 80348-81466
4926 JVTL01000082.1 GCA001053435_01360 gene open 81463-82383
4927 JVTL01000082.1 GCA001053435_01361 gene open 82631-83998
4928 JVTL01000082.1 GCA001053435_01362 gene open 84520-85071
4929 JVTL01000082.1 GCA001053435_01363 gene open 85114-87012
4930 JVTL01000082.1 GCA001053435_01364 gene open 87216-87464
4931 JVTL01000082.1 GCA001053435_01365 gene open 87718-88128
4932 JVTL01000082.1 GCA001053435_01366 gene open 88140-88661
4933 JVTL01000082.1 GCA001053435_01367 gene open 88712-90115
4934 JVTL01000082.1 GCA001053435_01368 gene open 90413-93769
4935 JVTL01000082.1 GCA001053435_01369 gene open 93912-95183
4936 JVTL01000082.1 GCA001053435_01370 gene open 95407-96246
4937 JVTL01000082.1 GCA001053435_01371 gene open 96256-97833
4938 JVTL01000082.1 GCA001053435_01372 gene open 97873-98124
4939 JVTL01000082.1 GCA001053435_01373 gene open 98121-99437
4940 JVTL01000082.1 GCA001053435_01374 gene open 99453-100733
4941 JVTL01000082.1 GCA001053435_01375 gene open 100981-102120 pucR
4942 JVTL01000082.1 GCA001053435_01376 gene open 102232-103479
4943 JVTL01000082.1 GCA001053435_01377 gene open 103627-103929
4944 JVTL01000082.1 GCA001053435_01378 gene open 104336-104899
4945 JVTL01000082.1 GCA001053435_01379 gene open 105112-106302
4946 JVTL01000082.1 GCA001053435_01380 gene open 106362-107771
4947 JVTL01000082.1 GCA001053435_01381 gene open 107802-109325
4948 JVTL01000082.1 GCA001053435_01382 gene open 109387-109893
4949 JVTL01000082.1 GCA001053435_01383 gene open 110043-110492
4950 JVTL01000083.1 GCA001053435_01384 CDS open 157-1203 _na     348_aa transposase
4951 JVTL01000083.1 GCA001053435_01385 CDS open 1509-1889 _na     126_aa Transcriptional regulator
4952 JVTL01000083.1 GCA001053435_01386 CDS open 2279-2845 _na     188_aa gcrR GcrR
4953 JVTL01000083.1 GCA001053435_01384 gene open 157-1203
4954 JVTL01000083.1 GCA001053435_01385 gene open 1509-1889
4955 JVTL01000083.1 GCA001053435_01386 gene open 2279-2845 gcrR
4956 JVTL01000085.1 GCA001053435_01387 CDS open 872-1066 _na     64_aa hypothetical protein
4957 JVTL01000085.1 GCA001053435_01388 CDS open 1229-1930 _na     233_aa IS30 family transposase
4958 JVTL01000085.1 GCA001053435_01387 gene open 872-1066
4959 JVTL01000085.1 GCA001053435_01388 gene open 1229-1930
4960 JVTL01000086.1 regulatory_region open 31771-31886 TPP riboswitch aptamer (THI element)
4961 JVTL01000086.1 GCA001053435_01389 CDS open 94-1677 _na     527_aa ftsY signal recognition particle-docking protein FtsY
4962 JVTL01000086.1 GCA001053435_01390 CDS open 1963-4941 _na     992_aa DUF4040 domain-containing protein
4963 JVTL01000086.1 GCA001053435_01391 CDS open 4941-5384 _na     147_aa Sodium H+ antiporter subunit C
4964 JVTL01000086.1 GCA001053435_01392 CDS open 5384-6925 _na     513_aa Monovalent cation/H+ antiporter subunit D
4965 JVTL01000086.1 GCA001053435_01393 CDS open 6926-7456 _na     176_aa monovalent cation/H+ antiporter subunit E
4966 JVTL01000086.1 GCA001053435_01394 CDS open 7456-7746 _na     96_aa Cation:proton antiporter
4967 JVTL01000086.1 GCA001053435_01395 CDS open 7749-8117 _na     122_aa Na+/H+ antiporter subunit G
4968 JVTL01000086.1 GCA001053435_01396 CDS open 8195-9607 _na     470_aa Ammonium transporter
4969 JVTL01000086.1 GCA001053435_01397 CDS open 9611-9949 _na     112_aa Nitrogen regulatory protein P-II
4970 JVTL01000086.1 GCA001053435_01398 CDS open 9951-12062 _na     703_aa [protein-PII] uridylyltransferase
4971 JVTL01000086.1 GCA001053435_01399 CDS open 12110-13735 _na     541_aa ffh signal recognition particle protein
4972 JVTL01000086.1 GCA001053435_01400 CDS open 13873-15057 _na     394_aa TIGR04053 family radical SAM/SPASM domain-containing protein
4973 JVTL01000086.1 GCA001053435_01401 CDS open 15059-17329 _na     756_aa Acyltransferase
4974 JVTL01000086.1 GCA001053435_01402 CDS open 17772-18269 _na     165_aa rpsP 30S ribosomal protein S16
4975 JVTL01000086.1 GCA001053435_01403 CDS open 18365-18775 _na     136_aa luxR LuxR family transcriptional regulator
4976 JVTL01000086.1 GCA001053435_01404 CDS open 18916-19407 _na     163_aa rimM ribosome maturation factor RimM
4977 JVTL01000086.1 GCA001053435_01405 CDS open 19404-20270 _na     288_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
4978 JVTL01000086.1 GCA001053435_01406 CDS open 20260-20622 _na     120_aa hypothetical protein
4979 JVTL01000086.1 GCA001053435_01407 CDS open 20774-21352 _na     192_aa Serine/threonine protein kinase
4980 JVTL01000086.1 GCA001053435_01408 CDS open 21535-23841 _na     768_aa Transcriptional accessory protein
4981 JVTL01000086.1 GCA001053435_01409 CDS open 23943-26066 _na     707_aa ABC-2 type transporter transmembrane domain-containing protein
4982 JVTL01000086.1 GCA001053435_01410 CDS open 26081-27235 _na     384_aa THIF-type NAD/FAD binding fold domain-containing protein
4983 JVTL01000086.1 GCA001053435_01411 CDS open 27235-28014 _na     259_aa Thiazole synthase
4984 JVTL01000086.1 GCA001053435_01412 CDS open 28019-28216 _na     65_aa thiS sulfur carrier protein ThiS
4985 JVTL01000086.1 GCA001053435_01413 CDS open 28262-29386 _na     374_aa thiO glycine oxidase ThiO
4986 JVTL01000086.1 GCA001053435_01414 CDS open 29383-30024 _na     213_aa thiamine phosphate synthase
4987 JVTL01000086.1 GCA001053435_01415 CDS open 30017-31774 _na     585_aa thiC phosphomethylpyrimidine synthase ThiC
4988 JVTL01000086.1 GCA001053435_01416 CDS open 32062-32406 _na     114_aa rplS 50S ribosomal protein L19
4989 JVTL01000086.1 GCA001053435_01417 CDS open 32573-33421 _na     282_aa lepB signal peptidase I
4990 JVTL01000086.1 GCA001053435_01418 CDS open 33492-34184 _na     230_aa lepB signal peptidase I
4991 JVTL01000086.1 GCA001053435_01419 CDS open 34153-34812 _na     219_aa ribonuclease HII
4992 JVTL01000086.1 GCA001053435_01420 CDS open 34876-35181 _na     101_aa Protein often found in Actinomycetes clustered with signal peptidase and/or RNaseHII
4993 JVTL01000086.1 GCA001053435_01421 CDS open 35379-35747 _na     122_aa yraN YraN family protein
4994 JVTL01000086.1 GCA001053435_01422 CDS open 35734-37254 _na     506_aa ATP-dependent protease
4995 JVTL01000086.1 GCA001053435_01423 CDS open 37251-38429 _na     392_aa dprA DNA-processing protein DprA
4996 JVTL01000086.1 GCA001053435_01424 CDS open 38452-39351 _na     299_aa xerC Tyrosine recombinase XerC
4997 JVTL01000086.1 GCA001053435_01425 CDS open 39314-39841 _na     175_aa M23 family peptidase
4998 JVTL01000086.1 GCA001053435_01426 CDS open 40224-41030 _na     268_aa rpsB 30S ribosomal protein S2
4999 JVTL01000086.1 GCA001053435_01427 CDS open 41183-41995 _na     270_aa tsf translation elongation factor Ts
5000 JVTL01000086.1 GCA001053435_01428 CDS open 42136-42876 _na     246_aa pyrH UMP kinase