HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium striatum (GCA_001053435.1)

Select a Genome:
BAKTA Annotations for GCA_001053435.1
Genome Selected: Corynebacterium striatum
ContigsBases CDSrRNA tmRNAtRNA
94 2905202 2693 6 1 56
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5526 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 5526 [12 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JVTL01000028.1 GCA001053435_02141 gene open 18380-19822
1002 JVTL01000028.1 GCA001053435_02142 gene open 19826-21781 pknB
1003 JVTL01000028.1 GCA001053435_02143 gene open 21852-22124 crgA
1004 JVTL01000028.1 GCA001053435_02144 gene open 22141-23229
1005 JVTL01000028.1 GCA001053435_02145 gene open 23292-23540
1006 JVTL01000028.1 GCA001053435_02146 gene open 23547-24197
1007 JVTL01000028.1 GCA001053435_02147 gene open 24219-24797
1008 JVTL01000028.1 GCA001053435_02148 gene open 24809-25477
1009 JVTL01000028.1 GCA001053435_02149 gene open 25434-26720
1010 JVTL01000028.1 GCA001053435_02150 gene open 27239-27883
1011 JVTL01000028.1 GCA001053435_02151 gene open 27951-28481
1012 JVTL01000028.1 GCA001053435_02152 gene open 28538-29188
1013 JVTL01000028.1 GCA001053435_02153 gene open 29185-31449 metE
1014 JVTL01000028.1 GCA001053435_02154 gene open 31446-32369
1015 JVTL01000028.1 GCA001053435_02155 gene open 32756-33568
1016 JVTL01000028.1 GCA001053435_02156 gene open 33683-33886
1017 JVTL01000028.1 GCA001053435_02157 gene open 34094-35524
1018 JVTL01000028.1 GCA001053435_02158 gene open 35521-36639
1019 JVTL01000028.1 GCA001053435_02159 gene open 36648-37301
1020 JVTL01000028.1 GCA001053435_02160 gene open 37312-37791
1021 JVTL01000028.1 GCA001053435_02162 gene open 38121-38393 ligB
1022 JVTL01000028.1 GCA001053435_02163 gene open 38526-39374
1023 JVTL01000028.1 GCA001053435_02164 gene open 39374-39922
1024 JVTL01000028.1 GCA001053435_02165 gene open 39929-40414 marR
1025 JVTL01000028.1 GCA001053435_02166 gene open 40457-41341 sucD
1026 JVTL01000028.1 GCA001053435_02167 gene open 41350-42522 sucC
1027 JVTL01000028.1 GCA001053435_02170 gene open 43106-43450
1028 JVTL01000028.1 GCA001053435_02171 gene open 43454-46024 gyrA
1029 JVTL01000028.1 GCA001053435_02172 gene open 46108-46314 copG
1030 JVTL01000028.1 GCA001053435_02173 gene open 46311-46580
1031 JVTL01000028.1 GCA001053435_02174 gene open 46650-47090
1032 JVTL01000028.1 GCA001053435_02175 gene open 47111-47317
1033 JVTL01000028.1 GCA001053435_02176 gene open 47416-49470 gyrB
1034 JVTL01000028.1 GCA001053435_02177 gene open 49606-50127
1035 JVTL01000028.1 GCA001053435_02178 gene open 50120-51298 recF
1036 JVTL01000028.1 GCA001053435_02179 gene open 51298-52479 dnaN
1037 JVTL01000028.1 GCA001053435_02180 gene open 53073-54668 dnaA
1038 JVTL01000028.1 GCA001053435_02181 gene open 55298-55441 rpmH
1039 JVTL01000028.1 GCA001053435_02182 gene open 55791-56066 yidD
1040 JVTL01000028.1 GCA001053435_02183 gene open 56076-57068 yidC
1041 JVTL01000028.1 GCA001053435_02184 gene open 57094-57702 rsmG
1042 JVTL01000028.1 GCA001053435_02185 gene open 57713-58561
1043 JVTL01000028.1 GCA001053435_02186 gene open 58568-59581
1044 JVTL01000028.1 GCA001053435_02187 gene open 59581-60156
1045 JVTL01000028.1 GCA001053435_02188 gene open 60186-61367
1046 JVTL01000028.1 GCA001053435_02189 gene open 61429-61758 trxA
1047 JVTL01000028.1 GCA001053435_02190 gene open 61765-62691 trxB
1048 JVTL01000028.1 GCA001053435_02191 gene open 62834-63388
1049 JVTL01000028.1 GCA001053435_02192 gene open 63470-65959 pepN
1050 JVTL01000028.1 GCA001053435_02193 gene open 66061-66588
1051 JVTL01000028.1 GCA001053435_02194 gene open 66805-69945 murJ
1052 JVTL01000028.1 GCA001053435_02195 gene open 69966-71993
1053 JVTL01000028.1 GCA001053435_02196 gene open 71990-72574 mutT
1054 JVTL01000028.1 GCA001053435_02197 gene open 72603-74006
1055 JVTL01000028.1 GCA001053435_02198 gene open 74010-74606
1056 JVTL01000028.1 GCA001053435_02199 gene open 74624-75328 azlC
1057 JVTL01000028.1 GCA001053435_02200 gene open 75328-75660 azlD
1058 JVTL01000028.1 GCA001053435_02201 gene open 75657-75968
1059 JVTL01000028.1 GCA001053435_02202 gene open 75965-76924
1060 JVTL01000028.1 GCA001053435_02203 gene open 76953-78017
1061 JVTL01000028.1 GCA001053435_02204 gene open 78138-78509
1062 JVTL01000028.1 GCA001053435_02205 gene open 78548-78769
1063 JVTL01000028.1 GCA001053435_02206 gene open 78998-79453 sdpI
1064 JVTL01000028.1 GCA001053435_02207 gene open 79621-80847
1065 JVTL01000028.1 GCA001053435_02208 gene open 80873-81895
1066 JVTL01000028.1 GCA001053435_02135 gene open 12653-12737 trnL
1067 JVTL01000028.1 GCA001053435_02161 gene open 37877-37949 trnA
1068 JVTL01000028.1 GCA001053435_02168 gene open 42824-42896 trnA
1069 JVTL01000028.1 GCA001053435_02169 gene open 42906-42982 trnI
1070 JVTL01000028.1 GCA001053435_02135 tRNA open 12653-12737 trnL tRNA-Leu(cag)
1071 JVTL01000028.1 GCA001053435_02161 tRNA open 37877-37949 trnA tRNA-Ala(tgc)
1072 JVTL01000028.1 GCA001053435_02168 tRNA open 42824-42896 trnA tRNA-Ala(tgc)
1073 JVTL01000028.1 GCA001053435_02169 tRNA open 42906-42982 trnI tRNA-Ile(gat)
1074 JVTL01000029.1 GCA001053435_02209 CDS open 369-560 _na     63_aa hypothetical protein
1075 JVTL01000029.1 GCA001053435_02210 CDS open 627-1019 _na     130_aa ATP-binding cassette domain-containing protein
1076 JVTL01000029.1 GCA001053435_02211 CDS open 1065-1760 _na     231_aa IS3 family transposase
1077 JVTL01000029.1 GCA001053435_02209 gene open 369-560
1078 JVTL01000029.1 GCA001053435_02210 gene open 627-1019
1079 JVTL01000029.1 GCA001053435_02211 gene open 1065-1760
1080 JVTL01000030.1 GCA001053435_02212 CDS open 153-1772 _na     539_aa istA IS21 family transposase
1081 JVTL01000030.1 GCA001053435_02213 CDS open 1780-2577 _na     265_aa IstB-like ATP-binding protein
1082 JVTL01000030.1 GCA001053435_02214 CDS open 2779-3405 _na     208_aa Secreted protein
1083 JVTL01000030.1 GCA001053435_02215 CDS open 4292-4711 _na     139_aa hypothetical protein
1084 JVTL01000030.1 GCA001053435_02216 CDS open 4704-5186 _na     160_aa HTH cro/C1-type domain-containing protein
1085 JVTL01000030.1 GCA001053435_02217 CDS open 5254-5778 _na     174_aa hypothetical protein
1086 JVTL01000030.1 GCA001053435_02218 CDS open 6009-6386 _na     125_aa hypothetical protein
1087 JVTL01000030.1 GCA001053435_02219 CDS open 6833-7783 _na     316_aa repA replication protein RepA
1088 JVTL01000030.1 GCA001053435_02220 CDS open 8160-8423 _na     87_aa copG Ribbon-helix-helix protein CopG domain-containing protein
1089 JVTL01000030.1 GCA001053435_02221 CDS open 8611-8886 _na     91_aa DUF805 domain-containing protein
1090 JVTL01000030.1 GCA001053435_02222 CDS open 8928-9299 _na     123_aa 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase
1091 JVTL01000030.1 GCA001053435_02223 CDS open 9511-13416 _na     1301_aa trwC TrwC relaxase domain-containing protein
1092 JVTL01000030.1 GCA001053435_02224 CDS open 14325-14654 _na     109_aa hypothetical protein
1093 JVTL01000030.1 GCA001053435_02225 CDS open 14641-15288 _na     215_aa AAA family ATPase
1094 JVTL01000030.1 GCA001053435_02226 CDS open 15766-16215 _na     149_aa helix-turn-helix domain-containing protein
1095 JVTL01000030.1 GCA001053435_02227 CDS open 16212-16766 _na     184_aa PIN domain-containing protein
1096 JVTL01000030.1 GCA001053435_02228 CDS open 17419-18150 _na     243_aa SDR family NAD(P)-dependent oxidoreductase
1097 JVTL01000030.1 GCA001053435_02229 CDS open 18143-19591 _na     482_aa ABC transporter ATP-binding protein
1098 JVTL01000030.1 GCA001053435_02230 CDS open 19838-20263 _na     141_aa hypothetical protein
1099 JVTL01000030.1 GCA001053435_02231 CDS open 20376-21350 _na     324_aa alpha/beta hydrolase
1100 JVTL01000030.1 GCA001053435_02232 CDS open 21343-22170 _na     275_aa HTTM domain-containing protein
1101 JVTL01000030.1 GCA001053435_02233 CDS open 22178-22387 _na     69_aa hypothetical protein
1102 JVTL01000030.1 GCA001053435_02234 CDS open 22788-24209 _na     473_aa NAD(P)/FAD-dependent oxidoreductase
1103 JVTL01000030.1 GCA001053435_02235 CDS open 24309-24491 _na     60_aa hypothetical protein
1104 JVTL01000030.1 GCA001053435_02236 CDS open 24682-24831 _na     49_aa hypothetical protein
1105 JVTL01000030.1 GCA001053435_02237 CDS open 24981-25559 _na     192_aa IS3 family transposase
1106 JVTL01000030.1 GCA001053435_02212 gene open 153-1772 istA
1107 JVTL01000030.1 GCA001053435_02213 gene open 1780-2577
1108 JVTL01000030.1 GCA001053435_02214 gene open 2779-3405
1109 JVTL01000030.1 GCA001053435_02215 gene open 4292-4711
1110 JVTL01000030.1 GCA001053435_02216 gene open 4704-5186
1111 JVTL01000030.1 GCA001053435_02217 gene open 5254-5778
1112 JVTL01000030.1 GCA001053435_02218 gene open 6009-6386
1113 JVTL01000030.1 GCA001053435_02219 gene open 6833-7783 repA
1114 JVTL01000030.1 GCA001053435_02220 gene open 8160-8423 copG
1115 JVTL01000030.1 GCA001053435_02221 gene open 8611-8886
1116 JVTL01000030.1 GCA001053435_02222 gene open 8928-9299
1117 JVTL01000030.1 GCA001053435_02223 gene open 9511-13416 trwC
1118 JVTL01000030.1 GCA001053435_02224 gene open 14325-14654
1119 JVTL01000030.1 GCA001053435_02225 gene open 14641-15288
1120 JVTL01000030.1 GCA001053435_02226 gene open 15766-16215
1121 JVTL01000030.1 GCA001053435_02227 gene open 16212-16766
1122 JVTL01000030.1 GCA001053435_02228 gene open 17419-18150
1123 JVTL01000030.1 GCA001053435_02229 gene open 18143-19591
1124 JVTL01000030.1 GCA001053435_02230 gene open 19838-20263
1125 JVTL01000030.1 GCA001053435_02231 gene open 20376-21350
1126 JVTL01000030.1 GCA001053435_02232 gene open 21343-22170
1127 JVTL01000030.1 GCA001053435_02233 gene open 22178-22387
1128 JVTL01000030.1 GCA001053435_02234 gene open 22788-24209
1129 JVTL01000030.1 GCA001053435_02235 gene open 24309-24491
1130 JVTL01000030.1 GCA001053435_02236 gene open 24682-24831
1131 JVTL01000030.1 GCA001053435_02237 gene open 24981-25559
1132 JVTL01000031.1 repeat_region open 8683-9940 CRISPR array with 21 repeats of length 28%2C consensus sequence GTCCGCCCCGCGTAAGCGGGGATGAGCC and spacer length 33
1133 JVTL01000031.1 GCA001053435_02238 CDS open 86-883 _na     265_aa IstB-like ATP-binding protein
1134 JVTL01000031.1 GCA001053435_02239 CDS open 891-2510 _na     539_aa istA IS21 family transposase
1135 JVTL01000031.1 GCA001053435_02240 CDS open 2764-4215 _na     483_aa casA type I-E CRISPR-associated protein Cse1/CasA
1136 JVTL01000031.1 GCA001053435_02241 CDS open 4208-4816 _na     202_aa casB type I-E CRISPR-associated protein Cse2/CasB
1137 JVTL01000031.1 GCA001053435_02242 CDS open 4836-5981 _na     381_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
1138 JVTL01000031.1 GCA001053435_02243 CDS open 5985-6683 _na     232_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
1139 JVTL01000031.1 GCA001053435_02244 CDS open 6680-7339 _na     219_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
1140 JVTL01000031.1 GCA001053435_02245 CDS open 7352-8290 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
1141 JVTL01000031.1 GCA001053435_02246 CDS open 8386-8505 _na     39_aa hypothetical protein
1142 JVTL01000031.1 GCA001053435_02238 gene open 86-883
1143 JVTL01000031.1 GCA001053435_02239 gene open 891-2510 istA
1144 JVTL01000031.1 GCA001053435_02240 gene open 2764-4215 casA
1145 JVTL01000031.1 GCA001053435_02241 gene open 4208-4816 casB
1146 JVTL01000031.1 GCA001053435_02242 gene open 4836-5981 cas7e
1147 JVTL01000031.1 GCA001053435_02243 gene open 5985-6683 cas5e
1148 JVTL01000031.1 GCA001053435_02244 gene open 6680-7339 cas6e
1149 JVTL01000031.1 GCA001053435_02245 gene open 7352-8290 cas1e
1150 JVTL01000031.1 GCA001053435_02246 gene open 8386-8505
1151 JVTL01000032.1 GCA001053435_02297 gene open 49992-50431 RNaseP_bact_a
1152 JVTL01000032.1 GCA001053435_02297 ncRNA open 49992-50431 Bacterial RNase P class A
1153 JVTL01000032.1 GCA001053435_02247 CDS open 404-784 _na     126_aa integrase core domain-containing protein
1154 JVTL01000032.1 GCA001053435_02248 CDS open 1219-2211 _na     330_aa DUF3800 domain-containing protein
1155 JVTL01000032.1 GCA001053435_02249 CDS open 2125-3012 _na     295_aa hypothetical protein
1156 JVTL01000032.1 GCA001053435_02250 CDS open 3109-3408 _na     99_aa yrhK YrhK family protein
1157 JVTL01000032.1 GCA001053435_02251 CDS open 3418-3534 _na     38_aa hypothetical protein
1158 JVTL01000032.1 GCA001053435_02252 CDS open 3582-6248 _na     888_aa DEAD/DEAH box helicase
1159 JVTL01000032.1 GCA001053435_02253 CDS open 6238-7215 _na     325_aa DUF1837 domain-containing protein
1160 JVTL01000032.1 GCA001053435_02254 CDS open 7782-10046 _na     754_aa RNA helicase
1161 JVTL01000032.1 GCA001053435_02255 CDS open 10072-10455 _na     127_aa hypothetical protein
1162 JVTL01000032.1 GCA001053435_02256 CDS open 10940-11488 _na     182_aa FAD-dependent monooxygenase
1163 JVTL01000032.1 GCA001053435_02257 CDS open 11547-12683 _na     378_aa ATPase AAA-type core domain-containing protein
1164 JVTL01000032.1 GCA001053435_02258 CDS open 12683-13357 _na     224_aa DUF4276 domain-containing protein
1165 JVTL01000032.1 GCA001053435_02259 CDS open 13678-13899 _na     73_aa Phage protein
1166 JVTL01000032.1 GCA001053435_02260 CDS open 14025-14162 _na     45_aa hypothetical protein
1167 JVTL01000032.1 GCA001053435_02261 CDS open 14159-14305 _na     48_aa hypothetical protein
1168 JVTL01000032.1 GCA001053435_02262 CDS open 14266-14541 _na     91_aa tetR TetR family transcriptional regulator
1169 JVTL01000032.1 GCA001053435_02263 CDS open 14728-15864 _na     378_aa DUF3322 domain-containing protein
1170 JVTL01000032.1 GCA001053435_02264 CDS open 15851-19249 _na     1132_aa AAA family ATPase
1171 JVTL01000032.1 GCA001053435_02265 CDS open 19270-19908 _na     212_aa DUF4194 domain-containing protein
1172 JVTL01000032.1 GCA001053435_02266 CDS open 19905-21338 _na     477_aa DUF3375 domain-containing protein
1173 JVTL01000032.1 GCA001053435_02267 CDS open 21723-22442 _na     239_aa ATP/GTP-binding protein
1174 JVTL01000032.1 GCA001053435_02268 CDS open 22541-23056 _na     171_aa ATP/GTP-binding protein
1175 JVTL01000032.1 GCA001053435_02269 CDS open 23210-23635 _na     141_aa Integral membrane protein
1176 JVTL01000032.1 GCA001053435_02271 CDS open 24081-24530 _na     149_aa Antitoxin SocA-like Panacea domain-containing protein
1177 JVTL01000032.1 GCA001053435_02272 CDS open 24698-24961 _na     87_aa Toxin
1178 JVTL01000032.1 GCA001053435_02273 CDS open 25483-25896 _na     137_aa Secreted protein
1179 JVTL01000032.1 GCA001053435_02274 CDS open 25987-27348 _na     453_aa Lipase
1180 JVTL01000032.1 GCA001053435_02275 CDS open 27569-28504 _na     311_aa Regulatory protein
1181 JVTL01000032.1 GCA001053435_02276 CDS open 28609-29358 _na     249_aa deoD purine-nucleoside phosphorylase
1182 JVTL01000032.1 GCA001053435_02277 CDS open 29379-30800 _na     473_aa Multidrug MFS transporter
1183 JVTL01000032.1 GCA001053435_02278 CDS open 30811-31458 _na     215_aa deoC deoxyribose-phosphate aldolase
1184 JVTL01000032.1 GCA001053435_02279 CDS open 31486-33063 _na     525_aa Phospho-sugar mutase
1185 JVTL01000032.1 GCA001053435_02280 CDS open 33222-34325 _na     367_aa Glycine transporter domain-containing protein
1186 JVTL01000032.1 GCA001053435_02281 CDS open 34392-36071 _na     559_aa Mechanosensitive ion channel
1187 JVTL01000032.1 GCA001053435_02282 CDS open 36135-36935 _na     266_aa Serine hydrolase
1188 JVTL01000032.1 GCA001053435_02283 CDS open 36959-37903 _na     314_aa Polyhydroxybutyrate depolymerase
1189 JVTL01000032.1 GCA001053435_02284 CDS open 38206-38604 _na     132_aa Secreted protein
1190 JVTL01000032.1 GCA001053435_02285 CDS open 38601-39386 _na     261_aa Pyridoxal phosphate phosphatase
1191 JVTL01000032.1 GCA001053435_02286 CDS open 39383-39688 _na     101_aa Acyl carrier protein
1192 JVTL01000032.1 GCA001053435_02287 CDS open 39742-40752 _na     336_aa Hydrolase
1193 JVTL01000032.1 GCA001053435_02288 CDS open 41134-43890 _na     918_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
1194 JVTL01000032.1 GCA001053435_02289 CDS open 44075-44512 _na     145_aa DUF3052 domain-containing protein
1195 JVTL01000032.1 GCA001053435_02291 CDS open 45001-45642 _na     213_aa HAD hydrolase-like protein
1196 JVTL01000032.1 GCA001053435_02292 CDS open 45670-46617 _na     315_aa SURF1-like protein
1197 JVTL01000032.1 GCA001053435_02293 CDS open 46628-47116 _na     162_aa protein-tyrosine-phosphatase
1198 JVTL01000032.1 GCA001053435_02294 CDS open 47227-48087 _na     286_aa Nif3-like dinuclear metal center hexameric protein
1199 JVTL01000032.1 GCA001053435_02295 CDS open 48088-48801 _na     237_aa C4-type zinc ribbon domain-containing protein
1200 JVTL01000032.1 GCA001053435_02296 CDS open 48801-49976 _na     391_aa bifunctional RNase H/acid phosphatase
1201 JVTL01000032.1 GCA001053435_02298 CDS open 50473-51663 _na     396_aa site-specific integrase
1202 JVTL01000032.1 GCA001053435_02299 CDS open 51779-52441 _na     220_aa excalibur calcium-binding domain-containing protein
1203 JVTL01000032.1 GCA001053435_02300 CDS open 52438-52866 _na     142_aa ImmA/IrrE family metallo-endopeptidase
1204 JVTL01000032.1 GCA001053435_02301 CDS open 52811-53311 _na     166_aa HTH cro/C1-type domain-containing protein
1205 JVTL01000032.1 GCA001053435_02302 CDS open 53436-53666 _na     76_aa mqsA MqsA
1206 JVTL01000032.1 GCA001053435_02303 CDS open 53736-54503 _na     255_aa Antirepressor protein C-terminal domain-containing protein
1207 JVTL01000032.1 GCA001053435_02304 CDS open 54504-54767 _na     87_aa hypothetical protein
1208 JVTL01000032.1 GCA001053435_02306 CDS open 55196-55306 _na     36_aa hypothetical protein
1209 JVTL01000032.1 GCA001053435_02307 CDS open 55339-55533 _na     64_aa helix-turn-helix domain-containing protein
1210 JVTL01000032.1 GCA001053435_02308 CDS open 55613-55834 _na     73_aa hypothetical protein
1211 JVTL01000032.1 GCA001053435_02309 CDS open 55813-56076 _na     87_aa hypothetical protein
1212 JVTL01000032.1 GCA001053435_02310 CDS open 56073-56273 _na     66_aa hypothetical protein
1213 JVTL01000032.1 GCA001053435_02311 CDS open 56251-57171 _na     306_aa yqaJ YqaJ viral recombinase domain-containing protein
1214 JVTL01000032.1 GCA001053435_02312 CDS open 57181-57795 _na     204_aa yubB YubB ferredoxin-like domain-containing protein
1215 JVTL01000032.1 GCA001053435_02313 CDS open 57811-58749 _na     312_aa recT Recombinase RecT
1216 JVTL01000032.1 GCA001053435_02314 CDS open 58746-59180 _na     144_aa Single-stranded DNA-binding protein
1217 JVTL01000032.1 GCA001053435_02315 CDS open 59191-59364 _na     57_aa hypothetical protein
1218 JVTL01000032.1 GCA001053435_02316 CDS open 59440-59712 _na     90_aa hypothetical protein
1219 JVTL01000032.1 GCA001053435_02317 CDS open 59709-59852 _na     47_aa hypothetical protein
1220 JVTL01000032.1 GCA001053435_02318 CDS open 60217-60654 _na     145_aa hypothetical protein
1221 JVTL01000032.1 GCA001053435_02319 CDS open 60666-60908 _na     80_aa WGR domain-containing protein
1222 JVTL01000032.1 GCA001053435_02320 CDS open 60872-61054 _na     60_aa DUF222 domain-containing protein
1223 JVTL01000032.1 GCA001053435_02321 CDS open 61065-61502 _na     145_aa hypothetical protein
1224 JVTL01000032.1 GCA001053435_02322 CDS open 61495-61626 _na     43_aa hypothetical protein
1225 JVTL01000032.1 GCA001053435_02323 CDS open 61623-62021 _na     132_aa rusA RusA family crossover junction endodeoxyribonuclease
1226 JVTL01000032.1 GCA001053435_02324 CDS open 62009-62593 _na     194_aa DUF222 domain-containing protein
1227 JVTL01000032.1 GCA001053435_02325 CDS open 62684-62968 _na     94_aa HNH endonuclease
1228 JVTL01000032.1 GCA001053435_02326 CDS open 63087-63410 _na     107_aa Terminase small subunit
1229 JVTL01000032.1 GCA001053435_02327 CDS open 63414-64931 _na     505_aa Terminase
1230 JVTL01000032.1 GCA001053435_02328 CDS open 64941-66272 _na     443_aa phage portal protein
1231 JVTL01000032.1 GCA001053435_02329 CDS open 66269-67051 _na     260_aa HK97 family phage prohead protease
1232 JVTL01000032.1 GCA001053435_02330 CDS open 67070-68278 _na     402_aa phage major capsid protein
1233 JVTL01000032.1 GCA001053435_02331 CDS open 68278-68457 _na     59_aa hypothetical protein
1234 JVTL01000032.1 GCA001053435_02332 CDS open 68463-69023 _na     186_aa head-tail adaptor
1235 JVTL01000032.1 GCA001053435_02333 CDS open 69020-69385 _na     121_aa Head-to-tail stopper
1236 JVTL01000032.1 GCA001053435_02334 CDS open 69366-69638 _na     90_aa HK97 gp10 family phage protein
1237 JVTL01000032.1 GCA001053435_02335 CDS open 69635-70039 _na     134_aa tail terminator
1238 JVTL01000032.1 GCA001053435_02336 CDS open 70131-71048 _na     305_aa Major tail protein
1239 JVTL01000032.1 GCA001053435_02337 CDS open 71169-71531 _na     120_aa Tail assembly chaperone
1240 JVTL01000032.1 GCA001053435_02338 CDS open 71615-71875 _na     86_aa hypothetical protein
1241 JVTL01000032.1 GCA001053435_02339 CDS open 71885-76855 _na     1656_aa tape measure protein
1242 JVTL01000032.1 GCA001053435_02340 CDS open 76865-77650 _na     261_aa Minor tail protein
1243 JVTL01000032.1 GCA001053435_02341 CDS open 77654-79267 _na     537_aa Minor tail protein
1244 JVTL01000032.1 GCA001053435_02342 CDS open 79280-79666 _na     128_aa minor tail protein
1245 JVTL01000032.1 GCA001053435_02343 CDS open 79670-80407 _na     245_aa Minor tail protein
1246 JVTL01000032.1 GCA001053435_02344 CDS open 80411-81652 _na     413_aa Tail fiber protein
1247 JVTL01000032.1 GCA001053435_02345 CDS open 81906-82157 _na     83_aa Chitin-binding type-3 domain-containing protein
1248 JVTL01000032.1 GCA001053435_02346 CDS open 82190-82762 _na     190_aa Chitin-binding type-3 domain-containing protein
1249 JVTL01000032.1 GCA001053435_02347 CDS open 82823-84172 _na     449_aa GH25 family lysozyme
1250 JVTL01000032.1 GCA001053435_02348 CDS open 84174-84545 _na     123_aa Holin
1251 JVTL01000032.1 GCA001053435_02349 CDS open 84545-84967 _na     140_aa MFS transporter
1252 JVTL01000032.1 GCA001053435_02350 CDS open 84945-85373 _na     142_aa Holin
1253 JVTL01000032.1 GCA001053435_02351 CDS open 85416-86069 _na     217_aa mucR MucR family transcriptional regulator
1254 JVTL01000032.1 GCA001053435_02352 CDS open 86066-86470 _na     134_aa Helix-turn-helix domain-containing protein
1255 JVTL01000032.1 GCA001053435_02353 CDS open 86501-86842 _na     113_aa hypothetical protein
1256 JVTL01000032.1 GCA001053435_02354 CDS open 86954-87502 _na     182_aa helix-turn-helix domain-containing protein
1257 JVTL01000032.1 GCA001053435_02355 CDS open 87640-88080 _na     146_aa hypothetical protein
1258 JVTL01000032.1 GCA001053435_02356 CDS open 88136-88471 _na     111_aa hypothetical protein
1259 JVTL01000032.1 GCA001053435_02357 CDS open 88713-90173 _na     486_aa RNB domain-containing ribonuclease
1260 JVTL01000032.1 GCA001053435_02358 CDS open 90224-91492 _na     422_aa Galactokinase
1261 JVTL01000032.1 GCA001053435_02359 CDS open 91690-91872 _na     60_aa SPOR domain-containing protein
1262 JVTL01000032.1 GCA001053435_02360 CDS open 91960-93660 _na     566_aa Metal-chelation protein CHAD
1263 JVTL01000032.1 GCA001053435_02361 CDS open 93753-94850 _na     365_aa DUF2786 domain-containing protein
1264 JVTL01000032.1 GCA001053435_02362 CDS open 95037-96368 _na     443_aa glnA type I glutamate--ammonia ligase
1265 JVTL01000032.1 GCA001053435_02363 CDS open 96393-99491 _na     1032_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
1266 JVTL01000032.1 GCA001053435_02364 CDS open 99604-99921 _na     105_aa Lsr2
1267 JVTL01000032.1 GCA001053435_02365 CDS open 99943-100383 _na     146_aa Secreted protein
1268 JVTL01000032.1 GCA001053435_02366 CDS open 100555-100764 _na     69_aa Secreted protein
1269 JVTL01000032.1 GCA001053435_02367 CDS open 100816-101535 _na     239_aa ABC transporter
1270 JVTL01000032.1 GCA001053435_02368 CDS open 101532-102833 _na     433_aa MFS transporter
1271 JVTL01000032.1 GCA001053435_02369 CDS open 102863-104320 _na     485_aa thrC threonine synthase
1272 JVTL01000032.1 GCA001053435_02370 CDS open 104330-104497 _na     55_aa Cell division protein
1273 JVTL01000032.1 GCA001053435_02371 CDS open 104478-105407 _na     309_aa Trypsin
1274 JVTL01000032.1 GCA001053435_02372 CDS open 105455-105985 _na     176_aa mutT DNA mismatch repair protein MutT
1275 JVTL01000032.1 GCA001053435_02373 CDS open 106180-107814 _na     544_aa CTP synthase
1276 JVTL01000032.1 GCA001053435_02374 CDS open 107970-108356 _na     128_aa hypothetical protein
1277 JVTL01000032.1 GCA001053435_02375 CDS open 108902-109432 _na     176_aa Secreted protein
1278 JVTL01000032.1 GCA001053435_02376 CDS open 109566-110363 _na     265_aa TIGR02391 family protein
1279 JVTL01000032.1 GCA001053435_02377 CDS open 110493-113096 _na     867_aa DNA/RNA helicase%2C superfamily II
1280 JVTL01000032.1 GCA001053435_02378 CDS open 113100-114743 _na     547_aa site-specific DNA-methyltransferase
1281 JVTL01000032.1 GCA001053435_02379 CDS open 115035-115595 _na     186_aa hypothetical protein
1282 JVTL01000032.1 GCA001053435_02380 CDS open 115951-117405 _na     484_aa hypothetical protein
1283 JVTL01000032.1 GCA001053435_02381 CDS open 117637-118560 _na     307_aa hypothetical protein
1284 JVTL01000032.1 GCA001053435_02382 CDS open 118665-120164 _na     499_aa Transposase
1285 JVTL01000032.1 GCA001053435_02247 gene open 404-784
1286 JVTL01000032.1 GCA001053435_02248 gene open 1219-2211
1287 JVTL01000032.1 GCA001053435_02249 gene open 2125-3012
1288 JVTL01000032.1 GCA001053435_02250 gene open 3109-3408 yrhK
1289 JVTL01000032.1 GCA001053435_02251 gene open 3418-3534
1290 JVTL01000032.1 GCA001053435_02252 gene open 3582-6248
1291 JVTL01000032.1 GCA001053435_02253 gene open 6238-7215
1292 JVTL01000032.1 GCA001053435_02254 gene open 7782-10046
1293 JVTL01000032.1 GCA001053435_02255 gene open 10072-10455
1294 JVTL01000032.1 GCA001053435_02256 gene open 10940-11488
1295 JVTL01000032.1 GCA001053435_02257 gene open 11547-12683
1296 JVTL01000032.1 GCA001053435_02258 gene open 12683-13357
1297 JVTL01000032.1 GCA001053435_02259 gene open 13678-13899
1298 JVTL01000032.1 GCA001053435_02260 gene open 14025-14162
1299 JVTL01000032.1 GCA001053435_02261 gene open 14159-14305
1300 JVTL01000032.1 GCA001053435_02262 gene open 14266-14541 tetR
1301 JVTL01000032.1 GCA001053435_02263 gene open 14728-15864
1302 JVTL01000032.1 GCA001053435_02264 gene open 15851-19249
1303 JVTL01000032.1 GCA001053435_02265 gene open 19270-19908
1304 JVTL01000032.1 GCA001053435_02266 gene open 19905-21338
1305 JVTL01000032.1 GCA001053435_02267 gene open 21723-22442
1306 JVTL01000032.1 GCA001053435_02268 gene open 22541-23056
1307 JVTL01000032.1 GCA001053435_02269 gene open 23210-23635
1308 JVTL01000032.1 GCA001053435_02271 gene open 24081-24530
1309 JVTL01000032.1 GCA001053435_02272 gene open 24698-24961
1310 JVTL01000032.1 GCA001053435_02273 gene open 25483-25896
1311 JVTL01000032.1 GCA001053435_02274 gene open 25987-27348
1312 JVTL01000032.1 GCA001053435_02275 gene open 27569-28504
1313 JVTL01000032.1 GCA001053435_02276 gene open 28609-29358 deoD
1314 JVTL01000032.1 GCA001053435_02277 gene open 29379-30800
1315 JVTL01000032.1 GCA001053435_02278 gene open 30811-31458 deoC
1316 JVTL01000032.1 GCA001053435_02279 gene open 31486-33063
1317 JVTL01000032.1 GCA001053435_02280 gene open 33222-34325
1318 JVTL01000032.1 GCA001053435_02281 gene open 34392-36071
1319 JVTL01000032.1 GCA001053435_02282 gene open 36135-36935
1320 JVTL01000032.1 GCA001053435_02283 gene open 36959-37903
1321 JVTL01000032.1 GCA001053435_02284 gene open 38206-38604
1322 JVTL01000032.1 GCA001053435_02285 gene open 38601-39386
1323 JVTL01000032.1 GCA001053435_02286 gene open 39383-39688
1324 JVTL01000032.1 GCA001053435_02287 gene open 39742-40752
1325 JVTL01000032.1 GCA001053435_02288 gene open 41134-43890 aceE
1326 JVTL01000032.1 GCA001053435_02289 gene open 44075-44512
1327 JVTL01000032.1 GCA001053435_02291 gene open 45001-45642
1328 JVTL01000032.1 GCA001053435_02292 gene open 45670-46617
1329 JVTL01000032.1 GCA001053435_02293 gene open 46628-47116
1330 JVTL01000032.1 GCA001053435_02294 gene open 47227-48087
1331 JVTL01000032.1 GCA001053435_02295 gene open 48088-48801
1332 JVTL01000032.1 GCA001053435_02296 gene open 48801-49976
1333 JVTL01000032.1 GCA001053435_02298 gene open 50473-51663
1334 JVTL01000032.1 GCA001053435_02299 gene open 51779-52441
1335 JVTL01000032.1 GCA001053435_02300 gene open 52438-52866
1336 JVTL01000032.1 GCA001053435_02301 gene open 52811-53311
1337 JVTL01000032.1 GCA001053435_02302 gene open 53436-53666 mqsA
1338 JVTL01000032.1 GCA001053435_02303 gene open 53736-54503
1339 JVTL01000032.1 GCA001053435_02304 gene open 54504-54767
1340 JVTL01000032.1 GCA001053435_02306 gene open 55196-55306
1341 JVTL01000032.1 GCA001053435_02307 gene open 55339-55533
1342 JVTL01000032.1 GCA001053435_02308 gene open 55613-55834
1343 JVTL01000032.1 GCA001053435_02309 gene open 55813-56076
1344 JVTL01000032.1 GCA001053435_02310 gene open 56073-56273
1345 JVTL01000032.1 GCA001053435_02311 gene open 56251-57171 yqaJ
1346 JVTL01000032.1 GCA001053435_02312 gene open 57181-57795 yubB
1347 JVTL01000032.1 GCA001053435_02313 gene open 57811-58749 recT
1348 JVTL01000032.1 GCA001053435_02314 gene open 58746-59180
1349 JVTL01000032.1 GCA001053435_02315 gene open 59191-59364
1350 JVTL01000032.1 GCA001053435_02316 gene open 59440-59712
1351 JVTL01000032.1 GCA001053435_02317 gene open 59709-59852
1352 JVTL01000032.1 GCA001053435_02318 gene open 60217-60654
1353 JVTL01000032.1 GCA001053435_02319 gene open 60666-60908
1354 JVTL01000032.1 GCA001053435_02320 gene open 60872-61054
1355 JVTL01000032.1 GCA001053435_02321 gene open 61065-61502
1356 JVTL01000032.1 GCA001053435_02322 gene open 61495-61626
1357 JVTL01000032.1 GCA001053435_02323 gene open 61623-62021 rusA
1358 JVTL01000032.1 GCA001053435_02324 gene open 62009-62593
1359 JVTL01000032.1 GCA001053435_02325 gene open 62684-62968
1360 JVTL01000032.1 GCA001053435_02326 gene open 63087-63410
1361 JVTL01000032.1 GCA001053435_02327 gene open 63414-64931
1362 JVTL01000032.1 GCA001053435_02328 gene open 64941-66272
1363 JVTL01000032.1 GCA001053435_02329 gene open 66269-67051
1364 JVTL01000032.1 GCA001053435_02330 gene open 67070-68278
1365 JVTL01000032.1 GCA001053435_02331 gene open 68278-68457
1366 JVTL01000032.1 GCA001053435_02332 gene open 68463-69023
1367 JVTL01000032.1 GCA001053435_02333 gene open 69020-69385
1368 JVTL01000032.1 GCA001053435_02334 gene open 69366-69638
1369 JVTL01000032.1 GCA001053435_02335 gene open 69635-70039
1370 JVTL01000032.1 GCA001053435_02336 gene open 70131-71048
1371 JVTL01000032.1 GCA001053435_02337 gene open 71169-71531
1372 JVTL01000032.1 GCA001053435_02338 gene open 71615-71875
1373 JVTL01000032.1 GCA001053435_02339 gene open 71885-76855
1374 JVTL01000032.1 GCA001053435_02340 gene open 76865-77650
1375 JVTL01000032.1 GCA001053435_02341 gene open 77654-79267
1376 JVTL01000032.1 GCA001053435_02342 gene open 79280-79666
1377 JVTL01000032.1 GCA001053435_02343 gene open 79670-80407
1378 JVTL01000032.1 GCA001053435_02344 gene open 80411-81652
1379 JVTL01000032.1 GCA001053435_02345 gene open 81906-82157
1380 JVTL01000032.1 GCA001053435_02346 gene open 82190-82762
1381 JVTL01000032.1 GCA001053435_02347 gene open 82823-84172
1382 JVTL01000032.1 GCA001053435_02348 gene open 84174-84545
1383 JVTL01000032.1 GCA001053435_02349 gene open 84545-84967
1384 JVTL01000032.1 GCA001053435_02350 gene open 84945-85373
1385 JVTL01000032.1 GCA001053435_02351 gene open 85416-86069 mucR
1386 JVTL01000032.1 GCA001053435_02352 gene open 86066-86470
1387 JVTL01000032.1 GCA001053435_02353 gene open 86501-86842
1388 JVTL01000032.1 GCA001053435_02354 gene open 86954-87502
1389 JVTL01000032.1 GCA001053435_02355 gene open 87640-88080
1390 JVTL01000032.1 GCA001053435_02356 gene open 88136-88471
1391 JVTL01000032.1 GCA001053435_02357 gene open 88713-90173
1392 JVTL01000032.1 GCA001053435_02358 gene open 90224-91492
1393 JVTL01000032.1 GCA001053435_02359 gene open 91690-91872
1394 JVTL01000032.1 GCA001053435_02360 gene open 91960-93660
1395 JVTL01000032.1 GCA001053435_02361 gene open 93753-94850
1396 JVTL01000032.1 GCA001053435_02362 gene open 95037-96368 glnA
1397 JVTL01000032.1 GCA001053435_02363 gene open 96393-99491
1398 JVTL01000032.1 GCA001053435_02364 gene open 99604-99921
1399 JVTL01000032.1 GCA001053435_02365 gene open 99943-100383
1400 JVTL01000032.1 GCA001053435_02366 gene open 100555-100764
1401 JVTL01000032.1 GCA001053435_02367 gene open 100816-101535
1402 JVTL01000032.1 GCA001053435_02368 gene open 101532-102833
1403 JVTL01000032.1 GCA001053435_02369 gene open 102863-104320 thrC
1404 JVTL01000032.1 GCA001053435_02370 gene open 104330-104497
1405 JVTL01000032.1 GCA001053435_02371 gene open 104478-105407
1406 JVTL01000032.1 GCA001053435_02372 gene open 105455-105985 mutT
1407 JVTL01000032.1 GCA001053435_02373 gene open 106180-107814
1408 JVTL01000032.1 GCA001053435_02374 gene open 107970-108356
1409 JVTL01000032.1 GCA001053435_02375 gene open 108902-109432
1410 JVTL01000032.1 GCA001053435_02376 gene open 109566-110363
1411 JVTL01000032.1 GCA001053435_02377 gene open 110493-113096
1412 JVTL01000032.1 GCA001053435_02378 gene open 113100-114743
1413 JVTL01000032.1 GCA001053435_02379 gene open 115035-115595
1414 JVTL01000032.1 GCA001053435_02380 gene open 115951-117405
1415 JVTL01000032.1 GCA001053435_02381 gene open 117637-118560
1416 JVTL01000032.1 GCA001053435_02382 gene open 118665-120164
1417 JVTL01000032.1 GCA001053435_02270 gene open 23855-23928 trnI
1418 JVTL01000032.1 GCA001053435_02290 gene open 44580-44652 trnV
1419 JVTL01000032.1 GCA001053435_02305 gene open 55088-55160 trnK
1420 JVTL01000032.1 GCA001053435_02270 tRNA open 23855-23928 trnI tRNA-Ile2(cat)
1421 JVTL01000032.1 GCA001053435_02290 tRNA open 44580-44652 trnV tRNA-Val(tac)
1422 JVTL01000032.1 GCA001053435_02305 tRNA open 55088-55160 trnK tRNA-Lys(ttt)
1423 JVTL01000033.1 GCA001053435_02491 gene open 109375-109492 rrf
1424 JVTL01000033.1 regulatory_region open 36102-36207 L31-Corynebacteriaceae ribosomal protein leader
1425 JVTL01000033.1 GCA001053435_02491 rRNA open 109375-109492 rrf 5S ribosomal RNA
1426 JVTL01000033.1 GCA001053435_02383 CDS open 347-3439 _na     1030_aa acyltransferase family protein
1427 JVTL01000033.1 GCA001053435_02384 CDS open 3563-4264 _na     233_aa putative membrane protein
1428 JVTL01000033.1 GCA001053435_02385 CDS open 4347-4721 _na     124_aa Antibiotic biosynthesis monooxygenase
1429 JVTL01000033.1 GCA001053435_02386 CDS open 4795-5346 _na     183_aa SCP domain-containing protein
1430 JVTL01000033.1 GCA001053435_02387 CDS open 5472-7331 _na     619_aa abc-f ribosomal protection-like ABC-F family protein
1431 JVTL01000033.1 GCA001053435_02388 CDS open 7423-8715 _na     430_aa Secreted protein
1432 JVTL01000033.1 GCA001053435_02389 CDS open 8819-9763 _na     314_aa 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
1433 JVTL01000033.1 GCA001053435_02390 CDS open 9760-10614 _na     284_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
1434 JVTL01000033.1 GCA001053435_02391 CDS open 10726-11874 _na     382_aa rpfB Resuscitation-promoting factor RpfB
1435 JVTL01000033.1 GCA001053435_02392 CDS open 12089-12904 _na     271_aa Deoxyribonuclease
1436 JVTL01000033.1 GCA001053435_02393 CDS open 12929-13441 _na     170_aa GNAT family acetyltransferase
1437 JVTL01000033.1 GCA001053435_02394 CDS open 13452-13967 _na     171_aa N-acetyltransferase
1438 JVTL01000033.1 GCA001053435_02395 CDS open 13937-15115 _na     392_aa MFS transporter
1439 JVTL01000033.1 GCA001053435_02396 CDS open 15117-17012 _na     631_aa Methionine--tRNA ligase
1440 JVTL01000033.1 GCA001053435_02397 CDS open 17109-18956 _na     615_aa Choline-glycine betaine transporter
1441 JVTL01000033.1 GCA001053435_02398 CDS open 19119-19976 _na     285_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
1442 JVTL01000033.1 GCA001053435_02399 CDS open 20047-21639 _na     530_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
1443 JVTL01000033.1 GCA001053435_02400 CDS open 21871-22566 _na     231_aa Putative zinc-finger domain-containing protein
1444 JVTL01000033.1 GCA001053435_02401 CDS open 22553-22972 _na     139_aa doxX DoxX family protein
1445 JVTL01000033.1 GCA001053435_02402 CDS open 23064-23846 _na     260_aa DNA-3-methyladenine glycosylase
1446 JVTL01000033.1 GCA001053435_02403 CDS open 23847-25187 _na     446_aa glpR gephyrin-like molybdotransferase receptor GlpR
1447 JVTL01000033.1 GCA001053435_02404 CDS open 25346-26056 _na     236_aa [ribosomal protein uS5]-alanine N-acetyltransferase
1448 JVTL01000033.1 GCA001053435_02405 CDS open 26059-27348 _na     429_aa glp gephyrin-like molybdotransferase Glp
1449 JVTL01000033.1 GCA001053435_02406 CDS open 27386-28312 _na     308_aa UTP--glucose-1-phosphate uridylyltransferase
1450 JVTL01000033.1 GCA001053435_02407 CDS open 28380-28952 _na     190_aa 5-formyltetrahydrofolate cyclo-ligase
1451 JVTL01000033.1 GCA001053435_02408 CDS open 29075-29755 _na     226_aa flgA Flagellar biosynthesis protein FlgA
1452 JVTL01000033.1 GCA001053435_02409 CDS open 29923-30387 _na     154_aa mscL large-conductance mechanosensitive channel protein MscL
1453 JVTL01000033.1 GCA001053435_02410 CDS open 30587-30808 _na     73_aa hypothetical protein
1454 JVTL01000033.1 GCA001053435_02411 CDS open 30829-31437 _na     202_aa Molybdenum cofactor biosynthesis protein
1455 JVTL01000033.1 GCA001053435_02412 CDS open 31519-33015 _na     498_aa Serine protease
1456 JVTL01000033.1 GCA001053435_02413 CDS open 33171-34724 _na     517_aa histidine kinase
1457 JVTL01000033.1 GCA001053435_02414 CDS open 34721-35419 _na     232_aa Response regulator transcription factor
1458 JVTL01000033.1 GCA001053435_02415 CDS open 35637-35810 _na     57_aa rpmF 50S ribosomal protein L32
1459 JVTL01000033.1 GCA001053435_02416 CDS open 35826-36095 _na     89_aa rpmE2 type B 50S ribosomal protein L31
1460 JVTL01000033.1 GCA001053435_02417 CDS open 36715-36951 _na     78_aa rpmB 50S ribosomal protein L28
1461 JVTL01000033.1 GCA001053435_02418 CDS open 36954-37118 _na     54_aa rpmG 50S ribosomal protein L33
1462 JVTL01000033.1 GCA001053435_02419 CDS open 37122-37427 _na     101_aa rpsN 30S ribosomal protein S14
1463 JVTL01000033.1 GCA001053435_02420 CDS open 37443-37697 _na     84_aa rpsR 30S ribosomal protein S18
1464 JVTL01000033.1 GCA001053435_02421 CDS open 37978-38769 _na     263_aa DUF294 domain-containing protein
1465 JVTL01000033.1 GCA001053435_02422 CDS open 38853-39572 _na     239_aa HTH-type pregulator
1466 JVTL01000033.1 GCA001053435_02423 CDS open 39608-40216 _na     202_aa Serine/threonine protein kinase
1467 JVTL01000033.1 GCA001053435_02424 CDS open 40289-40960 _na     223_aa DNA-binding response regulator
1468 JVTL01000033.1 GCA001053435_02425 CDS open 41042-42346 _na     434_aa non-specific serine/threonine protein kinase
1469 JVTL01000033.1 GCA001053435_02426 CDS open 42523-43311 _na     262_aa Serine/threonine protein kinase
1470 JVTL01000033.1 GCA001053435_02427 CDS open 43308-44237 _na     309_aa Serine hydrolase
1471 JVTL01000033.1 GCA001053435_02428 CDS open 44270-45061 _na     263_aa Secreted protein
1472 JVTL01000033.1 GCA001053435_02429 CDS open 45483-45686 _na     67_aa hypothetical protein
1473 JVTL01000033.1 GCA001053435_02430 CDS open 45777-47315 _na     512_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1474 JVTL01000033.1 GCA001053435_02431 CDS open 47343-47972 _na     209_aa purN phosphoribosylglycinamide formyltransferase
1475 JVTL01000033.1 GCA001053435_02432 CDS open 47983-49725 _na     580_aa Membrane protein related to de Novo purine biosynthesis
1476 JVTL01000033.1 GCA001053435_02433 CDS open 50204-50974 _na     256_aa Metallopeptidase
1477 JVTL01000033.1 GCA001053435_02434 CDS open 51469-51939 _na     156_aa parR ParR family transcriptional regulator
1478 JVTL01000033.1 GCA001053435_02435 CDS open 51942-52646 _na     234_aa ABC transporter ATP-binding protein
1479 JVTL01000033.1 GCA001053435_02436 CDS open 52649-55315 _na     888_aa FtsX-like permease family protein
1480 JVTL01000033.1 GCA001053435_02437 CDS open 55678-56442 _na     254_aa Metallopeptidase
1481 JVTL01000033.1 GCA001053435_02438 CDS open 56461-59070 _na     869_aa pcrA DNA helicase PcrA
1482 JVTL01000033.1 GCA001053435_02439 CDS open 59200-59571 _na     123_aa chorismate mutase
1483 JVTL01000033.1 GCA001053435_02440 CDS open 59624-60988 _na     454_aa nhaC Na+/H+ antiporter NhaC
1484 JVTL01000033.1 GCA001053435_02441 CDS open 61096-62727 _na     543_aa pgi glucose-6-phosphate isomerase
1485 JVTL01000033.1 GCA001053435_02442 CDS open 62814-62981 _na     55_aa Cell wall anchor protein
1486 JVTL01000033.1 GCA001053435_02443 CDS open 63294-63560 _na     88_aa relE Addiction module toxin RelE
1487 JVTL01000033.1 GCA001053435_02444 CDS open 63611-64024 _na     137_aa Secreted protein
1488 JVTL01000033.1 GCA001053435_02445 CDS open 64111-64524 _na     137_aa yccF YccF domain-containing protein
1489 JVTL01000033.1 GCA001053435_02446 CDS open 64617-65558 _na     313_aa Transporter
1490 JVTL01000033.1 GCA001053435_02447 CDS open 65595-65840 _na     81_aa hypothetical protein
1491 JVTL01000033.1 GCA001053435_02448 CDS open 65825-66943 _na     372_aa Aminotransferase class V-fold PLP-dependent enzyme
1492 JVTL01000033.1 GCA001053435_02449 CDS open 66943-67785 _na     280_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
1493 JVTL01000033.1 GCA001053435_02450 CDS open 67779-69308 _na     509_aa L-aspartate oxidase
1494 JVTL01000033.1 GCA001053435_02451 CDS open 69309-70538 _na     409_aa nadA quinolinate synthase NadA
1495 JVTL01000033.1 GCA001053435_02452 CDS open 70552-71271 _na     239_aa Hydrolase%2C NUDIX family
1496 JVTL01000033.1 GCA001053435_02453 CDS open 71376-72221 _na     281_aa DNA-(apurinic or apyrimidinic site) lyase
1497 JVTL01000033.1 GCA001053435_02454 CDS open 72292-72456 _na     54_aa hypothetical protein
1498 JVTL01000033.1 GCA001053435_02455 CDS open 72399-72749 _na     116_aa hypothetical protein
1499 JVTL01000033.1 GCA001053435_02456 CDS open 73815-75074 _na     419_aa Alpha-hydroxy-acid oxidizing protein
1500 JVTL01000033.1 GCA001053435_02457 CDS open 75233-75532 _na     99_aa NADH-flavin reductase