HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus pseudopneumoniae (GCA_001193755.1)

Select a Genome:
BAKTA Annotations for GCA_001193755.1
Genome Selected: Streptococcus pseudopneumoniae
ContigsBases CDSrRNA tmRNAtRNA
103 2192562 2146 3 1 36
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4475 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4475 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CQZX01000010.1 GCA001193755_00775 CDS open 46096-46953 _na     285_aa cdaA diadenylate cyclase CdaA
1502 CQZX01000010.1 GCA001193755_00776 CDS open 47088-48056 _na     322_aa trxB Ferredoxin--NADP reductase
1503 CQZX01000010.1 GCA001193755_00777 CDS open 48322-48477 _na     51_aa Phage protein
1504 CQZX01000010.1 GCA001193755_00778 CDS open 48619-48798 _na     59_aa DNA-binding protein
1505 CQZX01000010.1 GCA001193755_00729 gene open 263-745 greA
1506 CQZX01000010.1 GCA001193755_00730 gene open 807-2408 mltG
1507 CQZX01000010.1 GCA001193755_00731 gene open 2489-2983
1508 CQZX01000010.1 GCA001193755_00732 gene open 2980-3441
1509 CQZX01000010.1 GCA001193755_00733 gene open 3451-4785 murC
1510 CQZX01000010.1 GCA001193755_00734 gene open 4796-5413
1511 CQZX01000010.1 GCA001193755_00735 gene open 5461-8559 hepA
1512 CQZX01000010.1 GCA001193755_00736 gene open 8652-9818 malY
1513 CQZX01000010.1 GCA001193755_00737 gene open 9826-10920 metC
1514 CQZX01000010.1 GCA001193755_00738 gene open 11078-12760
1515 CQZX01000010.1 GCA001193755_00739 gene open 12932-14890 aliB
1516 CQZX01000010.1 GCA001193755_00740 gene open 15096-16718 spoVB
1517 CQZX01000010.1 GCA001193755_00741 gene open 16824-18269 murE
1518 CQZX01000010.1 GCA001193755_00742 gene open 18317-18508
1519 CQZX01000010.1 GCA001193755_00743 gene open 18609-19259
1520 CQZX01000010.1 GCA001193755_00744 gene open 19243-19755
1521 CQZX01000010.1 GCA001193755_00745 gene open 19842-20777 ppaC
1522 CQZX01000010.1 GCA001193755_00746 gene open 20863-21147
1523 CQZX01000010.1 GCA001193755_00747 gene open 21137-21886
1524 CQZX01000010.1 GCA001193755_00748 gene open 21940-22299 yabR
1525 CQZX01000010.1 GCA001193755_00749 gene open 22301-23701 ppiB
1526 CQZX01000010.1 GCA001193755_00750 gene open 23784-24287
1527 CQZX01000010.1 GCA001193755_00751 gene open 24459-24698 rpsR
1528 CQZX01000010.1 GCA001193755_00752 gene open 24730-25200 ssbA
1529 CQZX01000010.1 GCA001193755_00753 gene open 25212-25502 rpsF
1530 CQZX01000010.1 GCA001193755_00754 gene open 25655-26998 asnS
1531 CQZX01000010.1 GCA001193755_00755 gene open 27018-27383
1532 CQZX01000010.1 GCA001193755_00756 gene open 27376-28563 aspB
1533 CQZX01000010.1 GCA001193755_00757 gene open 28560-28991 ypmB
1534 CQZX01000010.1 GCA001193755_00758 gene open 29306-29854 ssuE
1535 CQZX01000010.1 GCA001193755_00759 gene open 29978-30706 yaaA
1536 CQZX01000010.1 GCA001193755_00760 gene open 30890-31054
1537 CQZX01000010.1 GCA001193755_00763 gene open 31233-32828
1538 CQZX01000010.1 GCA001193755_00764 gene open 32840-33250 def
1539 CQZX01000010.1 GCA001193755_00765 gene open 33510-34307 yghU
1540 CQZX01000010.1 GCA001193755_00766 gene open 34320-37016 mgtA
1541 CQZX01000010.1 GCA001193755_00767 gene open 37324-38508 mntE
1542 CQZX01000010.1 GCA001193755_00768 gene open 38545-40416 abc-f
1543 CQZX01000010.1 GCA001193755_00769 gene open 40413-41597 cca
1544 CQZX01000010.1 GCA001193755_00770 gene open 41609-42376 dapB
1545 CQZX01000010.1 GCA001193755_00771 gene open 42653-43501 degV
1546 CQZX01000010.1 GCA001193755_00772 gene open 43504-43878
1547 CQZX01000010.1 GCA001193755_00773 gene open 43952-45304 glmM
1548 CQZX01000010.1 GCA001193755_00774 gene open 45330-46109 ybbR
1549 CQZX01000010.1 GCA001193755_00775 gene open 46096-46953 cdaA
1550 CQZX01000010.1 GCA001193755_00776 gene open 47088-48056 trxB
1551 CQZX01000010.1 GCA001193755_00777 gene open 48322-48477
1552 CQZX01000010.1 GCA001193755_00778 gene open 48619-48798
1553 CQZX01000011.1 GCA001193755_00781 gene open 1536-1631 csRNA
1554 CQZX01000011.1 GCA001193755_00785 gene open 3682-3773 csRNA
1555 CQZX01000011.1 GCA001193755_00781 ncRNA open 1536-1631 Cia-dependent small RNA csRNA1
1556 CQZX01000011.1 GCA001193755_00785 ncRNA open 3682-3773 Cia-dependent small RNA csRNA1
1557 CQZX01000011.1 GCA001193755_00779 CDS open 69-425 _na     118_aa winged helix-turn-helix domain-containing protein
1558 CQZX01000011.1 GCA001193755_00780 CDS open 624-1277 _na     217_aa Telomeric repeat-binding factor 2
1559 CQZX01000011.1 GCA001193755_00782 CDS open 2124-3095 _na     323_aa ruvB Holliday junction branch migration DNA helicase RuvB
1560 CQZX01000011.1 GCA001193755_00783 CDS open 3076-3348 _na     90_aa Nucleotidyltransferase family protein
1561 CQZX01000011.1 GCA001193755_00784 CDS open 3373-3648 _na     91_aa Nucleotidyltransferase family protein
1562 CQZX01000011.1 GCA001193755_00786 CDS open 3879-4637 _na     252_aa uppS isoprenyl transferase
1563 CQZX01000011.1 GCA001193755_00787 CDS open 4646-5449 _na     267_aa cdsA Phosphatidate cytidylyltransferase
1564 CQZX01000011.1 GCA001193755_00788 CDS open 5471-6730 _na     419_aa rseP RIP metalloprotease RseP
1565 CQZX01000011.1 GCA001193755_00789 CDS open 6743-8596 _na     617_aa proS proline--tRNA ligase
1566 CQZX01000011.1 GCA001193755_00790 CDS open 8695-10074 _na     459_aa bglA 6-phospho-beta-glucosidase
1567 CQZX01000011.1 GCA001193755_00791 CDS open 10266-12074 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1568 CQZX01000011.1 GCA001193755_00792 CDS open 12519-14288 _na     589_aa mtlA PTS system mannitol-specific EIICB component
1569 CQZX01000011.1 GCA001193755_00793 CDS open 14312-16267 _na     651_aa mtlR Putative transcriptional regulator MtlR
1570 CQZX01000011.1 GCA001193755_00794 CDS open 16269-16706 _na     145_aa mtlA2 Mannitol-specific phosphotransferase enzyme IIA component
1571 CQZX01000011.1 GCA001193755_00795 CDS open 16768-17904 _na     378_aa mtlD mannitol-1-phosphate 5-dehydrogenase
1572 CQZX01000011.1 GCA001193755_00797 CDS open 18066-19115 _na     349_aa ssuD Luciferase-like domain-containing protein
1573 CQZX01000011.1 GCA001193755_00798 CDS open 19336-20343 _na     335_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
1574 CQZX01000011.1 GCA001193755_00799 CDS open 20353-20556 _na     67_aa Enoyl-CoA hydratase
1575 CQZX01000011.1 GCA001193755_00800 CDS open 20559-21557 _na     332_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
1576 CQZX01000011.1 GCA001193755_00801 CDS open 21569-22447 _na     292_aa Amino acid ABC transporter substrate-binding protein
1577 CQZX01000011.1 GCA001193755_00802 CDS open 22633-23325 _na     230_aa ABC transmembrane type-1 domain-containing protein
1578 CQZX01000011.1 GCA001193755_00803 CDS open 23329-24051 _na     240_aa ABC transmembrane type-1 domain-containing protein
1579 CQZX01000011.1 GCA001193755_00804 CDS open 24061-24825 _na     254_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
1580 CQZX01000011.1 GCA001193755_00805 CDS open 24901-28752 _na     1283_aa spuA LPXTG-anchored pullulanase SpuA
1581 CQZX01000011.1 GCA001193755_00806 CDS open 29332-31329 _na     665_aa Thiol-activated cytolysin
1582 CQZX01000011.1 GCA001193755_00807 CDS open 32021-32434 _na     137_aa rpsL 30S ribosomal protein S12
1583 CQZX01000011.1 GCA001193755_00808 CDS open 32454-32924 _na     156_aa rpsG 30S ribosomal protein S7
1584 CQZX01000011.1 GCA001193755_00809 CDS open 33202-35283 _na     693_aa fusA elongation factor G
1585 CQZX01000011.1 GCA001193755_00810 CDS open 35387-39778 _na     1463_aa polC PolC-type DNA polymerase III
1586 CQZX01000011.1 GCA001193755_00811 CDS open 39816-40493 _na     225_aa DUF4313 domain-containing protein
1587 CQZX01000011.1 GCA001193755_00812 CDS open 40507-40659 _na     50_aa polC DNA polymerase III PolC
1588 CQZX01000011.1 GCA001193755_00813 CDS open 40681-41922 _na     413_aa ampS Aminopeptidase PepS
1589 CQZX01000011.1 GCA001193755_00814 CDS open 41932-42162 _na     76_aa yeaQ GlsB/YeaQ/YmgE family stress response membrane protein
1590 CQZX01000011.1 GCA001193755_00815 CDS open 42183-42431 _na     82_aa hypothetical protein
1591 CQZX01000011.1 GCA001193755_00816 CDS open 42520-43242 _na     240_aa rsuA Pseudouridine synthase
1592 CQZX01000011.1 GCA001193755_00817 CDS open 43354-44688 _na     444_aa pepC aminopeptidase C
1593 CQZX01000011.1 GCA001193755_00818 CDS open 44744-45655 _na     303_aa manZ Phosphotransferase system%2C mannose-specific EIID
1594 CQZX01000011.1 GCA001193755_00819 CDS open 45679-46482 _na     267_aa manY Phosphotransferase system%2C mannose-specific EIIC
1595 CQZX01000011.1 GCA001193755_00820 CDS open 46510-47499 _na     329_aa agaB PTS system mannose-specific EIIAB component
1596 CQZX01000011.1 GCA001193755_00821 CDS open 47735-48754 _na     339_aa adhP alcohol dehydrogenase AdhP
1597 CQZX01000011.1 GCA001193755_00779 gene open 69-425
1598 CQZX01000011.1 GCA001193755_00780 gene open 624-1277
1599 CQZX01000011.1 GCA001193755_00782 gene open 2124-3095 ruvB
1600 CQZX01000011.1 GCA001193755_00783 gene open 3076-3348
1601 CQZX01000011.1 GCA001193755_00784 gene open 3373-3648
1602 CQZX01000011.1 GCA001193755_00786 gene open 3879-4637 uppS
1603 CQZX01000011.1 GCA001193755_00787 gene open 4646-5449 cdsA
1604 CQZX01000011.1 GCA001193755_00788 gene open 5471-6730 rseP
1605 CQZX01000011.1 GCA001193755_00789 gene open 6743-8596 proS
1606 CQZX01000011.1 GCA001193755_00790 gene open 8695-10074 bglA
1607 CQZX01000011.1 GCA001193755_00791 gene open 10266-12074 glmS
1608 CQZX01000011.1 GCA001193755_00792 gene open 12519-14288 mtlA
1609 CQZX01000011.1 GCA001193755_00793 gene open 14312-16267 mtlR
1610 CQZX01000011.1 GCA001193755_00794 gene open 16269-16706 mtlA2
1611 CQZX01000011.1 GCA001193755_00795 gene open 16768-17904 mtlD
1612 CQZX01000011.1 GCA001193755_00797 gene open 18066-19115 ssuD
1613 CQZX01000011.1 GCA001193755_00798 gene open 19336-20343
1614 CQZX01000011.1 GCA001193755_00799 gene open 20353-20556
1615 CQZX01000011.1 GCA001193755_00800 gene open 20559-21557
1616 CQZX01000011.1 GCA001193755_00801 gene open 21569-22447
1617 CQZX01000011.1 GCA001193755_00802 gene open 22633-23325
1618 CQZX01000011.1 GCA001193755_00803 gene open 23329-24051
1619 CQZX01000011.1 GCA001193755_00804 gene open 24061-24825 glnQ
1620 CQZX01000011.1 GCA001193755_00805 gene open 24901-28752 spuA
1621 CQZX01000011.1 GCA001193755_00806 gene open 29332-31329
1622 CQZX01000011.1 GCA001193755_00807 gene open 32021-32434 rpsL
1623 CQZX01000011.1 GCA001193755_00808 gene open 32454-32924 rpsG
1624 CQZX01000011.1 GCA001193755_00809 gene open 33202-35283 fusA
1625 CQZX01000011.1 GCA001193755_00810 gene open 35387-39778 polC
1626 CQZX01000011.1 GCA001193755_00811 gene open 39816-40493
1627 CQZX01000011.1 GCA001193755_00812 gene open 40507-40659 polC
1628 CQZX01000011.1 GCA001193755_00813 gene open 40681-41922 ampS
1629 CQZX01000011.1 GCA001193755_00814 gene open 41932-42162 yeaQ
1630 CQZX01000011.1 GCA001193755_00815 gene open 42183-42431
1631 CQZX01000011.1 GCA001193755_00816 gene open 42520-43242 rsuA
1632 CQZX01000011.1 GCA001193755_00817 gene open 43354-44688 pepC
1633 CQZX01000011.1 GCA001193755_00818 gene open 44744-45655 manZ
1634 CQZX01000011.1 GCA001193755_00819 gene open 45679-46482 manY
1635 CQZX01000011.1 GCA001193755_00820 gene open 46510-47499 agaB
1636 CQZX01000011.1 GCA001193755_00821 gene open 47735-48754 adhP
1637 CQZX01000012.1 GCA001193755_00860 gene open 40106-40216 Srn266
1638 CQZX01000012.1 GCA001193755_00860 ncRNA open 40106-40216 Streptococcus RNA 266
1639 CQZX01000012.1 regulatory_region open 25801-25889 Glycine riboswitch aptamer
1640 CQZX01000012.1 GCA001193755_00822 CDS open 1480-3024 _na     514_aa prfC peptide chain release factor 3
1641 CQZX01000012.1 GCA001193755_00823 CDS open 3237-3539 _na     100_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
1642 CQZX01000012.1 GCA001193755_00824 CDS open 3539-5005 _na     488_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
1643 CQZX01000012.1 GCA001193755_00825 CDS open 5005-6447 _na     480_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
1644 CQZX01000012.1 GCA001193755_00826 CDS open 6576-7136 _na     186_aa efp elongation factor P
1645 CQZX01000012.1 GCA001193755_00827 CDS open 7158-7547 _na     129_aa yloU General stress protein%2C Gls24 family
1646 CQZX01000012.1 GCA001193755_00828 CDS open 7540-7965 _na     141_aa nusB transcription antitermination factor NusB
1647 CQZX01000012.1 GCA001193755_00829 CDS open 8232-8999 _na     255_aa accA acetyl-CoA carboxylase carboxyl transferase subunit alpha
1648 CQZX01000012.1 GCA001193755_00830 CDS open 8996-9862 _na     288_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
1649 CQZX01000012.1 GCA001193755_00831 CDS open 9899-11266 _na     455_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
1650 CQZX01000012.1 GCA001193755_00832 CDS open 11278-11700 _na     140_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
1651 CQZX01000012.1 GCA001193755_00833 CDS open 11697-12182 _na     161_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
1652 CQZX01000012.1 GCA001193755_00834 CDS open 12185-13420 _na     411_aa fabF beta-ketoacyl-ACP synthase II
1653 CQZX01000012.1 GCA001193755_00835 CDS open 13442-14173 _na     243_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
1654 CQZX01000012.1 GCA001193755_00836 CDS open 14207-15127 _na     306_aa fabD ACP S-malonyltransferase
1655 CQZX01000012.1 GCA001193755_00837 CDS open 15120-16094 _na     324_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
1656 CQZX01000012.1 GCA001193755_00838 CDS open 16317-16541 _na     74_aa acpP Acyl carrier protein
1657 CQZX01000012.1 GCA001193755_00839 CDS open 16600-17574 _na     324_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
1658 CQZX01000012.1 GCA001193755_00840 CDS open 17574-18008 _na     144_aa HTH marR-type domain-containing protein
1659 CQZX01000012.1 GCA001193755_00841 CDS open 18102-18887 _na     261_aa enoyl-CoA hydratase
1660 CQZX01000012.1 GCA001193755_00842 CDS open 19257-20621 _na     454_aa metL1 aspartate kinase
1661 CQZX01000012.1 GCA001193755_00843 CDS open 20624-20995 _na     123_aa manO ManO
1662 CQZX01000012.1 GCA001193755_00844 CDS open 21209-22483 _na     424_aa serS serine--tRNA ligase
1663 CQZX01000012.1 GCA001193755_00845 CDS open 22508-23407 _na     299_aa tehA Exfoliative toxin A
1664 CQZX01000012.1 GCA001193755_00846 CDS open 23516-24064 _na     182_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
1665 CQZX01000012.1 GCA001193755_00847 CDS open 24388-25710 _na     440_aa alsT Amino acid carrier family protein
1666 CQZX01000012.1 GCA001193755_00848 CDS open 26054-28390 _na     778_aa mutS2 endonuclease MutS2
1667 CQZX01000012.1 GCA001193755_00849 CDS open 28494-29042 _na     182_aa cvpA CvpA family protein
1668 CQZX01000012.1 GCA001193755_00850 CDS open 29039-29341 _na     100_aa zapA Cell division protein ZapA
1669 CQZX01000012.1 GCA001193755_00851 CDS open 29428-30309 _na     293_aa rnhC ribonuclease HIII
1670 CQZX01000012.1 GCA001193755_00852 CDS open 30313-30927 _na     204_aa lepB signal peptidase I
1671 CQZX01000012.1 GCA001193755_00854 CDS open 31171-33537 _na     788_aa recD ATP-dependent RecD2 DNA helicase
1672 CQZX01000012.1 GCA001193755_00855 CDS open 33585-34868 _na     427_aa tig trigger factor
1673 CQZX01000012.1 GCA001193755_00856 CDS open 35418-36203 _na     261_aa Alpha%2Calpha-phosphotrehalase
1674 CQZX01000012.1 GCA001193755_00857 CDS open 36151-37035 _na     294_aa Alpha%2Calpha-phosphotrehalase
1675 CQZX01000012.1 GCA001193755_00858 CDS open 37213-39180 _na     655_aa treB PTS trehalose transporter subunit IIBC
1676 CQZX01000012.1 GCA001193755_00859 CDS open 39460-40074 _na     204_aa treR trehalose operon repressor
1677 CQZX01000012.1 GCA001193755_00861 CDS open 40229-40747 _na     172_aa IS1167 transposase
1678 CQZX01000012.1 GCA001193755_00862 CDS open 40744-41505 _na     253_aa ISL3 family transposase
1679 CQZX01000012.1 GCA001193755_00863 CDS open 41571-42497 _na     308_aa amiF Oligopeptide transport ATP-binding protein AmiF
1680 CQZX01000012.1 GCA001193755_00864 CDS open 42508-43575 _na     355_aa amiE Oligopeptide transport ATP-binding protein AmiE
1681 CQZX01000012.1 GCA001193755_00865 CDS open 43584-44510 _na     308_aa oppC oligopeptide ABC transporter permease OppC
1682 CQZX01000012.1 GCA001193755_00866 CDS open 44510-46006 _na     498_aa amiC Oligopeptide transport system permease protein AmiC
1683 CQZX01000012.1 GCA001193755_00867 CDS open 46073-48052 _na     659_aa amiA Oligopeptide-binding protein AmiA
1684 CQZX01000012.1 GCA001193755_00868 CDS open 48328-48513 _na     61_aa Transposase-like protein%2C IS1381 ISSpn7
1685 CQZX01000012.1 GCA001193755_00822 gene open 1480-3024 prfC
1686 CQZX01000012.1 GCA001193755_00823 gene open 3237-3539 gatC
1687 CQZX01000012.1 GCA001193755_00824 gene open 3539-5005 gatA
1688 CQZX01000012.1 GCA001193755_00825 gene open 5005-6447 gatB
1689 CQZX01000012.1 GCA001193755_00826 gene open 6576-7136 efp
1690 CQZX01000012.1 GCA001193755_00827 gene open 7158-7547 yloU
1691 CQZX01000012.1 GCA001193755_00828 gene open 7540-7965 nusB
1692 CQZX01000012.1 GCA001193755_00829 gene open 8232-8999 accA
1693 CQZX01000012.1 GCA001193755_00830 gene open 8996-9862 accD
1694 CQZX01000012.1 GCA001193755_00831 gene open 9899-11266 accC
1695 CQZX01000012.1 GCA001193755_00832 gene open 11278-11700 fabZ
1696 CQZX01000012.1 GCA001193755_00833 gene open 11697-12182 accB
1697 CQZX01000012.1 GCA001193755_00834 gene open 12185-13420 fabF
1698 CQZX01000012.1 GCA001193755_00835 gene open 13442-14173 fabG
1699 CQZX01000012.1 GCA001193755_00836 gene open 14207-15127 fabD
1700 CQZX01000012.1 GCA001193755_00837 gene open 15120-16094 fabK
1701 CQZX01000012.1 GCA001193755_00838 gene open 16317-16541 acpP
1702 CQZX01000012.1 GCA001193755_00839 gene open 16600-17574 fabH
1703 CQZX01000012.1 GCA001193755_00840 gene open 17574-18008
1704 CQZX01000012.1 GCA001193755_00841 gene open 18102-18887
1705 CQZX01000012.1 GCA001193755_00842 gene open 19257-20621 metL1
1706 CQZX01000012.1 GCA001193755_00843 gene open 20624-20995 manO
1707 CQZX01000012.1 GCA001193755_00844 gene open 21209-22483 serS
1708 CQZX01000012.1 GCA001193755_00845 gene open 22508-23407 tehA
1709 CQZX01000012.1 GCA001193755_00846 gene open 23516-24064 yciW
1710 CQZX01000012.1 GCA001193755_00847 gene open 24388-25710 alsT
1711 CQZX01000012.1 GCA001193755_00848 gene open 26054-28390 mutS2
1712 CQZX01000012.1 GCA001193755_00849 gene open 28494-29042 cvpA
1713 CQZX01000012.1 GCA001193755_00850 gene open 29039-29341 zapA
1714 CQZX01000012.1 GCA001193755_00851 gene open 29428-30309 rnhC
1715 CQZX01000012.1 GCA001193755_00852 gene open 30313-30927 lepB
1716 CQZX01000012.1 GCA001193755_00854 gene open 31171-33537 recD
1717 CQZX01000012.1 GCA001193755_00855 gene open 33585-34868 tig
1718 CQZX01000012.1 GCA001193755_00856 gene open 35418-36203
1719 CQZX01000012.1 GCA001193755_00857 gene open 36151-37035
1720 CQZX01000012.1 GCA001193755_00858 gene open 37213-39180 treB
1721 CQZX01000012.1 GCA001193755_00859 gene open 39460-40074 treR
1722 CQZX01000012.1 GCA001193755_00861 gene open 40229-40747
1723 CQZX01000012.1 GCA001193755_00862 gene open 40744-41505
1724 CQZX01000012.1 GCA001193755_00863 gene open 41571-42497 amiF
1725 CQZX01000012.1 GCA001193755_00864 gene open 42508-43575 amiE
1726 CQZX01000012.1 GCA001193755_00865 gene open 43584-44510 oppC
1727 CQZX01000012.1 GCA001193755_00866 gene open 44510-46006 amiC
1728 CQZX01000012.1 GCA001193755_00867 gene open 46073-48052 amiA
1729 CQZX01000012.1 GCA001193755_00868 gene open 48328-48513
1730 CQZX01000013.1 GCA001193755_00873 gene open 3747-3809 Spy392987
1731 CQZX01000013.1 GCA001193755_00898 gene open 27822-27886 Bacilli-1
1732 CQZX01000013.1 GCA001193755_00873 ncRNA open 3747-3809 S. pyogenes antisense RNA 392987
1733 CQZX01000013.1 GCA001193755_00898 ncRNA open 27822-27886 Bacilli-1 RNA
1734 CQZX01000013.1 regulatory_region open 39860-39943 Ribosomal protein L13 leader
1735 CQZX01000013.1 repeat_region open 12369-12539 CRISPR array with 3 repeats of length 23%2C consensus sequence GTTGCATTACCAAAAGCGACTTC and spacer length 46
1736 CQZX01000013.1 GCA001193755_00869 CDS open 80-1435 _na     451_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
1737 CQZX01000013.1 GCA001193755_00870 CDS open 1492-2268 _na     258_aa Aminoglycoside phosphotransferase
1738 CQZX01000013.1 GCA001193755_00871 CDS open 2278-3054 _na     258_aa recX recombination regulator RecX
1739 CQZX01000013.1 GCA001193755_00872 CDS open 3143-3676 _na     177_aa ygaC Nucleoside triphosphate/diphosphate phosphatase
1740 CQZX01000013.1 GCA001193755_00874 CDS open 4392-4730 _na     112_aa mutR Transcriptional regulators%2C MutR family
1741 CQZX01000013.1 GCA001193755_00875 CDS open 4743-5516 _na     257_aa Methyltransferase domain-containing protein
1742 CQZX01000013.1 GCA001193755_00876 CDS open 5962-6717 _na     251_aa queH Epoxyqueuosine reductase QueH
1743 CQZX01000013.1 GCA001193755_00877 CDS open 6855-8477 _na     540_aa groL chaperonin GroEL
1744 CQZX01000013.1 GCA001193755_00878 CDS open 8493-8777 _na     94_aa groES co-chaperone GroES
1745 CQZX01000013.1 GCA001193755_00880 CDS open 9047-9442 _na     131_aa ssb single-stranded DNA-binding protein
1746 CQZX01000013.1 GCA001193755_00881 CDS open 9520-10281 _na     253_aa ydfG 3-oxoacyl-ACP reductase
1747 CQZX01000013.1 GCA001193755_00882 CDS open 10314-10940 _na     208_aa ytpR YtpR family tRNA-binding protein
1748 CQZX01000013.1 GCA001193755_00883 CDS open 10956-11273 _na     105_aa trxA Thioredoxin domain-containing protein
1749 CQZX01000013.1 GCA001193755_00884 CDS open 11270-11569 _na     99_aa DUF4651 domain-containing protein
1750 CQZX01000013.1 GCA001193755_00885 CDS open 11774-11962 _na     62_aa Choline-binding protein Cbp5
1751 CQZX01000013.1 GCA001193755_00886 CDS open 12894-13340 _na     148_aa lytTR HTH LytTR-type domain-containing protein
1752 CQZX01000013.1 GCA001193755_00887 CDS open 13454-13957 _na     167_aa Membrane-associated phospholipid phosphatase
1753 CQZX01000013.1 GCA001193755_00888 CDS open 14053-15813 _na     586_aa ABC transporter%2C permease and ATP-binding protein%2C multidrug export
1754 CQZX01000013.1 GCA001193755_00889 CDS open 15803-17530 _na     575_aa ABC transporter%2C ATP-binding protein%2C multidrug export
1755 CQZX01000013.1 GCA001193755_00890 CDS open 17547-18017 _na     156_aa marR Transcriptional regulator%2C MarR family
1756 CQZX01000013.1 GCA001193755_00891 CDS open 18194-18910 _na     238_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1757 CQZX01000013.1 GCA001193755_00892 CDS open 19595-21010 _na     471_aa ply cholesterol-dependent cytolysin pneumolysin
1758 CQZX01000013.1 GCA001193755_00893 CDS open 21021-21431 _na     136_aa hypothetical protein
1759 CQZX01000013.1 GCA001193755_00894 CDS open 21424-22032 _na     202_aa hypothetical protein
1760 CQZX01000013.1 GCA001193755_00895 CDS open 22047-22505 _na     152_aa DUF4231 domain-containing protein
1761 CQZX01000013.1 GCA001193755_00896 CDS open 22817-26353 _na     1178_aa Surface anchored protein
1762 CQZX01000013.1 GCA001193755_00897 CDS open 27191-27694 _na     167_aa Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein
1763 CQZX01000013.1 GCA001193755_00899 CDS open 28335-28883 _na     182_aa PIN domain-containing protein
1764 CQZX01000013.1 GCA001193755_00900 CDS open 28876-29634 _na     252_aa Zinc metallopeptidase
1765 CQZX01000013.1 GCA001193755_00901 CDS open 29635-29973 _na     112_aa XRE family transcriptional regulator
1766 CQZX01000013.1 GCA001193755_00902 CDS open 30502-31452 _na     316_aa Lytic amidase
1767 CQZX01000013.1 GCA001193755_00903 CDS open 31828-33198 _na     456_aa norM Damage inducible DinF protein
1768 CQZX01000013.1 GCA001193755_00904 CDS open 33313-34479 _na     388_aa recA recombinase RecA
1769 CQZX01000013.1 GCA001193755_00905 CDS open 34534-35790 _na     418_aa cinA competence/damage-inducible protein A
1770 CQZX01000013.1 GCA001193755_00906 CDS open 35875-36891 _na     338_aa brpA biofilm formation/cell division transcriptional regulator BrpA
1771 CQZX01000013.1 GCA001193755_00907 CDS open 36899-37417 _na     172_aa rimL N-acetyltransferase domain-containing protein
1772 CQZX01000013.1 GCA001193755_00908 CDS open 37407-37850 _na     147_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1773 CQZX01000013.1 GCA001193755_00909 CDS open 38040-38660 _na     206_aa Lipoprotein
1774 CQZX01000013.1 GCA001193755_00910 CDS open 38978-39370 _na     130_aa rpsI 30S ribosomal protein S9
1775 CQZX01000013.1 GCA001193755_00911 CDS open 39390-39836 _na     148_aa rplM 50S ribosomal protein L13
1776 CQZX01000013.1 GCA001193755_00912 CDS open 40191-40508 _na     105_aa GTP cyclohydrolase
1777 CQZX01000013.1 GCA001193755_00913 CDS open 40714-41526 _na     270_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1778 CQZX01000013.1 GCA001193755_00914 CDS open 41685-42239 _na     184_aa folE GTP cyclohydrolase I FolE
1779 CQZX01000013.1 GCA001193755_00915 CDS open 42220-43542 _na     440_aa tetrahydrofolate synthase
1780 CQZX01000013.1 GCA001193755_00916 CDS open 43544-44491 _na     315_aa folP dihydropteroate synthase
1781 CQZX01000013.1 GCA001193755_00918 CDS open 44730-45437 _na     235_aa Metal-dependent CAAX amino terminal membrane protease family protein
1782 CQZX01000013.1 GCA001193755_00919 CDS open 45490-46908 _na     472_aa nCS2 Xanthine/uracil permease family protein
1783 CQZX01000013.1 GCA001193755_00920 CDS open 47098-47910 _na     270_aa cof Cof family protein
1784 CQZX01000013.1 GCA001193755_00869 gene open 80-1435 rlmD
1785 CQZX01000013.1 GCA001193755_00870 gene open 1492-2268
1786 CQZX01000013.1 GCA001193755_00871 gene open 2278-3054 recX
1787 CQZX01000013.1 GCA001193755_00872 gene open 3143-3676 ygaC
1788 CQZX01000013.1 GCA001193755_00874 gene open 4392-4730 mutR
1789 CQZX01000013.1 GCA001193755_00875 gene open 4743-5516
1790 CQZX01000013.1 GCA001193755_00876 gene open 5962-6717 queH
1791 CQZX01000013.1 GCA001193755_00877 gene open 6855-8477 groL
1792 CQZX01000013.1 GCA001193755_00878 gene open 8493-8777 groES
1793 CQZX01000013.1 GCA001193755_00880 gene open 9047-9442 ssb
1794 CQZX01000013.1 GCA001193755_00881 gene open 9520-10281 ydfG
1795 CQZX01000013.1 GCA001193755_00882 gene open 10314-10940 ytpR
1796 CQZX01000013.1 GCA001193755_00883 gene open 10956-11273 trxA
1797 CQZX01000013.1 GCA001193755_00884 gene open 11270-11569
1798 CQZX01000013.1 GCA001193755_00885 gene open 11774-11962
1799 CQZX01000013.1 GCA001193755_00886 gene open 12894-13340 lytTR
1800 CQZX01000013.1 GCA001193755_00887 gene open 13454-13957
1801 CQZX01000013.1 GCA001193755_00888 gene open 14053-15813
1802 CQZX01000013.1 GCA001193755_00889 gene open 15803-17530
1803 CQZX01000013.1 GCA001193755_00890 gene open 17547-18017 marR
1804 CQZX01000013.1 GCA001193755_00891 gene open 18194-18910 tACO1
1805 CQZX01000013.1 GCA001193755_00892 gene open 19595-21010 ply
1806 CQZX01000013.1 GCA001193755_00893 gene open 21021-21431
1807 CQZX01000013.1 GCA001193755_00894 gene open 21424-22032
1808 CQZX01000013.1 GCA001193755_00895 gene open 22047-22505
1809 CQZX01000013.1 GCA001193755_00896 gene open 22817-26353
1810 CQZX01000013.1 GCA001193755_00897 gene open 27191-27694
1811 CQZX01000013.1 GCA001193755_00899 gene open 28335-28883
1812 CQZX01000013.1 GCA001193755_00900 gene open 28876-29634
1813 CQZX01000013.1 GCA001193755_00901 gene open 29635-29973
1814 CQZX01000013.1 GCA001193755_00902 gene open 30502-31452
1815 CQZX01000013.1 GCA001193755_00903 gene open 31828-33198 norM
1816 CQZX01000013.1 GCA001193755_00904 gene open 33313-34479 recA
1817 CQZX01000013.1 GCA001193755_00905 gene open 34534-35790 cinA
1818 CQZX01000013.1 GCA001193755_00906 gene open 35875-36891 brpA
1819 CQZX01000013.1 GCA001193755_00907 gene open 36899-37417 rimL
1820 CQZX01000013.1 GCA001193755_00908 gene open 37407-37850 tsaE
1821 CQZX01000013.1 GCA001193755_00909 gene open 38040-38660
1822 CQZX01000013.1 GCA001193755_00910 gene open 38978-39370 rpsI
1823 CQZX01000013.1 GCA001193755_00911 gene open 39390-39836 rplM
1824 CQZX01000013.1 GCA001193755_00912 gene open 40191-40508
1825 CQZX01000013.1 GCA001193755_00913 gene open 40714-41526 folK
1826 CQZX01000013.1 GCA001193755_00914 gene open 41685-42239 folE
1827 CQZX01000013.1 GCA001193755_00915 gene open 42220-43542
1828 CQZX01000013.1 GCA001193755_00916 gene open 43544-44491 folP
1829 CQZX01000013.1 GCA001193755_00918 gene open 44730-45437
1830 CQZX01000013.1 GCA001193755_00919 gene open 45490-46908 nCS2
1831 CQZX01000013.1 GCA001193755_00920 gene open 47098-47910 cof
1832 CQZX01000014.1 rep_origin open 13382-13538
1833 CQZX01000014.1 GCA001193755_00964 gene open 43894-43938 SpF51_sRNA
1834 CQZX01000014.1 GCA001193755_00964 ncRNA open 43894-43938 Streptococcus sRNA SpF51
1835 CQZX01000014.1 GCA001193755_00921 CDS open 169-648 _na     159_aa Competence-specific global transcription modulator
1836 CQZX01000014.1 GCA001193755_00922 CDS open 768-2726 _na     652_aa ftsH ATP-dependent zinc metalloprotease FtsH
1837 CQZX01000014.1 GCA001193755_00923 CDS open 2742-3284 _na     180_aa hpt hypoxanthine phosphoribosyltransferase
1838 CQZX01000014.1 GCA001193755_00924 CDS open 3289-4566 _na     425_aa tilS tRNA(Ile)-lysidine synthase
1839 CQZX01000014.1 GCA001193755_00925 CDS open 4563-5831 _na     422_aa penP Beta-lactamase class A catalytic domain-containing protein
1840 CQZX01000014.1 GCA001193755_00926 CDS open 5824-5946 _na     40_aa SP_0009 family protein
1841 CQZX01000014.1 GCA001193755_00927 CDS open 5951-6319 _na     122_aa ftsB Septum formation initiator family protein
1842 CQZX01000014.1 GCA001193755_00928 CDS open 6312-6578 _na     88_aa rqcP RQC P-site tRNA stabilizing factor
1843 CQZX01000014.1 GCA001193755_00929 CDS open 6636-10145 _na     1169_aa mfd transcription-repair coupling factor
1844 CQZX01000014.1 GCA001193755_00930 CDS open 10146-10715 _na     189_aa pth aminoacyl-tRNA hydrolase
1845 CQZX01000014.1 GCA001193755_00931 CDS open 10787-11902 _na     371_aa ychF redox-regulated ATPase YchF
1846 CQZX01000014.1 GCA001193755_00932 CDS open 11986-12180 _na     64_aa DUF951 domain-containing protein
1847 CQZX01000014.1 GCA001193755_00933 CDS open 12245-13381 _na     378_aa dnaN DNA polymerase III subunit beta
1848 CQZX01000014.1 GCA001193755_00934 CDS open 13540-14901 _na     453_aa dnaA chromosomal replication initiator protein DnaA
1849 CQZX01000014.1 GCA001193755_00935 CDS open 15114-15857 _na     247_aa spo0J Chromosome segregation protein
1850 CQZX01000014.1 GCA001193755_00936 CDS open 15930-17111 _na     393_aa degQ Serine protease
1851 CQZX01000014.1 GCA001193755_00937 CDS open 17294-17773 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
1852 CQZX01000014.1 GCA001193755_00939 CDS open 18052-18177 _na     41_aa comC competence-stimulating peptide ComC
1853 CQZX01000014.1 GCA001193755_00940 CDS open 18198-19523 _na     441_aa yesM Histidine protein kinase
1854 CQZX01000014.1 GCA001193755_00941 CDS open 19520-20272 _na     250_aa lytT Accessory gene regulator protein A
1855 CQZX01000014.1 GCA001193755_00944 CDS open 20515-21057 _na     180_aa acrR HTH tetR-type domain-containing protein
1856 CQZX01000014.1 GCA001193755_00945 CDS open 21185-23824 _na     879_aa ABC-2 type transporter transmembrane domain-containing protein
1857 CQZX01000014.1 GCA001193755_00946 CDS open 23854-26397 _na     847_aa yfhO ABC transporter permease component
1858 CQZX01000014.1 GCA001193755_00947 CDS open 26457-28079 _na     540_aa uup ABC transporter ATP-binding protein
1859 CQZX01000014.1 GCA001193755_00948 CDS open 28285-29310 _na     341_aa trpS tryptophan--tRNA ligase
1860 CQZX01000014.1 GCA001193755_00949 CDS open 29462-30940 _na     492_aa guaB IMP dehydrogenase
1861 CQZX01000014.1 GCA001193755_00950 CDS open 30996-32087 _na     363_aa recF DNA replication/repair protein RecF
1862 CQZX01000014.1 GCA001193755_00951 CDS open 32090-32458 _na     122_aa ybcJ S4 domain protein YaaA
1863 CQZX01000014.1 GCA001193755_00952 CDS open 32617-33867 _na     416_aa yfmF EF-P 5-aminopentanol modification-associated protein YfmF
1864 CQZX01000014.1 GCA001193755_00953 CDS open 33864-35147 _na     427_aa yfmH EF-P 5-aminopentanol modification-associated protein YfmH
1865 CQZX01000014.1 GCA001193755_00954 CDS open 35189-36031 _na     280_aa rodZ cytoskeleton protein RodZ
1866 CQZX01000014.1 GCA001193755_00955 CDS open 36042-36587 _na     181_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1867 CQZX01000014.1 GCA001193755_00956 CDS open 36584-37411 _na     275_aa ecfA1 energy-coupling factor ABC transporter ATP-binding protein
1868 CQZX01000014.1 GCA001193755_00957 CDS open 37396-38235 _na     279_aa ecfA2 energy-coupling factor transporter ATPase
1869 CQZX01000014.1 GCA001193755_00958 CDS open 38228-39022 _na     264_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
1870 CQZX01000014.1 GCA001193755_00959 CDS open 39082-39900 _na     272_aa mreC rod shape-determining protein MreC
1871 CQZX01000014.1 GCA001193755_00960 CDS open 39900-40394 _na     164_aa mreD rod shape-determining protein MreD
1872 CQZX01000014.1 GCA001193755_00961 CDS open 40488-41666 _na     392_aa pcsB peptidoglycan hydrolase PcsB
1873 CQZX01000014.1 GCA001193755_00962 CDS open 41891-42670 _na     259_aa rpsB 30S ribosomal protein S2
1874 CQZX01000014.1 GCA001193755_00963 CDS open 42749-43789 _na     346_aa tsf translation elongation factor Ts
1875 CQZX01000014.1 GCA001193755_00965 CDS open 43932-44858 _na     308_aa cysK cysteine synthase A
1876 CQZX01000014.1 GCA001193755_00966 CDS open 45143-45778 _na     211_aa yIH1 Xaa-Pro dipeptidase
1877 CQZX01000014.1 GCA001193755_00967 CDS open 45834-47132 _na     432_aa comFA Helicase ComFA
1878 CQZX01000014.1 GCA001193755_00968 CDS open 47129-47791 _na     220_aa comFC Amidophosphoribosyltransferase
1879 CQZX01000014.1 GCA001193755_00921 gene open 169-648
1880 CQZX01000014.1 GCA001193755_00922 gene open 768-2726 ftsH
1881 CQZX01000014.1 GCA001193755_00923 gene open 2742-3284 hpt
1882 CQZX01000014.1 GCA001193755_00924 gene open 3289-4566 tilS
1883 CQZX01000014.1 GCA001193755_00925 gene open 4563-5831 penP
1884 CQZX01000014.1 GCA001193755_00926 gene open 5824-5946
1885 CQZX01000014.1 GCA001193755_00927 gene open 5951-6319 ftsB
1886 CQZX01000014.1 GCA001193755_00928 gene open 6312-6578 rqcP
1887 CQZX01000014.1 GCA001193755_00929 gene open 6636-10145 mfd
1888 CQZX01000014.1 GCA001193755_00930 gene open 10146-10715 pth
1889 CQZX01000014.1 GCA001193755_00931 gene open 10787-11902 ychF
1890 CQZX01000014.1 GCA001193755_00932 gene open 11986-12180
1891 CQZX01000014.1 GCA001193755_00933 gene open 12245-13381 dnaN
1892 CQZX01000014.1 GCA001193755_00934 gene open 13540-14901 dnaA
1893 CQZX01000014.1 GCA001193755_00935 gene open 15114-15857 spo0J
1894 CQZX01000014.1 GCA001193755_00936 gene open 15930-17111 degQ
1895 CQZX01000014.1 GCA001193755_00937 gene open 17294-17773 rlmH
1896 CQZX01000014.1 GCA001193755_00939 gene open 18052-18177 comC
1897 CQZX01000014.1 GCA001193755_00940 gene open 18198-19523 yesM
1898 CQZX01000014.1 GCA001193755_00941 gene open 19520-20272 lytT
1899 CQZX01000014.1 GCA001193755_00944 gene open 20515-21057 acrR
1900 CQZX01000014.1 GCA001193755_00945 gene open 21185-23824
1901 CQZX01000014.1 GCA001193755_00946 gene open 23854-26397 yfhO
1902 CQZX01000014.1 GCA001193755_00947 gene open 26457-28079 uup
1903 CQZX01000014.1 GCA001193755_00948 gene open 28285-29310 trpS
1904 CQZX01000014.1 GCA001193755_00949 gene open 29462-30940 guaB
1905 CQZX01000014.1 GCA001193755_00950 gene open 30996-32087 recF
1906 CQZX01000014.1 GCA001193755_00951 gene open 32090-32458 ybcJ
1907 CQZX01000014.1 GCA001193755_00952 gene open 32617-33867 yfmF
1908 CQZX01000014.1 GCA001193755_00953 gene open 33864-35147 yfmH
1909 CQZX01000014.1 GCA001193755_00954 gene open 35189-36031 rodZ
1910 CQZX01000014.1 GCA001193755_00955 gene open 36042-36587 pgsA
1911 CQZX01000014.1 GCA001193755_00956 gene open 36584-37411 ecfA1
1912 CQZX01000014.1 GCA001193755_00957 gene open 37396-38235 ecfA2
1913 CQZX01000014.1 GCA001193755_00958 gene open 38228-39022 ecfT
1914 CQZX01000014.1 GCA001193755_00959 gene open 39082-39900 mreC
1915 CQZX01000014.1 GCA001193755_00960 gene open 39900-40394 mreD
1916 CQZX01000014.1 GCA001193755_00961 gene open 40488-41666 pcsB
1917 CQZX01000014.1 GCA001193755_00962 gene open 41891-42670 rpsB
1918 CQZX01000014.1 GCA001193755_00963 gene open 42749-43789 tsf
1919 CQZX01000014.1 GCA001193755_00965 gene open 43932-44858 cysK
1920 CQZX01000014.1 GCA001193755_00966 gene open 45143-45778 yIH1
1921 CQZX01000014.1 GCA001193755_00967 gene open 45834-47132 comFA
1922 CQZX01000014.1 GCA001193755_00968 gene open 47129-47791 comFC
1923 CQZX01000014.1 GCA001193755_00938 gene open 17814-17887 trnR
1924 CQZX01000014.1 GCA001193755_00942 gene open 20324-20395 trnE
1925 CQZX01000014.1 GCA001193755_00943 gene open 20401-20474 trnN
1926 CQZX01000014.1 GCA001193755_00938 tRNA open 17814-17887 trnR tRNA-Arg(tct)
1927 CQZX01000014.1 GCA001193755_00942 tRNA open 20324-20395 trnE tRNA-Glu(ttc)
1928 CQZX01000014.1 GCA001193755_00943 tRNA open 20401-20474 trnN tRNA-Asn(gtt)
1929 CQZX01000015.1 GCA001193755_00969 CDS open 110-2107 _na     665_aa metG methionine--tRNA ligase
1930 CQZX01000015.1 GCA001193755_00970 CDS open 2231-3490 _na     419_aa salY ABC transporter permeae
1931 CQZX01000015.1 GCA001193755_00971 CDS open 3492-4193 _na     233_aa lolD ABC transporter domain-containing protein
1932 CQZX01000015.1 GCA001193755_00972 CDS open 4177-5370 _na     397_aa acrA RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein
1933 CQZX01000015.1 GCA001193755_00973 CDS open 5658-7004 _na     448_aa gor glutathione-disulfide reductase
1934 CQZX01000015.1 GCA001193755_00974 CDS open 7200-7736 _na     178_aa Biotin transporter
1935 CQZX01000015.1 GCA001193755_00975 CDS open 7790-8005 _na     71_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
1936 CQZX01000015.1 GCA001193755_00976 CDS open 8104-8424 _na     106_aa YolD-like protein
1937 CQZX01000015.1 GCA001193755_00977 CDS open 8455-8793 _na     112_aa ATP cone domain protein
1938 CQZX01000015.1 GCA001193755_00978 CDS open 8805-9524 _na     239_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
1939 CQZX01000015.1 GCA001193755_00979 CDS open 9514-10032 _na     172_aa rimM ribosome maturation factor RimM
1940 CQZX01000015.1 GCA001193755_00980 CDS open 10063-10851 _na     262_aa menH AB hydrolase-1 domain-containing protein
1941 CQZX01000015.1 GCA001193755_00982 CDS open 11431-11670 _na     79_aa khpA RNA-binding protein KhpA
1942 CQZX01000015.1 GCA001193755_00983 CDS open 11690-11962 _na     90_aa rpsP 30S ribosomal protein S16
1943 CQZX01000015.1 GCA001193755_00984 CDS open 12140-12340 _na     66_aa DNA polymerase III subunit delta
1944 CQZX01000015.1 GCA001193755_00985 CDS open 13024-13518 _na     164_aa Helix-turn-helix transcriptional regulator
1945 CQZX01000015.1 GCA001193755_00986 CDS open 13562-13900 _na     112_aa cadX Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX
1946 CQZX01000015.1 GCA001193755_00987 CDS open 13912-14526 _na     204_aa cadD Cadmium transporter
1947 CQZX01000015.1 GCA001193755_00988 CDS open 15142-15720 _na     192_aa DUF3796 domain-containing protein
1948 CQZX01000015.1 GCA001193755_00989 CDS open 15723-15947 _na     74_aa HTH cro/C1-type domain-containing protein
1949 CQZX01000015.1 GCA001193755_00990 CDS open 16276-16437 _na     53_aa fbpA Fur-regulated basic protein FbpA
1950 CQZX01000015.1 GCA001193755_00991 CDS open 16545-17348 _na     267_aa ppiB Peptidyl-prolyl cis-trans isomerase
1951 CQZX01000015.1 GCA001193755_00992 CDS open 17404-18945 _na     513_aa abc-f ribosomal protection-like ABC-F family protein
1952 CQZX01000015.1 GCA001193755_00993 CDS open 18947-19429 _na     160_aa vanZ VanZ family protein
1953 CQZX01000015.1 GCA001193755_00994 CDS open 19429-20418 _na     329_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
1954 CQZX01000015.1 GCA001193755_00995 CDS open 20387-20494 _na     35_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
1955 CQZX01000015.1 GCA001193755_00996 CDS open 20515-21045 _na     176_aa yutD Transcriptional regulator
1956 CQZX01000015.1 GCA001193755_00997 CDS open 21202-21807 _na     201_aa sodA Superoxide dismutase [Mn]
1957 CQZX01000015.1 GCA001193755_00998 CDS open 21986-22417 _na     143_aa hypothetical protein
1958 CQZX01000015.1 GCA001193755_00999 CDS open 22497-23534 _na     345_aa holA DNA polymerase III subunit delta
1959 CQZX01000015.1 GCA001193755_01000 CDS open 23568-24503 _na     311_aa pyrDA dihydroorotate oxidase
1960 CQZX01000015.1 GCA001193755_01001 CDS open 24951-26141 _na     396_aa metK methionine adenosyltransferase
1961 CQZX01000015.1 GCA001193755_01002 CDS open 26512-27855 _na     447_aa srmB DEAD-box ATP-dependent RNA helicase CshB
1962 CQZX01000015.1 GCA001193755_01003 CDS open 28102-28917 _na     271_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
1963 CQZX01000015.1 GCA001193755_01004 CDS open 28969-31149 _na     726_aa exp5 PTS system glucose-specific EIICBA component
1964 CQZX01000015.1 GCA001193755_01005 CDS open 31558-32484 _na     308_aa ftsX permease-like cell division protein FtsX
1965 CQZX01000015.1 GCA001193755_01006 CDS open 32477-33169 _na     230_aa ftsE cell division ATP-binding protein FtsE
1966 CQZX01000015.1 GCA001193755_01007 CDS open 33187-34164 _na     325_aa prfB peptide chain release factor 2
1967 CQZX01000015.1 GCA001193755_01008 CDS open 34390-35046 _na     218_aa cBS Inosine-5'-monophosphate dehydrogenase
1968 CQZX01000015.1 GCA001193755_01009 CDS open 35438-36148 _na     236_aa livF ABC transporter%2C ATP-binding protein
1969 CQZX01000015.1 GCA001193755_01010 CDS open 36148-36912 _na     254_aa livG ATP-binding cassette domain-containing protein
1970 CQZX01000015.1 GCA001193755_01011 CDS open 36912-37868 _na     318_aa livM ABC transporter membrane-spanning permease-branched chain amino acid transport
1971 CQZX01000015.1 GCA001193755_01012 CDS open 37872-38741 _na     289_aa livH ABC transporter membrane-spanning permease-branched chain amino acid transport
1972 CQZX01000015.1 GCA001193755_01013 CDS open 38858-40018 _na     386_aa livK Branched chain amino acid ABC transporter substrate+B481-binding protein
1973 CQZX01000015.1 GCA001193755_01014 CDS open 40102-40368 _na     88_aa ylbG UPF0298 protein SPT_0762
1974 CQZX01000015.1 GCA001193755_01015 CDS open 40447-41037 _na     196_aa clpP ATP-dependent Clp protease proteolytic subunit ClpP
1975 CQZX01000015.1 GCA001193755_01016 CDS open 41210-41839 _na     209_aa upp uracil phosphoribosyltransferase
1976 CQZX01000015.1 GCA001193755_01017 CDS open 41928-42395 _na     155_aa comEB Cytidine and deoxycytidylate deaminase zinc-binding region family protein
1977 CQZX01000015.1 GCA001193755_01018 CDS open 42414-42971 _na     185_aa acrR HTH tetR-type domain-containing protein
1978 CQZX01000015.1 GCA001193755_01019 CDS open 43096-43941 _na     281_aa degV DegV domain-containing protein spr0652
1979 CQZX01000015.1 GCA001193755_01020 CDS open 44000-45175 _na     391_aa yhiN BaiN-like insert domain-containing protein
1980 CQZX01000015.1 GCA001193755_00969 gene open 110-2107 metG
1981 CQZX01000015.1 GCA001193755_00970 gene open 2231-3490 salY
1982 CQZX01000015.1 GCA001193755_00971 gene open 3492-4193 lolD
1983 CQZX01000015.1 GCA001193755_00972 gene open 4177-5370 acrA
1984 CQZX01000015.1 GCA001193755_00973 gene open 5658-7004 gor
1985 CQZX01000015.1 GCA001193755_00974 gene open 7200-7736
1986 CQZX01000015.1 GCA001193755_00975 gene open 7790-8005
1987 CQZX01000015.1 GCA001193755_00976 gene open 8104-8424
1988 CQZX01000015.1 GCA001193755_00977 gene open 8455-8793
1989 CQZX01000015.1 GCA001193755_00978 gene open 8805-9524 trmD
1990 CQZX01000015.1 GCA001193755_00979 gene open 9514-10032 rimM
1991 CQZX01000015.1 GCA001193755_00980 gene open 10063-10851 menH
1992 CQZX01000015.1 GCA001193755_00982 gene open 11431-11670 khpA
1993 CQZX01000015.1 GCA001193755_00983 gene open 11690-11962 rpsP
1994 CQZX01000015.1 GCA001193755_00984 gene open 12140-12340
1995 CQZX01000015.1 GCA001193755_00985 gene open 13024-13518
1996 CQZX01000015.1 GCA001193755_00986 gene open 13562-13900 cadX
1997 CQZX01000015.1 GCA001193755_00987 gene open 13912-14526 cadD
1998 CQZX01000015.1 GCA001193755_00988 gene open 15142-15720
1999 CQZX01000015.1 GCA001193755_00989 gene open 15723-15947
2000 CQZX01000015.1 GCA001193755_00990 gene open 16276-16437 fbpA