HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Rhodobacter capsulatus (GCA_001402715.1)

Select a Genome:
BAKTA Annotations for GCA_001402715.1
Genome Selected: Rhodobacter capsulatus
ContigsBases CDSrRNA tmRNAtRNA
64 3675736 3456 3 1 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 7062 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:13]    |    Number of Records Found: 7062 [15 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
6001 LLVU01000056.1 GCA001402715_02944 gene open 61558-63012 tauR
6002 LLVU01000056.1 GCA001402715_02945 gene open 63274-63582
6003 LLVU01000056.1 GCA001402715_02946 gene open 63613-64164 yciW1
6004 LLVU01000056.1 GCA001402715_02947 gene open 64284-64388
6005 LLVU01000056.1 GCA001402715_02948 gene open 64460-64939 ydeN
6006 LLVU01000056.1 GCA001402715_02949 gene open 65333-65608
6007 LLVU01000056.1 GCA001402715_02950 gene open 65605-65793
6008 LLVU01000056.1 GCA001402715_02951 gene open 65866-66189
6009 LLVU01000056.1 GCA001402715_02952 gene open 66419-67135 guaA1
6010 LLVU01000056.1 GCA001402715_02953 gene open 67152-67859 cysA
6011 LLVU01000056.1 GCA001402715_02954 gene open 67968-68675 modA
6012 LLVU01000056.1 GCA001402715_02955 gene open 68679-69362 modB
6013 LLVU01000056.1 GCA001402715_02956 gene open 69470-70390 rfaB
6014 LLVU01000056.1 GCA001402715_02957 gene open 70387-71247
6015 LLVU01000056.1 GCA001402715_02958 gene open 71223-72029
6016 LLVU01000056.1 GCA001402715_02959 gene open 72256-73500 ackA
6017 LLVU01000056.1 GCA001402715_02960 gene open 73613-74524
6018 LLVU01000056.1 GCA001402715_02961 gene open 75156-75746
6019 LLVU01000056.1 GCA001402715_02962 gene open 75804-78326 pflD
6020 LLVU01000056.1 GCA001402715_02963 gene open 78439-79578 eutG
6021 LLVU01000056.1 GCA001402715_02964 gene open 79668-79952 pduA
6022 LLVU01000056.1 GCA001402715_02965 gene open 79981-80805 pduB
6023 LLVU01000056.1 GCA001402715_02966 gene open 80824-81363 ccmK
6024 LLVU01000056.1 GCA001402715_02967 gene open 81382-82029 pduL
6025 LLVU01000056.1 GCA001402715_02968 gene open 82039-82875 eutJ
6026 LLVU01000056.1 GCA001402715_02969 gene open 82875-83576
6027 LLVU01000056.1 GCA001402715_02970 gene open 83585-83866 eutN
6028 LLVU01000056.1 GCA001402715_02971 gene open 83870-84343 efgA
6029 LLVU01000056.1 GCA001402715_02972 gene open 84340-85941 adhE
6030 LLVU01000056.1 GCA001402715_02973 gene open 85964-86263
6031 LLVU01000056.1 GCA001402715_02974 gene open 86290-87207 pflA
6032 LLVU01000056.1 GCA001402715_02975 gene open 87477-88817 pocR
6033 LLVU01000056.1 GCA001402715_02976 gene open 88826-89878 yesN
6034 LLVU01000056.1 GCA001402715_02977 gene open 89957-90415 mcrA
6035 LLVU01000056.1 GCA001402715_02978 gene open 90926-91588 ypfH
6036 LLVU01000056.1 GCA001402715_02979 gene open 91585-92217 alkA
6037 LLVU01000056.1 GCA001402715_02980 gene open 92299-93528 araJ
6038 LLVU01000056.1 GCA001402715_02981 gene open 93534-93980 soxR
6039 LLVU01000056.1 GCA001402715_02982 gene open 94071-96320
6040 LLVU01000056.1 GCA001402715_02983 gene open 96406-97155 labA
6041 LLVU01000056.1 GCA001402715_02984 gene open 97162-99657
6042 LLVU01000056.1 GCA001402715_02985 gene open 99783-101471
6043 LLVU01000056.1 GCA001402715_02986 gene open 101529-102554 potD
6044 LLVU01000056.1 GCA001402715_02987 gene open 102586-103392 potC
6045 LLVU01000056.1 GCA001402715_02988 gene open 103385-104293 potB
6046 LLVU01000056.1 GCA001402715_02989 gene open 104295-105356 potA
6047 LLVU01000056.1 GCA001402715_02990 gene open 105670-107061 bioA
6048 LLVU01000056.1 GCA001402715_02991 gene open 107086-107748 gntR
6049 LLVU01000056.1 GCA001402715_02992 gene open 107811-108149 azlD
6050 LLVU01000056.1 GCA001402715_02993 gene open 108146-108838 azlC
6051 LLVU01000056.1 GCA001402715_02994 gene open 109038-109928 yneE
6052 LLVU01000056.1 GCA001402715_02995 gene open 110157-110786
6053 LLVU01000056.1 GCA001402715_02996 gene open 110783-110950
6054 LLVU01000056.1 GCA001402715_02997 gene open 111067-111765 mtbC1
6055 LLVU01000056.1 GCA001402715_02998 gene open 111932-113038 splB
6056 LLVU01000056.1 GCA001402715_02999 gene open 113134-114147 bmt
6057 LLVU01000056.1 GCA001402715_03000 gene open 114217-116247 mprF
6058 LLVU01000056.1 GCA001402715_03001 gene open 116448-116762
6059 LLVU01000056.1 GCA001402715_03002 gene open 117015-117776 purC
6060 LLVU01000056.1 GCA001402715_03003 gene open 117971-118210 purS
6061 LLVU01000056.1 GCA001402715_03004 gene open 118280-118948 purQ
6062 LLVU01000056.1 GCA001402715_03005 gene open 118994-120793
6063 LLVU01000056.1 GCA001402715_03006 gene open 120797-122122 atoC
6064 LLVU01000056.1 GCA001402715_03007 gene open 122696-125530 cafA
6065 LLVU01000056.1 GCA001402715_03008 gene open 125612-125863 tusA
6066 LLVU01000056.1 GCA001402715_03009 gene open 125955-126713 ccdA
6067 LLVU01000056.1 GCA001402715_03010 gene open 126825-129386 mrcA
6068 LLVU01000056.1 GCA001402715_03011 gene open 129709-129861
6069 LLVU01000056.1 GCA001402715_03012 gene open 130029-131030 gap
6070 LLVU01000056.1 GCA001402715_03013 gene open 131159-131302
6071 LLVU01000056.1 GCA001402715_03014 gene open 131405-132463 fliG
6072 LLVU01000056.1 GCA001402715_03015 gene open 132621-133925 purB
6073 LLVU01000056.1 GCA001402715_03016 gene open 134007-134411
6074 LLVU01000056.1 GCA001402715_03017 gene open 134637-137243 mprF
6075 LLVU01000056.1 GCA001402715_03018 gene open 137244-137558 tM2
6076 LLVU01000056.1 GCA001402715_03019 gene open 137623-138195 ykwD
6077 LLVU01000056.1 GCA001402715_03020 gene open 138369-138728 tM2
6078 LLVU01000056.1 GCA001402715_03021 gene open 138843-139862 tar
6079 LLVU01000056.1 GCA001402715_03022 gene open 140033-142741 acnA
6080 LLVU01000056.1 GCA001402715_03023 gene open 142969-143988
6081 LLVU01000056.1 GCA001402715_03024 gene open 144004-144888 lpxP
6082 LLVU01000056.1 GCA001402715_03025 gene open 144894-145874 rhaT
6083 LLVU01000056.1 GCA001402715_03026 gene open 145871-147889 tkt
6084 LLVU01000056.1 GCA001402715_03027 gene open 148152-148763
6085 LLVU01000056.1 GCA001402715_03028 gene open 148756-149139 zapA
6086 LLVU01000056.1 GCA001402715_03029 gene open 149250-149420
6087 LLVU01000056.1 GCA001402715_03030 gene open 149606-150058 iscR
6088 LLVU01000056.1 GCA001402715_03031 gene open 150269-150856
6089 LLVU01000056.1 GCA001402715_03032 gene open 150931-152139 livK
6090 LLVU01000056.1 GCA001402715_03033 gene open 152158-154047
6091 LLVU01000056.1 GCA001402715_03034 gene open 154085-154888
6092 LLVU01000056.1 GCA001402715_03035 gene open 154937-155836 yjjP
6093 LLVU01000056.1 GCA001402715_03036 gene open 155839-156306 thrE
6094 LLVU01000056.1 GCA001402715_03037 gene open 156319-157083
6095 LLVU01000056.1 GCA001402715_03038 gene open 157448-158350 folD
6096 LLVU01000056.1 GCA001402715_03039 gene open 158444-159322 sbcC
6097 LLVU01000060.1 GCA001402715_03040 CDS open 17-226 _na     69_aa Auto-transporter adhesin head GIN domain-containing protein
6098 LLVU01000060.1 GCA001402715_03040 gene open 17-226
6099 LLVU01000062.1 GCA001402715_03133 gene open 90854-91141 5_ureB_sRNA
6100 LLVU01000062.1 GCA001402715_03133 ncRNA open 90854-91141 5' ureB small RNA
6101 LLVU01000062.1 regulatory_region open 9751-9841 Glycine riboswitch aptamer
6102 LLVU01000062.1 regulatory_region open 155864-156050 Cobalamin riboswitch aptamer
6103 LLVU01000062.1 regulatory_region open 156238-156442 Cobalamin riboswitch aptamer
6104 LLVU01000062.1 regulatory_region open 163803-164017 Cobalamin riboswitch aptamer
6105 LLVU01000062.1 repeat_region open 138509-142390 CRISPR array with 48 repeats of length 29%2C consensus sequence CTGTTCCCCGCCCACGCGGGGATGAACCG and spacer length 52
6106 LLVU01000062.1 repeat_region open 141376-142390 CRISPR array with 17 repeats of length 29%2C consensus sequence CTGTTCCCCGCCCACGCGGGGATGAACCG and spacer length 32
6107 LLVU01000062.1 GCA001402715_03041 CDS open 42-659 _na     205_aa luxR Transcriptional regulator%2C LuxR family
6108 LLVU01000062.1 GCA001402715_03042 CDS open 666-1175 _na     169_aa gbsR HTH-type transcriptional regulator
6109 LLVU01000062.1 GCA001402715_03043 CDS open 1185-2183 _na     332_aa galM Aldose 1-epimerase
6110 LLVU01000062.1 GCA001402715_03044 CDS open 2238-3197 _na     319_aa znuA High-affinity zinc uptake system protein ZnuA
6111 LLVU01000062.1 GCA001402715_03045 CDS open 3282-3785 _na     167_aa fur Transcriptional regulator%2C Fur family
6112 LLVU01000062.1 GCA001402715_03046 CDS open 3782-4579 _na     265_aa znuC Zinc ABC transporter%2C ATP-binding protein ZnuC
6113 LLVU01000062.1 GCA001402715_03047 CDS open 4572-5357 _na     261_aa znuB High-affinity zinc uptake system membrane protein ZnuB
6114 LLVU01000062.1 GCA001402715_03048 CDS open 5403-6350 _na     315_aa fruK Phosphofructokinase
6115 LLVU01000062.1 GCA001402715_03049 CDS open 6492-6701 _na     69_aa hypothetical protein
6116 LLVU01000062.1 GCA001402715_03050 CDS open 6715-7704 _na     329_aa DUF2793 domain-containing protein
6117 LLVU01000062.1 GCA001402715_03051 CDS open 7747-8151 _na     134_aa Metallopeptidase family protein
6118 LLVU01000062.1 GCA001402715_03052 CDS open 8251-9579 _na     442_aa gltX glutamate--tRNA ligase
6119 LLVU01000062.1 GCA001402715_03053 CDS open 9990-11099 _na     369_aa gcvT glycine cleavage system aminomethyltransferase GcvT
6120 LLVU01000062.1 GCA001402715_03054 CDS open 11109-11471 _na     120_aa gcvH glycine cleavage system protein GcvH
6121 LLVU01000062.1 GCA001402715_03055 CDS open 11485-14319 _na     944_aa gcvP aminomethyl-transferring glycine dehydrogenase
6122 LLVU01000062.1 GCA001402715_03056 CDS open 14554-15672 _na     372_aa fabH beta-ketoacyl-ACP synthase III
6123 LLVU01000062.1 GCA001402715_03057 CDS open 15730-16671 _na     313_aa Gluconate 2-dehydrogenase
6124 LLVU01000062.1 GCA001402715_03058 CDS open 16671-17009 _na     112_aa tRNA-binding protein
6125 LLVU01000062.1 GCA001402715_03059 CDS open 17006-17818 _na     270_aa proC pyrroline-5-carboxylate reductase
6126 LLVU01000062.1 GCA001402715_03060 CDS open 17843-18346 _na     167_aa ybjN Diacylglyceryl transferase
6127 LLVU01000062.1 GCA001402715_03061 CDS open 18606-19706 _na     366_aa aroC chorismate synthase
6128 LLVU01000062.1 GCA001402715_03062 CDS open 19710-20012 _na     100_aa DUF1330 domain-containing protein
6129 LLVU01000062.1 GCA001402715_03063 CDS open 20082-20393 _na     103_aa hisE phosphoribosyl-ATP diphosphatase
6130 LLVU01000062.1 GCA001402715_03064 CDS open 20390-21151 _na     253_aa hisF Imidazole glycerol phosphate synthase subunit HisF
6131 LLVU01000062.1 GCA001402715_03065 CDS open 21322-22041 _na     239_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
6132 LLVU01000062.1 GCA001402715_03066 CDS open 22177-22560 _na     127_aa DUF2147 domain-containing protein
6133 LLVU01000062.1 GCA001402715_03067 CDS open 22635-23474 _na     279_aa uspA UspA domain-containing protein
6134 LLVU01000062.1 GCA001402715_03068 CDS open 23723-25321 _na     532_aa ccoN cytochrome-c oxidase%2C cbb3-type subunit I
6135 LLVU01000062.1 GCA001402715_03069 CDS open 25334-26062 _na     242_aa ccoO cytochrome-c oxidase%2C cbb3-type subunit II
6136 LLVU01000062.1 GCA001402715_03070 CDS open 26074-26250 _na     58_aa ccoQ Cytochrome c oxidase%2C Cbb3-type%2C subunit IV
6137 LLVU01000062.1 GCA001402715_03071 CDS open 26296-27189 _na     297_aa ccoP cytochrome-c oxidase%2C cbb3-type subunit III
6138 LLVU01000062.1 GCA001402715_03072 CDS open 27454-28914 _na     486_aa ccoG cytochrome c oxidase accessory protein CcoG
6139 LLVU01000062.1 GCA001402715_03073 CDS open 28916-29371 _na     151_aa ccoH Cytochrome c oxidase%2C Cbb3-type%2C biogenesis protein CcoH
6140 LLVU01000062.1 GCA001402715_03074 CDS open 29377-31605 _na     742_aa ccoI Cytochrome c oxidase%2C Cbb3-type%2C biogenesis protein CcoI
6141 LLVU01000062.1 GCA001402715_03075 CDS open 31623-31781 _na     52_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
6142 LLVU01000062.1 GCA001402715_03076 CDS open 31891-33507 _na     538_aa D-alanyl-D-alanine carboxypeptidase-1
6143 LLVU01000062.1 GCA001402715_03077 CDS open 33708-34418 _na     236_aa yigB Hydrolase%2C HAD superfamily
6144 LLVU01000062.1 GCA001402715_03078 CDS open 34590-34943 _na     117_aa clpS ATP-dependent Clp protease adapter ClpS
6145 LLVU01000062.1 GCA001402715_03079 CDS open 34965-36029 _na     354_aa rsmC Methyltransferase small domain protein
6146 LLVU01000062.1 GCA001402715_03080 CDS open 36045-36455 _na     136_aa rbcS Lipoprotein
6147 LLVU01000062.1 GCA001402715_03081 CDS open 36668-38653 _na     661_aa srmB ATP-dependent RNA helicase DbpA
6148 LLVU01000062.1 GCA001402715_03082 CDS open 38725-39759 _na     344_aa hemE uroporphyrinogen decarboxylase
6149 LLVU01000062.1 GCA001402715_03083 CDS open 39878-40822 _na     314_aa hemC hydroxymethylbilane synthase
6150 LLVU01000062.1 GCA001402715_03084 CDS open 40926-42302 _na     458_aa glcD D-2-hydroxyglutarate dehydrogenase
6151 LLVU01000062.1 GCA001402715_03085 CDS open 42341-43543 _na     400_aa MFS transporter
6152 LLVU01000062.1 GCA001402715_03086 CDS open 43584-43964 _na     126_aa GDSL-type esterase/lipase family protein
6153 LLVU01000062.1 GCA001402715_03087 CDS open 43942-44247 _na     101_aa hypothetical protein
6154 LLVU01000062.1 GCA001402715_03088 CDS open 44285-44953 _na     222_aa ybbA ABC transporter ATP-binding protein
6155 LLVU01000062.1 GCA001402715_03089 CDS open 44950-47457 _na     835_aa ybbP FtsX-like permease family protein
6156 LLVU01000062.1 GCA001402715_03090 CDS open 47519-47986 _na     155_aa mltE Transglycosylase%2C Slt family
6157 LLVU01000062.1 GCA001402715_03091 CDS open 48097-50514 _na     805_aa copZ Copper-transporting P-type ATPase-2
6158 LLVU01000062.1 GCA001402715_03092 CDS open 50641-50850 _na     69_aa Inner membrane protein YgaP-like transmembrane domain-containing protein
6159 LLVU01000062.1 GCA001402715_03093 CDS open 50986-51627 _na     213_aa hisH imidazole glycerol phosphate synthase subunit HisH
6160 LLVU01000062.1 GCA001402715_03094 CDS open 51627-52214 _na     195_aa hisB imidazoleglycerol-phosphate dehydratase HisB
6161 LLVU01000062.1 GCA001402715_03097 CDS open 52686-52883 _na     65_aa yjbJ CsbD family protein
6162 LLVU01000062.1 GCA001402715_03098 CDS open 53136-55340 _na     734_aa tar Methyl-accepting chemotaxis sensory transducer
6163 LLVU01000062.1 GCA001402715_03099 CDS open 55522-57687 _na     721_aa Phytase-like domain-containing protein
6164 LLVU01000062.1 GCA001402715_03100 CDS open 57871-58692 _na     273_aa phnC phosphonate ABC transporter ATP-binding protein
6165 LLVU01000062.1 GCA001402715_03101 CDS open 58735-59658 _na     307_aa phnD phosphonate ABC transporter substrate-binding protein
6166 LLVU01000062.1 GCA001402715_03102 CDS open 59733-60614 _na     293_aa phnE phosphonate ABC transporter%2C permease protein PhnE
6167 LLVU01000062.1 GCA001402715_03103 CDS open 60611-61945 _na     444_aa phnE phosphonate ABC transporter%2C permease protein PhnE
6168 LLVU01000062.1 GCA001402715_03104 CDS open 61949-62575 _na     208_aa wbbJ Transferase hexapeptide repeat family protein
6169 LLVU01000062.1 GCA001402715_03105 CDS open 62554-63288 _na     244_aa phnF phosphonate metabolism transcriptional regulator PhnF
6170 LLVU01000062.1 GCA001402715_03106 CDS open 63366-63836 _na     156_aa phnG phosphonate C-P lyase system protein PhnG
6171 LLVU01000062.1 GCA001402715_03107 CDS open 63837-64403 _na     188_aa phnH phosphonate C-P lyase system protein PhnH
6172 LLVU01000062.1 GCA001402715_03108 CDS open 64403-65476 _na     357_aa phnI Phosphonate metabolism protein PhnI
6173 LLVU01000062.1 GCA001402715_03109 CDS open 65479-65604 _na     41_aa hypothetical protein
6174 LLVU01000062.1 GCA001402715_03110 CDS open 65633-66496 _na     287_aa phnJ Alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase
6175 LLVU01000062.1 GCA001402715_03111 CDS open 66496-67302 _na     268_aa phnK phosphonate C-P lyase system protein PhnK
6176 LLVU01000062.1 GCA001402715_03112 CDS open 67307-67990 _na     227_aa phnL phosphonate C-P lyase system protein PhnL
6177 LLVU01000062.1 GCA001402715_03113 CDS open 68506-69177 _na     223_aa Putative phosphonate metabolism protein
6178 LLVU01000062.1 GCA001402715_03114 CDS open 69267-70412 _na     381_aa phnM alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase
6179 LLVU01000062.1 GCA001402715_03115 CDS open 70464-73898 _na     1144_aa pyruvate carboxylase
6180 LLVU01000062.1 GCA001402715_03116 CDS open 74075-75829 _na     584_aa Sporulation related domain-containing protein
6181 LLVU01000062.1 GCA001402715_03117 CDS open 75995-76933 _na     312_aa glycine--tRNA ligase subunit alpha
6182 LLVU01000062.1 GCA001402715_03118 CDS open 76930-77331 _na     133_aa Histidine kinase
6183 LLVU01000062.1 GCA001402715_03119 CDS open 77333-79597 _na     754_aa glyS Glycine--tRNA ligase beta subunit
6184 LLVU01000062.1 GCA001402715_03120 CDS open 79735-82272 _na     845_aa ppsA Pyruvate%2C phosphate dikinase
6185 LLVU01000062.1 GCA001402715_03121 CDS open 82547-83218 _na     223_aa sleB Cell wall hydrolase%2C SleB
6186 LLVU01000062.1 GCA001402715_03122 CDS open 83303-84214 _na     303_aa folB dihydroneopterin aldolase
6187 LLVU01000062.1 GCA001402715_03123 CDS open 84263-85279 _na     338_aa folP dihydropteroate synthase
6188 LLVU01000062.1 GCA001402715_03124 CDS open 85276-86622 _na     448_aa glmM phosphoglucosamine mutase
6189 LLVU01000062.1 GCA001402715_03125 CDS open 86626-86994 _na     122_aa DUF805 domain-containing protein
6190 LLVU01000062.1 GCA001402715_03126 CDS open 87072-88094 _na     340_aa ilvC ketol-acid reductoisomerase
6191 LLVU01000062.1 GCA001402715_03127 CDS open 88207-88677 _na     156_aa lrp Transcriptional regulator%2C AsnC/Lrp family
6192 LLVU01000062.1 GCA001402715_03128 CDS open 88674-89132 _na     152_aa lrp Transcriptional regulator%2C AsnC/Lrp family
6193 LLVU01000062.1 GCA001402715_03129 CDS open 89172-90074 _na     300_aa ureD Urease accessory protein UreD
6194 LLVU01000062.1 GCA001402715_03130 CDS open 90084-90386 _na     100_aa ureA urease subunit gamma
6195 LLVU01000062.1 GCA001402715_03131 CDS open 90396-90701 _na     101_aa ureB urease subunit beta
6196 LLVU01000062.1 GCA001402715_03132 CDS open 90701-92407 _na     568_aa ureC urease subunit alpha
6197 LLVU01000062.1 GCA001402715_03134 CDS open 92412-92756 _na     114_aa hypothetical protein
6198 LLVU01000062.1 GCA001402715_03135 CDS open 92837-93307 _na     156_aa ureE Urease accessory protein UreE
6199 LLVU01000062.1 GCA001402715_03136 CDS open 93252-93935 _na     227_aa ureF Urease accessory protein UreF
6200 LLVU01000062.1 GCA001402715_03137 CDS open 93932-94558 _na     208_aa ureG urease accessory protein UreG
6201 LLVU01000062.1 GCA001402715_03138 CDS open 94782-96083 _na     433_aa urtA urea ABC transporter substrate-binding protein
6202 LLVU01000062.1 GCA001402715_03139 CDS open 96144-98120 _na     658_aa urtB urea ABC transporter permease subunit UrtB
6203 LLVU01000062.1 GCA001402715_03140 CDS open 98217-99455 _na     412_aa urtC urea ABC transporter permease subunit UrtC
6204 LLVU01000062.1 GCA001402715_03141 CDS open 99452-100192 _na     246_aa urtD urea ABC transporter ATP-binding protein UrtD
6205 LLVU01000062.1 GCA001402715_03142 CDS open 100194-100889 _na     231_aa urtE urea ABC transporter ATP-binding subunit UrtE
6206 LLVU01000062.1 GCA001402715_03143 CDS open 101065-102282 _na     405_aa ubiH UbiH/UbiF family hydroxylase
6207 LLVU01000062.1 GCA001402715_03144 CDS open 102369-102551 _na     60_aa Membrane protein%2C putative
6208 LLVU01000062.1 GCA001402715_03145 CDS open 102693-102911 _na     72_aa Aa3-type cytochrome c oxidase subunit IV
6209 LLVU01000062.1 GCA001402715_03146 CDS open 103057-103716 _na     219_aa yigB pyrimidine 5'-nucleotidase
6210 LLVU01000062.1 GCA001402715_03147 CDS open 103875-104510 _na     211_aa gntR Transcriptional regulator%2C GntR family
6211 LLVU01000062.1 GCA001402715_03148 CDS open 104517-106586 _na     689_aa bcsA Glycosyl transferase%2C family 2
6212 LLVU01000062.1 GCA001402715_03149 CDS open 106738-107904 _na     388_aa carbamoyl phosphate synthase small subunit
6213 LLVU01000062.1 GCA001402715_03150 CDS open 108097-108480 _na     127_aa gloA Glyoxalase/bleomycin resistance protein/dioxygenase
6214 LLVU01000062.1 GCA001402715_03151 CDS open 108588-109001 _na     137_aa cycA Cytochrome c2
6215 LLVU01000062.1 GCA001402715_03152 CDS open 109206-109868 _na     220_aa lipB lipoyl(octanoyl) transferase LipB
6216 LLVU01000062.1 GCA001402715_03154 CDS open 110360-112663 _na     767_aa Hedgehog/Intein (Hint) domain-containing protein
6217 LLVU01000062.1 GCA001402715_03155 CDS open 112736-113839 _na     367_aa potA Spermidine/putrescine import ATP-binding protein PotA
6218 LLVU01000062.1 GCA001402715_03156 CDS open 113952-115025 _na     357_aa potD Polyamine ABC transporter%2C periplasmic polyamine-binding protein PotD-1
6219 LLVU01000062.1 GCA001402715_03157 CDS open 115127-116392 _na     421_aa potB Polyamine ABC transporter%2C permease protein PotB-1
6220 LLVU01000062.1 GCA001402715_03158 CDS open 116405-117358 _na     317_aa potC Polyamine ABC transporter%2C permease protein PotI-1
6221 LLVU01000062.1 GCA001402715_03159 CDS open 117555-118505 _na     316_aa yfdV AEC family transporter
6222 LLVU01000062.1 GCA001402715_03160 CDS open 118505-119305 _na     266_aa phnP MBL fold metallo-hydrolase
6223 LLVU01000062.1 GCA001402715_03161 CDS open 119298-120095 _na     265_aa tatD TatD-related deoxyribonuclease family protein
6224 LLVU01000062.1 GCA001402715_03162 CDS open 120112-121221 _na     369_aa dnaX DNA polymerase III subunit delta'
6225 LLVU01000062.1 GCA001402715_03163 CDS open 121218-121838 _na     206_aa tmk dTMP kinase
6226 LLVU01000062.1 GCA001402715_03164 CDS open 121843-123003 _na     386_aa dacC serine-type D-Ala-D-Ala carboxypeptidase
6227 LLVU01000062.1 GCA001402715_03165 CDS open 123016-123882 _na     288_aa SPOR domain-containing protein
6228 LLVU01000062.1 GCA001402715_03167 CDS open 124873-125316 _na     147_aa hypothetical protein
6229 LLVU01000062.1 GCA001402715_03168 CDS open 125605-125883 _na     92_aa hypothetical protein
6230 LLVU01000062.1 GCA001402715_03169 CDS open 126076-126414 _na     112_aa hypothetical protein
6231 LLVU01000062.1 GCA001402715_03170 CDS open 126411-126998 _na     195_aa iclR IclR helix-turn-helix domain-containing protein
6232 LLVU01000062.1 GCA001402715_03171 CDS open 126995-127402 _na     135_aa Transcriptional regulator
6233 LLVU01000062.1 GCA001402715_03172 CDS open 128058-129041 _na     327_aa putative DNA-binding transcriptional regulator YafY%2C contains an HTH and WYL domains
6234 LLVU01000062.1 GCA001402715_03173 CDS open 129157-129780 _na     207_aa yobV WYL domain-containing protein
6235 LLVU01000062.1 GCA001402715_03174 CDS open 129835-132339 _na     834_aa CRISPR-associated endonuclease/helicase Cas3
6236 LLVU01000062.1 GCA001402715_03175 CDS open 132770-134239 _na     489_aa casA type I-E CRISPR-associated protein Cse1/CasA
6237 LLVU01000062.1 GCA001402715_03176 CDS open 134236-134730 _na     164_aa casB type I-E CRISPR-associated protein Cse2/CasB
6238 LLVU01000062.1 GCA001402715_03177 CDS open 134727-135812 _na     361_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
6239 LLVU01000062.1 GCA001402715_03178 CDS open 135812-136495 _na     227_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
6240 LLVU01000062.1 GCA001402715_03179 CDS open 136492-137163 _na     223_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
6241 LLVU01000062.1 GCA001402715_03180 CDS open 137160-138143 _na     327_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
6242 LLVU01000062.1 GCA001402715_03181 CDS open 138140-138421 _na     93_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
6243 LLVU01000062.1 GCA001402715_03182 CDS open 143285-143740 _na     151_aa gpG phage virion morphogenesis protein
6244 LLVU01000062.1 GCA001402715_03183 CDS open 143737-144069 _na     110_aa hypothetical protein
6245 LLVU01000062.1 GCA001402715_03184 CDS open 144077-145633 _na     518_aa N-acetylmuramoyl-L-alanine amidase
6246 LLVU01000062.1 GCA001402715_03185 CDS open 145722-145970 _na     82_aa Homeodomain-like domain-containing protein
6247 LLVU01000062.1 GCA001402715_03186 CDS open 146057-146590 _na     177_aa Bacteriophage Mu transposase
6248 LLVU01000062.1 GCA001402715_03187 CDS open 146939-147370 _na     143_aa 2Fe-2S iron-sulfur cluster binding domain-containing protein
6249 LLVU01000062.1 GCA001402715_03188 CDS open 147385-148296 _na     303_aa prpB methylisocitrate lyase
6250 LLVU01000062.1 GCA001402715_03189 CDS open 148300-149475 _na     391_aa prpC 2-methylcitrate synthase
6251 LLVU01000062.1 GCA001402715_03190 CDS open 149486-150997 _na     503_aa prpD 2-methylcitrate dehydratase
6252 LLVU01000062.1 GCA001402715_03191 CDS open 151026-151409 _na     127_aa Acyl-CoA hydrolase
6253 LLVU01000062.1 GCA001402715_03192 CDS open 151526-152908 _na     460_aa HTH cro/C1-type domain-containing protein
6254 LLVU01000062.1 GCA001402715_03193 CDS open 152921-153538 _na     205_aa pflA anaerobic ribonucleoside-triphosphate reductase activating protein
6255 LLVU01000062.1 GCA001402715_03194 CDS open 153531-153719 _na     62_aa anaerobic ribonucleoside-triphosphate reductase
6256 LLVU01000062.1 GCA001402715_03195 CDS open 153737-155767 _na     676_aa nrdD ribonucleoside triphosphate reductase
6257 LLVU01000062.1 GCA001402715_03196 CDS open 156530-157672 _na     380_aa BLUF domain-containing protein
6258 LLVU01000062.1 GCA001402715_03197 CDS open 157750-159360 _na     536_aa aceA isocitrate lyase
6259 LLVU01000062.1 GCA001402715_03198 CDS open 159484-161106 _na     540_aa aceB malate synthase A
6260 LLVU01000062.1 GCA001402715_03199 CDS open 161261-162697 _na     478_aa HTH cro/C1-type domain-containing protein
6261 LLVU01000062.1 GCA001402715_03200 CDS open 162814-163587 _na     257_aa Iron complex transport system ATP-binding protein
6262 LLVU01000062.1 GCA001402715_03201 CDS open 163584-163772 _na     62_aa hypothetical protein
6263 LLVU01000062.1 GCA001402715_03202 CDS open 164120-164548 _na     142_aa lrp Transcriptional regulator%2C AsnC/Lrp family
6264 LLVU01000062.1 GCA001402715_03203 CDS open 164666-165595 _na     309_aa rocF arginase
6265 LLVU01000062.1 GCA001402715_03204 CDS open 165592-166644 _na     350_aa oCDMu Ornithine cyclodeaminase-1
6266 LLVU01000062.1 GCA001402715_03205 CDS open 166800-168428 _na     542_aa Methyl-accepting chemotaxis protein
6267 LLVU01000062.1 GCA001402715_03206 CDS open 168651-168914 _na     87_aa STAS domain-containing protein
6268 LLVU01000062.1 GCA001402715_03207 CDS open 168917-169282 _na     121_aa ompR Chemotaxis protein CheY-1
6269 LLVU01000062.1 GCA001402715_03208 CDS open 169302-171263 _na     653_aa cheA Chemotaxis protein CheA
6270 LLVU01000062.1 GCA001402715_03209 CDS open 171275-171757 _na     160_aa cheW Chemotaxis protein CheW-1
6271 LLVU01000062.1 GCA001402715_03210 CDS open 171779-173971 _na     730_aa Methyl-accepting chemotaxis protein
6272 LLVU01000062.1 GCA001402715_03211 CDS open 174079-174615 _na     178_aa cheW CheW-like domain protein
6273 LLVU01000062.1 GCA001402715_03212 CDS open 174621-175523 _na     300_aa cheR protein-glutamate O-methyltransferase
6274 LLVU01000062.1 GCA001402715_03213 CDS open 175520-176626 _na     368_aa cheB Protein-glutamate methylesterase/protein-glutamine glutaminase
6275 LLVU01000062.1 GCA001402715_03214 CDS open 176771-177376 _na     201_aa fecR FecR protein domain-containing protein
6276 LLVU01000062.1 GCA001402715_03215 CDS open 177366-177917 _na     183_aa adenylate/guanylate cyclase domain-containing protein
6277 LLVU01000062.1 GCA001402715_03216 CDS open 177927-179117 _na     396_aa CHASE2 domain-containing protein
6278 LLVU01000062.1 GCA001402715_03217 CDS open 179117-179818 _na     233_aa crp Transcriptional regulator%2C Crp/Fnr family
6279 LLVU01000062.1 GCA001402715_03218 CDS open 179948-181825 _na     625_aa Calcium-binding protein
6280 LLVU01000062.1 GCA001402715_03219 CDS open 181883-183442 _na     519_aa leuA 2-isopropylmalate synthase
6281 LLVU01000062.1 GCA001402715_03220 CDS open 183733-185223 _na     496_aa histidine kinase
6282 LLVU01000062.1 GCA001402715_03221 CDS open 185362-186816 _na     484_aa MORN repeat family protein
6283 LLVU01000062.1 GCA001402715_03222 CDS open 186965-188623 _na     552_aa nadE NAD+ synthase
6284 LLVU01000062.1 GCA001402715_03223 CDS open 188867-189331 _na     154_aa rAYT REP-associated tyrosine transposase
6285 LLVU01000062.1 GCA001402715_03224 CDS open 189386-189703 _na     105_aa Antibiotic biosynthesis monooxygenase
6286 LLVU01000062.1 GCA001402715_03225 CDS open 189996-191093 _na     365_aa afuA ABC transporter%2C periplasmic substrate-binding protein
6287 LLVU01000062.1 GCA001402715_03226 CDS open 191164-192057 _na     297_aa Putative spermidine/putrescine transport system permease protein
6288 LLVU01000062.1 GCA001402715_03227 CDS open 192054-192836 _na     260_aa potC ABC transporter%2C permease protein
6289 LLVU01000062.1 GCA001402715_03228 CDS open 192833-193879 _na     348_aa potA ABC transporter%2C ATP-binding protein
6290 LLVU01000062.1 GCA001402715_03229 CDS open 194021-194893 _na     290_aa rpiR Transcriptional regulator%2C RpiR family
6291 LLVU01000062.1 GCA001402715_03230 CDS open 195166-195672 _na     168_aa fcbT2 TRAP transporter small permease protein
6292 LLVU01000062.1 GCA001402715_03231 CDS open 195672-196997 _na     441_aa fcbT3 TRAP C4-dicarboxylate transport system permease%2C DctM-1 subunit
6293 LLVU01000062.1 GCA001402715_03232 CDS open 197045-198079 _na     344_aa fcbT1 TRAP dicarboxylate transporter%2C DctP-1 subunit
6294 LLVU01000062.1 GCA001402715_03233 CDS open 198133-199497 _na     454_aa glnA Glutamine synthetase-2
6295 LLVU01000062.1 GCA001402715_03234 CDS open 199538-200926 _na     462_aa adhE Aldehyde dehydrogenase family protein
6296 LLVU01000062.1 GCA001402715_03235 CDS open 200923-202077 _na     384_aa eutG Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
6297 LLVU01000062.1 GCA001402715_03236 CDS open 202246-204441 _na     731_aa yjbH YjbH domain-containing protein
6298 LLVU01000062.1 GCA001402715_03237 CDS open 204438-205127 _na     229_aa Lipoprotein%2C putative
6299 LLVU01000062.1 GCA001402715_03238 CDS open 205304-205489 _na     61_aa Ferrochelatase
6300 LLVU01000062.1 GCA001402715_03239 CDS open 205804-207108 _na     434_aa ugd UDP-glucose 6-dehydrogenase
6301 LLVU01000062.1 GCA001402715_03240 CDS open 207118-209301 _na     727_aa uvrB excinuclease ABC subunit UvrB
6302 LLVU01000062.1 GCA001402715_03241 CDS open 209669-209980 _na     103_aa NADH ubiquinone oxidoreductase subunit%2C NDUFA4 family
6303 LLVU01000062.1 GCA001402715_03242 CDS open 210244-211404 _na     386_aa 2-aminoethylphosphonate--pyruvate transaminase
6304 LLVU01000062.1 GCA001402715_03243 CDS open 211401-212192 _na     263_aa phnX phosphonoacetaldehyde hydrolase
6305 LLVU01000062.1 GCA001402715_03244 CDS open 212408-212851 _na     147_aa hypothetical protein
6306 LLVU01000062.1 GCA001402715_03245 CDS open 212989-213303 _na     104_aa hypothetical protein
6307 LLVU01000062.1 GCA001402715_03246 CDS open 213419-214339 _na     306_aa yciV Polymerase/histidinol phosphatase N-terminal domain-containing protein
6308 LLVU01000062.1 GCA001402715_03247 CDS open 214415-216193 _na     592_aa eAL Diguanylate cyclase/phosphodiesterase family protein
6309 LLVU01000062.1 GCA001402715_03248 CDS open 216215-217315 _na     366_aa ugpC sn-glycerol-3-phosphate transport ATP-binding protein UgpC
6310 LLVU01000062.1 GCA001402715_03249 CDS open 217312-218154 _na     280_aa ugpE sn-glycerol-3-phosphate transport system permease protein UgpE
6311 LLVU01000062.1 GCA001402715_03250 CDS open 218158-219072 _na     304_aa ugpA sn-glycerol-3-phosphate transport system permease protein UgpA
6312 LLVU01000062.1 GCA001402715_03251 CDS open 219137-220432 _na     431_aa ugpB sn-glycerol-3-phosphate-binding periplasmic protein UgpB
6313 LLVU01000062.1 GCA001402715_03252 CDS open 220623-221192 _na     189_aa Photosynthetic apparatus regulatory protein RegA-2
6314 LLVU01000062.1 GCA001402715_03253 CDS open 221185-222453 _na     422_aa histidine kinase
6315 LLVU01000062.1 GCA001402715_03254 CDS open 222651-226175 _na     1174_aa Conserved domain protein
6316 LLVU01000062.1 GCA001402715_03255 CDS open 226147-227070 _na     307_aa hypothetical protein
6317 LLVU01000062.1 GCA001402715_03256 CDS open 227037-228044 _na     335_aa DUF2332 domain-containing protein
6318 LLVU01000062.1 GCA001402715_03257 CDS open 228058-230394 _na     778_aa Conserved domain protein
6319 LLVU01000062.1 GCA001402715_03258 CDS open 230916-231431 _na     171_aa hypothetical protein
6320 LLVU01000062.1 GCA001402715_03259 CDS open 231433-231786 _na     117_aa Secreted protein with PEP-CTERM sorting signal
6321 LLVU01000062.1 GCA001402715_03260 CDS open 231783-232037 _na     84_aa ytxH YtxH domain-containing protein
6322 LLVU01000062.1 GCA001402715_03261 CDS open 232059-234695 _na     878_aa ATPase%2C P-type (Transporting)%2C HAD superfamily%2C subfamily IC/heavy metal translocating P-type ATPase
6323 LLVU01000062.1 GCA001402715_03262 CDS open 234713-235321 _na     202_aa hypothetical protein
6324 LLVU01000062.1 GCA001402715_03041 gene open 42-659 luxR
6325 LLVU01000062.1 GCA001402715_03042 gene open 666-1175 gbsR
6326 LLVU01000062.1 GCA001402715_03043 gene open 1185-2183 galM
6327 LLVU01000062.1 GCA001402715_03044 gene open 2238-3197 znuA
6328 LLVU01000062.1 GCA001402715_03045 gene open 3282-3785 fur
6329 LLVU01000062.1 GCA001402715_03046 gene open 3782-4579 znuC
6330 LLVU01000062.1 GCA001402715_03047 gene open 4572-5357 znuB
6331 LLVU01000062.1 GCA001402715_03048 gene open 5403-6350 fruK
6332 LLVU01000062.1 GCA001402715_03049 gene open 6492-6701
6333 LLVU01000062.1 GCA001402715_03050 gene open 6715-7704
6334 LLVU01000062.1 GCA001402715_03051 gene open 7747-8151
6335 LLVU01000062.1 GCA001402715_03052 gene open 8251-9579 gltX
6336 LLVU01000062.1 GCA001402715_03053 gene open 9990-11099 gcvT
6337 LLVU01000062.1 GCA001402715_03054 gene open 11109-11471 gcvH
6338 LLVU01000062.1 GCA001402715_03055 gene open 11485-14319 gcvP
6339 LLVU01000062.1 GCA001402715_03056 gene open 14554-15672 fabH
6340 LLVU01000062.1 GCA001402715_03057 gene open 15730-16671
6341 LLVU01000062.1 GCA001402715_03058 gene open 16671-17009
6342 LLVU01000062.1 GCA001402715_03059 gene open 17006-17818 proC
6343 LLVU01000062.1 GCA001402715_03060 gene open 17843-18346 ybjN
6344 LLVU01000062.1 GCA001402715_03061 gene open 18606-19706 aroC
6345 LLVU01000062.1 GCA001402715_03062 gene open 19710-20012
6346 LLVU01000062.1 GCA001402715_03063 gene open 20082-20393 hisE
6347 LLVU01000062.1 GCA001402715_03064 gene open 20390-21151 hisF
6348 LLVU01000062.1 GCA001402715_03065 gene open 21322-22041 hisA
6349 LLVU01000062.1 GCA001402715_03066 gene open 22177-22560
6350 LLVU01000062.1 GCA001402715_03067 gene open 22635-23474 uspA
6351 LLVU01000062.1 GCA001402715_03068 gene open 23723-25321 ccoN
6352 LLVU01000062.1 GCA001402715_03069 gene open 25334-26062 ccoO
6353 LLVU01000062.1 GCA001402715_03070 gene open 26074-26250 ccoQ
6354 LLVU01000062.1 GCA001402715_03071 gene open 26296-27189 ccoP
6355 LLVU01000062.1 GCA001402715_03072 gene open 27454-28914 ccoG
6356 LLVU01000062.1 GCA001402715_03073 gene open 28916-29371 ccoH
6357 LLVU01000062.1 GCA001402715_03074 gene open 29377-31605 ccoI
6358 LLVU01000062.1 GCA001402715_03075 gene open 31623-31781 ccoS
6359 LLVU01000062.1 GCA001402715_03076 gene open 31891-33507
6360 LLVU01000062.1 GCA001402715_03077 gene open 33708-34418 yigB
6361 LLVU01000062.1 GCA001402715_03078 gene open 34590-34943 clpS
6362 LLVU01000062.1 GCA001402715_03079 gene open 34965-36029 rsmC
6363 LLVU01000062.1 GCA001402715_03080 gene open 36045-36455 rbcS
6364 LLVU01000062.1 GCA001402715_03081 gene open 36668-38653 srmB
6365 LLVU01000062.1 GCA001402715_03082 gene open 38725-39759 hemE
6366 LLVU01000062.1 GCA001402715_03083 gene open 39878-40822 hemC
6367 LLVU01000062.1 GCA001402715_03084 gene open 40926-42302 glcD
6368 LLVU01000062.1 GCA001402715_03085 gene open 42341-43543
6369 LLVU01000062.1 GCA001402715_03086 gene open 43584-43964
6370 LLVU01000062.1 GCA001402715_03087 gene open 43942-44247
6371 LLVU01000062.1 GCA001402715_03088 gene open 44285-44953 ybbA
6372 LLVU01000062.1 GCA001402715_03089 gene open 44950-47457 ybbP
6373 LLVU01000062.1 GCA001402715_03090 gene open 47519-47986 mltE
6374 LLVU01000062.1 GCA001402715_03091 gene open 48097-50514 copZ
6375 LLVU01000062.1 GCA001402715_03092 gene open 50641-50850
6376 LLVU01000062.1 GCA001402715_03093 gene open 50986-51627 hisH
6377 LLVU01000062.1 GCA001402715_03094 gene open 51627-52214 hisB
6378 LLVU01000062.1 GCA001402715_03097 gene open 52686-52883 yjbJ
6379 LLVU01000062.1 GCA001402715_03098 gene open 53136-55340 tar
6380 LLVU01000062.1 GCA001402715_03099 gene open 55522-57687
6381 LLVU01000062.1 GCA001402715_03100 gene open 57871-58692 phnC
6382 LLVU01000062.1 GCA001402715_03101 gene open 58735-59658 phnD
6383 LLVU01000062.1 GCA001402715_03102 gene open 59733-60614 phnE
6384 LLVU01000062.1 GCA001402715_03103 gene open 60611-61945 phnE
6385 LLVU01000062.1 GCA001402715_03104 gene open 61949-62575 wbbJ
6386 LLVU01000062.1 GCA001402715_03105 gene open 62554-63288 phnF
6387 LLVU01000062.1 GCA001402715_03106 gene open 63366-63836 phnG
6388 LLVU01000062.1 GCA001402715_03107 gene open 63837-64403 phnH
6389 LLVU01000062.1 GCA001402715_03108 gene open 64403-65476 phnI
6390 LLVU01000062.1 GCA001402715_03109 gene open 65479-65604
6391 LLVU01000062.1 GCA001402715_03110 gene open 65633-66496 phnJ
6392 LLVU01000062.1 GCA001402715_03111 gene open 66496-67302 phnK
6393 LLVU01000062.1 GCA001402715_03112 gene open 67307-67990 phnL
6394 LLVU01000062.1 GCA001402715_03113 gene open 68506-69177
6395 LLVU01000062.1 GCA001402715_03114 gene open 69267-70412 phnM
6396 LLVU01000062.1 GCA001402715_03115 gene open 70464-73898
6397 LLVU01000062.1 GCA001402715_03116 gene open 74075-75829
6398 LLVU01000062.1 GCA001402715_03117 gene open 75995-76933
6399 LLVU01000062.1 GCA001402715_03118 gene open 76930-77331
6400 LLVU01000062.1 GCA001402715_03119 gene open 77333-79597 glyS
6401 LLVU01000062.1 GCA001402715_03120 gene open 79735-82272 ppsA
6402 LLVU01000062.1 GCA001402715_03121 gene open 82547-83218 sleB
6403 LLVU01000062.1 GCA001402715_03122 gene open 83303-84214 folB
6404 LLVU01000062.1 GCA001402715_03123 gene open 84263-85279 folP
6405 LLVU01000062.1 GCA001402715_03124 gene open 85276-86622 glmM
6406 LLVU01000062.1 GCA001402715_03125 gene open 86626-86994
6407 LLVU01000062.1 GCA001402715_03126 gene open 87072-88094 ilvC
6408 LLVU01000062.1 GCA001402715_03127 gene open 88207-88677 lrp
6409 LLVU01000062.1 GCA001402715_03128 gene open 88674-89132 lrp
6410 LLVU01000062.1 GCA001402715_03129 gene open 89172-90074 ureD
6411 LLVU01000062.1 GCA001402715_03130 gene open 90084-90386 ureA
6412 LLVU01000062.1 GCA001402715_03131 gene open 90396-90701 ureB
6413 LLVU01000062.1 GCA001402715_03132 gene open 90701-92407 ureC
6414 LLVU01000062.1 GCA001402715_03134 gene open 92412-92756
6415 LLVU01000062.1 GCA001402715_03135 gene open 92837-93307 ureE
6416 LLVU01000062.1 GCA001402715_03136 gene open 93252-93935 ureF
6417 LLVU01000062.1 GCA001402715_03137 gene open 93932-94558 ureG
6418 LLVU01000062.1 GCA001402715_03138 gene open 94782-96083 urtA
6419 LLVU01000062.1 GCA001402715_03139 gene open 96144-98120 urtB
6420 LLVU01000062.1 GCA001402715_03140 gene open 98217-99455 urtC
6421 LLVU01000062.1 GCA001402715_03141 gene open 99452-100192 urtD
6422 LLVU01000062.1 GCA001402715_03142 gene open 100194-100889 urtE
6423 LLVU01000062.1 GCA001402715_03143 gene open 101065-102282 ubiH
6424 LLVU01000062.1 GCA001402715_03144 gene open 102369-102551
6425 LLVU01000062.1 GCA001402715_03145 gene open 102693-102911
6426 LLVU01000062.1 GCA001402715_03146 gene open 103057-103716 yigB
6427 LLVU01000062.1 GCA001402715_03147 gene open 103875-104510 gntR
6428 LLVU01000062.1 GCA001402715_03148 gene open 104517-106586 bcsA
6429 LLVU01000062.1 GCA001402715_03149 gene open 106738-107904
6430 LLVU01000062.1 GCA001402715_03150 gene open 108097-108480 gloA
6431 LLVU01000062.1 GCA001402715_03151 gene open 108588-109001 cycA
6432 LLVU01000062.1 GCA001402715_03152 gene open 109206-109868 lipB
6433 LLVU01000062.1 GCA001402715_03154 gene open 110360-112663
6434 LLVU01000062.1 GCA001402715_03155 gene open 112736-113839 potA
6435 LLVU01000062.1 GCA001402715_03156 gene open 113952-115025 potD
6436 LLVU01000062.1 GCA001402715_03157 gene open 115127-116392 potB
6437 LLVU01000062.1 GCA001402715_03158 gene open 116405-117358 potC
6438 LLVU01000062.1 GCA001402715_03159 gene open 117555-118505 yfdV
6439 LLVU01000062.1 GCA001402715_03160 gene open 118505-119305 phnP
6440 LLVU01000062.1 GCA001402715_03161 gene open 119298-120095 tatD
6441 LLVU01000062.1 GCA001402715_03162 gene open 120112-121221 dnaX
6442 LLVU01000062.1 GCA001402715_03163 gene open 121218-121838 tmk
6443 LLVU01000062.1 GCA001402715_03164 gene open 121843-123003 dacC
6444 LLVU01000062.1 GCA001402715_03165 gene open 123016-123882
6445 LLVU01000062.1 GCA001402715_03167 gene open 124873-125316
6446 LLVU01000062.1 GCA001402715_03168 gene open 125605-125883
6447 LLVU01000062.1 GCA001402715_03169 gene open 126076-126414
6448 LLVU01000062.1 GCA001402715_03170 gene open 126411-126998 iclR
6449 LLVU01000062.1 GCA001402715_03171 gene open 126995-127402
6450 LLVU01000062.1 GCA001402715_03172 gene open 128058-129041
6451 LLVU01000062.1 GCA001402715_03173 gene open 129157-129780 yobV
6452 LLVU01000062.1 GCA001402715_03174 gene open 129835-132339
6453 LLVU01000062.1 GCA001402715_03175 gene open 132770-134239 casA
6454 LLVU01000062.1 GCA001402715_03176 gene open 134236-134730 casB
6455 LLVU01000062.1 GCA001402715_03177 gene open 134727-135812 cas7e
6456 LLVU01000062.1 GCA001402715_03178 gene open 135812-136495 cas5e
6457 LLVU01000062.1 GCA001402715_03179 gene open 136492-137163 cas6e
6458 LLVU01000062.1 GCA001402715_03180 gene open 137160-138143 cas1e
6459 LLVU01000062.1 GCA001402715_03181 gene open 138140-138421 cas2e
6460 LLVU01000062.1 GCA001402715_03182 gene open 143285-143740 gpG
6461 LLVU01000062.1 GCA001402715_03183 gene open 143737-144069
6462 LLVU01000062.1 GCA001402715_03184 gene open 144077-145633
6463 LLVU01000062.1 GCA001402715_03185 gene open 145722-145970
6464 LLVU01000062.1 GCA001402715_03186 gene open 146057-146590
6465 LLVU01000062.1 GCA001402715_03187 gene open 146939-147370
6466 LLVU01000062.1 GCA001402715_03188 gene open 147385-148296 prpB
6467 LLVU01000062.1 GCA001402715_03189 gene open 148300-149475 prpC
6468 LLVU01000062.1 GCA001402715_03190 gene open 149486-150997 prpD
6469 LLVU01000062.1 GCA001402715_03191 gene open 151026-151409
6470 LLVU01000062.1 GCA001402715_03192 gene open 151526-152908
6471 LLVU01000062.1 GCA001402715_03193 gene open 152921-153538 pflA
6472 LLVU01000062.1 GCA001402715_03194 gene open 153531-153719
6473 LLVU01000062.1 GCA001402715_03195 gene open 153737-155767 nrdD
6474 LLVU01000062.1 GCA001402715_03196 gene open 156530-157672
6475 LLVU01000062.1 GCA001402715_03197 gene open 157750-159360 aceA
6476 LLVU01000062.1 GCA001402715_03198 gene open 159484-161106 aceB
6477 LLVU01000062.1 GCA001402715_03199 gene open 161261-162697
6478 LLVU01000062.1 GCA001402715_03200 gene open 162814-163587
6479 LLVU01000062.1 GCA001402715_03201 gene open 163584-163772
6480 LLVU01000062.1 GCA001402715_03202 gene open 164120-164548 lrp
6481 LLVU01000062.1 GCA001402715_03203 gene open 164666-165595 rocF
6482 LLVU01000062.1 GCA001402715_03204 gene open 165592-166644 oCDMu
6483 LLVU01000062.1 GCA001402715_03205 gene open 166800-168428
6484 LLVU01000062.1 GCA001402715_03206 gene open 168651-168914
6485 LLVU01000062.1 GCA001402715_03207 gene open 168917-169282 ompR
6486 LLVU01000062.1 GCA001402715_03208 gene open 169302-171263 cheA
6487 LLVU01000062.1 GCA001402715_03209 gene open 171275-171757 cheW
6488 LLVU01000062.1 GCA001402715_03210 gene open 171779-173971
6489 LLVU01000062.1 GCA001402715_03211 gene open 174079-174615 cheW
6490 LLVU01000062.1 GCA001402715_03212 gene open 174621-175523 cheR
6491 LLVU01000062.1 GCA001402715_03213 gene open 175520-176626 cheB
6492 LLVU01000062.1 GCA001402715_03214 gene open 176771-177376 fecR
6493 LLVU01000062.1 GCA001402715_03215 gene open 177366-177917
6494 LLVU01000062.1 GCA001402715_03216 gene open 177927-179117
6495 LLVU01000062.1 GCA001402715_03217 gene open 179117-179818 crp
6496 LLVU01000062.1 GCA001402715_03218 gene open 179948-181825
6497 LLVU01000062.1 GCA001402715_03219 gene open 181883-183442 leuA
6498 LLVU01000062.1 GCA001402715_03220 gene open 183733-185223
6499 LLVU01000062.1 GCA001402715_03221 gene open 185362-186816
6500 LLVU01000062.1 GCA001402715_03222 gene open 186965-188623 nadE