HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lactiplantibacillus plantarum (GCA_001435215.1)

Select a Genome:
BAKTA Annotations for GCA_001435215.1
Genome Selected: Lactiplantibacillus plantarum
ContigsBases CDSrRNA tmRNAtRNA
210 3,186,310 2936 4 1 69
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6082 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 6082 [13 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 AZFR01000136.1 repeat_region open 191621-191842 CRISPR array with 4 repeats of length 30%2C consensus sequence TGGGATCACCCCCGCATACACGGGGAACAG and spacer length 31
4002 AZFR01000136.1 repeat_region open 194304-194586 CRISPR array with 5 repeats of length 28%2C consensus sequence GGATCACCCCCGTATGTACGGGGAATAG and spacer length 33
4003 AZFR01000136.1 repeat_region open 196913-197192 CRISPR array with 5 repeats of length 28%2C consensus sequence GGATCACCCCCGCATACACGGGGAATAG and spacer length 33
4004 AZFR01000136.1 repeat_region open 205502-205928 CRISPR array with 7 repeats of length 28%2C consensus sequence GTGTTCCCCGTGTATGCGGGGGTGATCC and spacer length 33
4005 AZFR01000136.1 GCA001435215_00802 CDS open 3013-3513 _na     166_aa ABM domain-containing protein
4006 AZFR01000136.1 GCA001435215_00803 CDS open 3654-4397 _na     247_aa elaC Metal-dependent hydrolase%2C beta-lactamase superfamily III
4007 AZFR01000136.1 GCA001435215_00804 CDS open 4684-5082 _na     132_aa spxA transcriptional regulator SpxA
4008 AZFR01000136.1 GCA001435215_00805 CDS open 5218-5946 _na     242_aa mecA Adapter protein MecA
4009 AZFR01000136.1 GCA001435215_00806 CDS open 6119-7204 _na     361_aa Competence protein
4010 AZFR01000136.1 GCA001435215_00807 CDS open 7282-9093 _na     603_aa pepF oligoendopeptidase F
4011 AZFR01000136.1 GCA001435215_00814 CDS open 10239-10781 _na     180_aa apt Adenine phosphoribosyltransferase
4012 AZFR01000136.1 GCA001435215_00815 CDS open 10784-11857 _na     357_aa nCS2 Guanine permease
4013 AZFR01000136.1 GCA001435215_00816 CDS open 12052-12573 _na     173_aa ASCH domain-containing protein
4014 AZFR01000136.1 GCA001435215_00817 CDS open 12765-13283 _na     172_aa rimL Acetyltransferase%2C GNAT family
4015 AZFR01000136.1 GCA001435215_00818 CDS open 13397-14233 _na     278_aa yfcE Protein-serine/threonine phosphatase
4016 AZFR01000136.1 GCA001435215_00819 CDS open 14832-15059 _na     75_aa hypothetical protein
4017 AZFR01000136.1 GCA001435215_00820 CDS open 15072-16397 _na     441_aa mntH Nramp family divalent metal transporter
4018 AZFR01000136.1 GCA001435215_00821 CDS open 16369-17343 _na     324_aa hemH ferrochelatase
4019 AZFR01000136.1 GCA001435215_00822 CDS open 17676-19058 _na     460_aa lysP S-methylmethionine transport protein
4020 AZFR01000136.1 GCA001435215_00823 CDS open 19172-20101 _na     309_aa mmuM homocysteine S-methyltransferase
4021 AZFR01000136.1 GCA001435215_00824 CDS open 20500-21999 _na     499_aa Poly(Glycerol-phosphate) alpha-glucosyltransferase
4022 AZFR01000136.1 GCA001435215_00825 CDS open 22076-22795 _na     239_aa Integral membrane protein
4023 AZFR01000136.1 GCA001435215_00826 CDS open 23009-24196 _na     395_aa metK methionine adenosyltransferase
4024 AZFR01000136.1 GCA001435215_00827 CDS open 24332-25834 _na     500_aa araJ Methionine transport protein
4025 AZFR01000136.1 GCA001435215_00828 CDS open 26219-33268 _na     2349_aa mreB Cell shape-determining protein MreB
4026 AZFR01000136.1 GCA001435215_00829 CDS open 33395-35029 _na     544_aa Glycosyl transferase family 1
4027 AZFR01000136.1 GCA001435215_00830 CDS open 35029-36564 _na     511_aa rfaB Poly(Glycerol-phosphate) alpha-glucosyltransferase
4028 AZFR01000136.1 GCA001435215_00831 CDS open 36575-38101 _na     508_aa Poly(Glycerol-phosphate) alpha-glucosyltransferase
4029 AZFR01000136.1 GCA001435215_00832 CDS open 38131-38328 _na     65_aa Prophage protein
4030 AZFR01000136.1 GCA001435215_00833 CDS open 38415-38942 _na     175_aa gcd14 Methyltransferase%2C SAM-dependent
4031 AZFR01000136.1 GCA001435215_00834 CDS open 39011-39661 _na     216_aa Undecaprenyl-diphosphate phosphatase
4032 AZFR01000136.1 GCA001435215_00835 CDS open 40159-42585 _na     808_aa leuS leucine--tRNA ligase
4033 AZFR01000136.1 GCA001435215_00836 CDS open 43110-44780 _na     556_aa spoVB Polysaccharide biosynthesis protein
4034 AZFR01000136.1 GCA001435215_00837 CDS open 44788-45528 _na     246_aa rsuA Pseudouridine synthase
4035 AZFR01000136.1 GCA001435215_00838 CDS open 45668-46504 _na     278_aa nnrD ADP-dependent (S)-NAD(P)H-hydrate dehydratase
4036 AZFR01000136.1 GCA001435215_00839 CDS open 46631-48034 _na     467_aa pepV dipeptidase PepV
4037 AZFR01000136.1 GCA001435215_00840 CDS open 48061-48567 _na     168_aa uspA Nucleotide-binding protein%2C universal stress protein UspA family
4038 AZFR01000136.1 GCA001435215_00841 CDS open 48913-50013 _na     366_aa malK Methionine import ATP-binding protein MetN
4039 AZFR01000136.1 GCA001435215_00842 CDS open 49988-50953 _na     321_aa ugpA Glycerol-3-phosphate ABC transporter%2C permease protein
4040 AZFR01000136.1 GCA001435215_00843 CDS open 50953-51795 _na     280_aa Carbohydrate ABC transporter permease
4041 AZFR01000136.1 GCA001435215_00844 CDS open 51792-53144 _na     450_aa ugpB Glycerol-3-phosphate ABC transporter substrate-binding protein
4042 AZFR01000136.1 GCA001435215_00845 CDS open 53165-53851 _na     228_aa ugpQ Glycerophosphodiester phosphodiesterase
4043 AZFR01000136.1 GCA001435215_00846 CDS open 54043-54690 _na     215_aa dck Deoxynucleoside kinase
4044 AZFR01000136.1 GCA001435215_00847 CDS open 54795-55175 _na     126_aa mscL large-conductance mechanosensitive channel protein MscL
4045 AZFR01000136.1 GCA001435215_00848 CDS open 55520-58471 _na     983_aa tagG ABC-2 type transporter transmembrane domain-containing protein
4046 AZFR01000136.1 GCA001435215_00849 CDS open 58878-59036 _na     52_aa DUF2187 domain-containing protein
4047 AZFR01000136.1 GCA001435215_00850 CDS open 59057-59794 _na     245_aa ABC transporter%2C permease protein
4048 AZFR01000136.1 GCA001435215_00851 CDS open 59791-60648 _na     285_aa rbbA ABC transporter%2C ATP-binding protein
4049 AZFR01000136.1 GCA001435215_00852 CDS open 60799-61785 _na     328_aa rbbA Bifunctional protein: ABC transporter%2CATP-binding protein transcription regulator%2C LytR family
4050 AZFR01000136.1 GCA001435215_00853 CDS open 62121-64520 _na     799_aa RNA polymerase sigma-70 region 4 domain-containing protein
4051 AZFR01000136.1 GCA001435215_00854 CDS open 64844-65647 _na     267_aa msrA Peptide methionine sulfoxide reductase MsrA
4052 AZFR01000136.1 GCA001435215_00855 CDS open 66130-66951 _na     273_aa cof Hydrolase%2C HAD superfamily%2C Cof family
4053 AZFR01000136.1 GCA001435215_00856 CDS open 67081-67689 _na     202_aa Phage protein
4054 AZFR01000136.1 GCA001435215_00857 CDS open 67897-68361 _na     154_aa tnpA IS200/IS605 family transposase
4055 AZFR01000136.1 GCA001435215_00858 CDS open 68740-70002 _na     420_aa yesM Two-component system histidine protein kinase sensor protein
4056 AZFR01000136.1 GCA001435215_00859 CDS open 70008-70775 _na     255_aa lytT Two-component system response regulator
4057 AZFR01000136.1 GCA001435215_00860 CDS open 70943-71281 _na     112_aa Extracellular protein%2C membrane-anchored
4058 AZFR01000136.1 GCA001435215_00861 CDS open 71500-71871 _na     123_aa Integral membrane protein
4059 AZFR01000136.1 GCA001435215_00862 CDS open 71910-72596 _na     228_aa CPBP family intramembrane metalloprotease
4060 AZFR01000136.1 GCA001435215_00863 CDS open 73246-73722 _na     158_aa marR HTH-type transcriptional regulator SarZ
4061 AZFR01000136.1 GCA001435215_00864 CDS open 73839-74351 _na     170_aa hypothetical protein
4062 AZFR01000136.1 GCA001435215_00865 CDS open 74466-74753 _na     95_aa Heavy metal-binding domain-containing protein
4063 AZFR01000136.1 GCA001435215_00866 CDS open 74818-77085 _na     755_aa uvrA UvrABC system protein A
4064 AZFR01000136.1 GCA001435215_00869 CDS open 77937-78362 _na     141_aa Lipoprotein
4065 AZFR01000136.1 GCA001435215_00870 CDS open 78375-78494 _na     39_aa hypothetical protein
4066 AZFR01000136.1 GCA001435215_00871 CDS open 78527-79540 _na     337_aa Extracellular protein%2C membrane-anchored
4067 AZFR01000136.1 GCA001435215_00872 CDS open 79646-80167 _na     173_aa gtrA Teichoic acid glycosylation protein
4068 AZFR01000136.1 GCA001435215_00873 CDS open 80268-80627 _na     119_aa UPF0344 protein lp_1373
4069 AZFR01000136.1 GCA001435215_00874 CDS open 80700-82556 _na     618_aa metF bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase
4070 AZFR01000136.1 GCA001435215_00875 CDS open 82570-84876 _na     768_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
4071 AZFR01000136.1 GCA001435215_00876 CDS open 85765-87402 _na     545_aa Sulfotransferase family protein
4072 AZFR01000136.1 GCA001435215_00877 CDS open 87380-88555 _na     391_aa sat Sulfate adenylyltransferase
4073 AZFR01000136.1 GCA001435215_00878 CDS open 88558-89181 _na     207_aa cysC Adenylyl-sulfate kinase
4074 AZFR01000136.1 GCA001435215_00879 CDS open 89171-90127 _na     318_aa Phosphoesterase%2C DHH family
4075 AZFR01000136.1 GCA001435215_00880 CDS open 90344-92083 _na     579_aa Arylsulfate sulfotransferase
4076 AZFR01000136.1 GCA001435215_00881 CDS open 92592-94367 _na     591_aa trkA Sodium/sulfate symport protein
4077 AZFR01000136.1 GCA001435215_00882 CDS open 94643-96013 _na     456_aa norM Na+ driven multidrug efflux protein%2C MATE family
4078 AZFR01000136.1 GCA001435215_00883 CDS open 96160-96405 _na     81_aa DUF2187 domain-containing protein
4079 AZFR01000136.1 GCA001435215_00886 CDS open 96793-97239 _na     148_aa elaA GNAT family N-acetyltransferase
4080 AZFR01000136.1 GCA001435215_00887 CDS open 97511-99199 _na     562_aa argS arginine--tRNA ligase
4081 AZFR01000136.1 GCA001435215_00888 CDS open 99398-99874 _na     158_aa Integral membrane protein
4082 AZFR01000136.1 GCA001435215_00889 CDS open 100133-102127 _na     664_aa lolE ABC transporter%2C ATP-binding and permease protein
4083 AZFR01000136.1 GCA001435215_00890 CDS open 102696-103352 _na     218_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
4084 AZFR01000136.1 GCA001435215_00891 CDS open 103486-106014 _na     842_aa PRD domain-containing protein
4085 AZFR01000136.1 GCA001435215_00892 CDS open 106240-106689 _na     149_aa DUF3284 domain-containing protein
4086 AZFR01000136.1 GCA001435215_00893 CDS open 106993-107331 _na     112_aa celC PTS system%2C beta-glucosides-specific EIIA component
4087 AZFR01000136.1 GCA001435215_00894 CDS open 107328-107627 _na     99_aa PTS sugar transporter subunit IIB
4088 AZFR01000136.1 GCA001435215_00895 CDS open 107661-109016 _na     451_aa celB Permease IIC component
4089 AZFR01000136.1 GCA001435215_00896 CDS open 109019-110491 _na     490_aa bglB 6-phospho-beta-glucosidase
4090 AZFR01000136.1 GCA001435215_00897 CDS open 110503-110901 _na     132_aa hypothetical protein
4091 AZFR01000136.1 GCA001435215_00898 CDS open 111118-111687 _na     189_aa hypothetical protein
4092 AZFR01000136.1 GCA001435215_00899 CDS open 111684-112295 _na     203_aa erfK Cell surface protein%2C ErfK family
4093 AZFR01000136.1 GCA001435215_00900 CDS open 112564-112800 _na     78_aa dltC D-alanine--poly(phosphoribitol) ligase subunit DltC
4094 AZFR01000136.1 GCA001435215_00901 CDS open 112909-114360 _na     483_aa aRO8 Aminotransferase (PLP-dependent) with N-terminal regulator domain%2C GntR family
4095 AZFR01000136.1 GCA001435215_00902 CDS open 114596-115204 _na     202_aa argO Amino acid efflux protein
4096 AZFR01000136.1 GCA001435215_00903 CDS open 115270-116391 _na     373_aa aspB aminotransferase
4097 AZFR01000136.1 GCA001435215_00904 CDS open 116570-117031 _na     153_aa argR arginine repressor
4098 AZFR01000136.1 GCA001435215_00905 CDS open 117109-117231 _na     40_aa 30S ribosomal protein S21
4099 AZFR01000136.1 GCA001435215_00906 CDS open 117529-119658 _na     709_aa mrcB peptidoglycan glycosyltransferase
4100 AZFR01000136.1 GCA001435215_00907 CDS open 119749-120093 _na     114_aa ylbF UPF0342 protein lp_1415
4101 AZFR01000136.1 GCA001435215_00908 CDS open 120163-121383 _na     406_aa sbcD Phosphoesterase
4102 AZFR01000136.1 GCA001435215_00909 CDS open 121370-123850 _na     826_aa yhaN putative protein YhaN AAA domain-containing protein
4103 AZFR01000136.1 GCA001435215_00910 CDS open 123861-124841 _na     326_aa yhaM HD domain-containing protein
4104 AZFR01000136.1 GCA001435215_00911 CDS open 125274-126434 _na     386_aa hypothetical protein
4105 AZFR01000136.1 GCA001435215_00912 CDS open 126525-127496 _na     323_aa ctpA Carboxyterminal processing proteinase%2C S41 family%2C membrane-anchored
4106 AZFR01000136.1 GCA001435215_00913 CDS open 127682-128629 _na     315_aa lysR Transcription regulator%2C LysR family
4107 AZFR01000136.1 GCA001435215_00914 CDS open 128973-129587 _na     204_aa ssuE NADPH-dependent FMN reductase family protein
4108 AZFR01000136.1 GCA001435215_00915 CDS open 129590-132028 _na     812_aa urdA Urocanate reductase
4109 AZFR01000136.1 GCA001435215_00916 CDS open 132116-132676 _na     186_aa DUF2479 domain-containing protein
4110 AZFR01000136.1 GCA001435215_00917 CDS open 132747-133187 _na     146_aa rCL Nucleoside 2-deoxyribosyltransferase
4111 AZFR01000136.1 GCA001435215_00918 CDS open 134047-135042 _na     331_aa wcaA Glycosyltransferase%2C family 2
4112 AZFR01000136.1 GCA001435215_00919 CDS open 135039-137075 _na     678_aa Integral membrane protein
4113 AZFR01000136.1 GCA001435215_00920 CDS open 137257-137379 _na     40_aa hypothetical protein
4114 AZFR01000136.1 GCA001435215_00921 CDS open 137503-140052 _na     849_aa yfhO Integral membrane protein
4115 AZFR01000136.1 GCA001435215_00922 CDS open 140569-141636 _na     355_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
4116 AZFR01000136.1 GCA001435215_00923 CDS open 141637-142239 _na     200_aa ribC riboflavin synthase
4117 AZFR01000136.1 GCA001435215_00924 CDS open 142241-143455 _na     404_aa ribA GTP cyclohydrolase-2
4118 AZFR01000136.1 GCA001435215_00925 CDS open 143452-143931 _na     159_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
4119 AZFR01000136.1 GCA001435215_00926 CDS open 143962-144522 _na     186_aa Nucleotidyltransferase superfamily protein
4120 AZFR01000136.1 GCA001435215_00927 CDS open 144699-145262 _na     187_aa EF-hand domain-containing protein
4121 AZFR01000136.1 GCA001435215_00928 CDS open 145351-145992 _na     213_aa crp Transcription regulator%2C Crp/FNR family
4122 AZFR01000136.1 GCA001435215_00929 CDS open 146127-146753 _na     208_aa acrR Transcription regulator%2C TetR family
4123 AZFR01000136.1 GCA001435215_00930 CDS open 146907-148223 _na     438_aa fadH2 NADH peroxidase
4124 AZFR01000136.1 GCA001435215_00931 CDS open 148523-151810 _na     1095_aa WxL domain-containing protein
4125 AZFR01000136.1 GCA001435215_00932 CDS open 151816-152187 _na     123_aa cscD Cell surface protein%2C CscD family%2CLPXTG-motif cell wall anchor
4126 AZFR01000136.1 GCA001435215_00933 CDS open 152247-153293 _na     348_aa DUF916 domain-containing protein
4127 AZFR01000136.1 GCA001435215_00934 CDS open 153303-153983 _na     226_aa cscB Cell surface protein%2C CscB family
4128 AZFR01000136.1 GCA001435215_00935 CDS open 154003-154707 _na     234_aa WxL domain-containing protein
4129 AZFR01000136.1 GCA001435215_00936 CDS open 155001-155948 _na     315_aa draG Thiamine phosphate synthase
4130 AZFR01000136.1 GCA001435215_00937 CDS open 156115-157011 _na     298_aa prsA1 Foldase protein PrsA 1
4131 AZFR01000136.1 GCA001435215_00938 CDS open 157243-157584 _na     113_aa Extracellular protein%2C membrane-anchored
4132 AZFR01000136.1 GCA001435215_00939 CDS open 157595-158047 _na     150_aa hinT Nucleotide-binding protein%2C histidine triad family
4133 AZFR01000136.1 GCA001435215_00940 CDS open 158247-158984 _na     245_aa rbbA ABC superfamily ATP binding cassette transporter%2C ABC protein
4134 AZFR01000136.1 GCA001435215_00941 CDS open 158977-160182 _na     401_aa ecsB ABC transporter%2C permease protein
4135 AZFR01000136.1 GCA001435215_00942 CDS open 160301-161086 _na     261_aa cotS Aminoglycoside phosphotransferase domain-containing protein
4136 AZFR01000136.1 GCA001435215_00943 CDS open 161172-161816 _na     214_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
4137 AZFR01000136.1 GCA001435215_00944 CDS open 161957-162280 _na     107_aa PepSY domain-containing protein
4138 AZFR01000136.1 GCA001435215_00945 CDS open 162449-163090 _na     213_aa ytpR YtpR family tRNA-binding protein
4139 AZFR01000136.1 GCA001435215_00946 CDS open 163123-166119 _na     998_aa ftsK DNA translocase FtsK
4140 AZFR01000136.1 GCA001435215_00947 CDS open 166182-167492 _na     436_aa murC UDP-N-acetylmuramate--L-alanine ligase
4141 AZFR01000136.1 GCA001435215_00948 CDS open 167781-167945 _na     54_aa FeoB-associated Cys-rich membrane protein
4142 AZFR01000136.1 GCA001435215_00949 CDS open 167962-169950 _na     662_aa feoB ferrous iron transport protein B
4143 AZFR01000136.1 GCA001435215_00950 CDS open 169952-170176 _na     74_aa feoA Ferrous iron transporter FeoA-like domain-containing protein
4144 AZFR01000136.1 GCA001435215_00951 CDS open 170432-171229 _na     265_aa sufC Fe-S cluster assembly ATPase SufC
4145 AZFR01000136.1 GCA001435215_00952 CDS open 171242-172543 _na     433_aa sufD Fe-S cluster assembly protein SufD
4146 AZFR01000136.1 GCA001435215_00953 CDS open 172527-173765 _na     412_aa csdA Cysteine desulfurase
4147 AZFR01000136.1 GCA001435215_00954 CDS open 173752-174219 _na     155_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
4148 AZFR01000136.1 GCA001435215_00955 CDS open 174216-175622 _na     468_aa sufB Fe-S cluster assembly protein SufB
4149 AZFR01000136.1 GCA001435215_00956 CDS open 175916-176254 _na     112_aa paaD Aromatic ring hydroxylating enzyme
4150 AZFR01000136.1 GCA001435215_00957 CDS open 176278-177165 _na     295_aa hipB HTH cro/C1-type domain-containing protein
4151 AZFR01000136.1 GCA001435215_00958 CDS open 177705-178421 _na     238_aa ybhL Bax inhibitor-1/YccA family protein
4152 AZFR01000136.1 GCA001435215_00959 CDS open 178683-181331 _na     882_aa polA DNA polymerase I
4153 AZFR01000136.1 GCA001435215_00960 CDS open 181343-182167 _na     274_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
4154 AZFR01000136.1 GCA001435215_00961 CDS open 182177-182770 _na     197_aa coaE dephospho-CoA kinase
4155 AZFR01000136.1 GCA001435215_00962 CDS open 182812-183327 _na     171_aa nrdR transcriptional regulator NrdR
4156 AZFR01000136.1 GCA001435215_00963 CDS open 183349-184752 _na     467_aa dnaB Replication initiation and membrane attachment protein DnaB
4157 AZFR01000136.1 GCA001435215_00964 CDS open 184756-185691 _na     311_aa dnaI primosomal protein DnaI
4158 AZFR01000136.1 GCA001435215_00965 CDS open 185922-187988 _na     688_aa thrS threonine--tRNA ligase
4159 AZFR01000136.1 GCA001435215_00966 CDS open 188231-188731 _na     166_aa infC translation initiation factor IF-3
4160 AZFR01000136.1 GCA001435215_00967 CDS open 188753-188947 _na     64_aa rpmI 50S ribosomal protein L35
4161 AZFR01000136.1 GCA001435215_00968 CDS open 188984-189340 _na     118_aa rplT 50S ribosomal protein L20
4162 AZFR01000136.1 GCA001435215_00969 CDS open 189584-189895 _na     103_aa Phage protein
4163 AZFR01000136.1 GCA001435215_00970 CDS open 190063-191325 _na     420_aa rarA ATPase%2C AAA family
4164 AZFR01000136.1 GCA001435215_00971 CDS open 192057-192461 _na     134_aa hypothetical protein
4165 AZFR01000136.1 GCA001435215_00972 CDS open 192833-193582 _na     249_aa Aspartate/glutamate racemase family protein
4166 AZFR01000136.1 GCA001435215_00973 CDS open 194914-195864 _na     316_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
4167 AZFR01000136.1 GCA001435215_00974 CDS open 195861-196751 _na     296_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
4168 AZFR01000136.1 GCA001435215_00975 CDS open 197750-200497 _na     915_aa CRISPR-associated helicase/endonuclease Cas3
4169 AZFR01000136.1 GCA001435215_00976 CDS open 200503-202233 _na     576_aa Type I-E CRISPR-associated protein Cse1/CasA
4170 AZFR01000136.1 GCA001435215_00977 CDS open 202247-202852 _na     201_aa casB type I-E CRISPR-associated protein Cse2/CasB
4171 AZFR01000136.1 GCA001435215_00978 CDS open 202852-203931 _na     359_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
4172 AZFR01000136.1 GCA001435215_00979 CDS open 203912-204619 _na     235_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
4173 AZFR01000136.1 GCA001435215_00980 CDS open 204633-205304 _na     223_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
4174 AZFR01000136.1 GCA001435215_00981 CDS open 206034-207347 _na     437_aa bcsA Glycosyl transferase
4175 AZFR01000136.1 GCA001435215_00982 CDS open 207351-207833 _na     160_aa Integral membrane protein
4176 AZFR01000136.1 GCA001435215_00983 CDS open 208474-209004 _na     176_aa yqeG Hydrolase%2C HAD superfamily
4177 AZFR01000136.1 GCA001435215_00984 CDS open 209001-210137 _na     378_aa yqeH ribosome biogenesis GTPase YqeH
4178 AZFR01000136.1 GCA001435215_00985 CDS open 210208-210522 _na     104_aa yhbY ribosome assembly RNA-binding protein YhbY
4179 AZFR01000136.1 GCA001435215_00986 CDS open 210535-211170 _na     211_aa nadD nicotinate-nucleotide adenylyltransferase
4180 AZFR01000136.1 GCA001435215_00987 CDS open 211154-211771 _na     205_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
4181 AZFR01000136.1 GCA001435215_00988 CDS open 211789-212145 _na     118_aa rsfS ribosome silencing factor
4182 AZFR01000136.1 GCA001435215_00989 CDS open 212142-212876 _na     244_aa ubiG Methyltransferase
4183 AZFR01000136.1 GCA001435215_00990 CDS open 212890-214041 _na     383_aa tmcAL nucleotidyltransferase
4184 AZFR01000136.1 GCA001435215_00991 CDS open 214166-214720 _na     184_aa yceD DNA-binding protein
4185 AZFR01000136.1 GCA001435215_00992 CDS open 215249-215833 _na     194_aa ykoI PepSY domain-containing protein
4186 AZFR01000136.1 GCA001435215_00993 CDS open 215969-216931 _na     320_aa fieF Cation transporter
4187 AZFR01000136.1 GCA001435215_00994 CDS open 217326-218762 _na     478_aa gndA NADP-dependent phosphogluconate dehydrogenase
4188 AZFR01000136.1 GCA001435215_00995 CDS open 218931-220280 _na     449_aa rarA Recombination factor protein RarA ATPase%2C AAA family
4189 AZFR01000136.1 GCA001435215_00996 CDS open 220471-221157 _na     228_aa ompR Two-component system response regulator
4190 AZFR01000136.1 GCA001435215_00997 CDS open 221157-222800 _na     547_aa walK Signal transduction histidine-protein kinase ArlS
4191 AZFR01000136.1 GCA001435215_00998 CDS open 223161-224129 _na     322_aa 1%2C4-dihydroxy-2-naphthoate prenyltransferase
4192 AZFR01000136.1 GCA001435215_00999 CDS open 224268-227453 _na     1061_aa sbcC Nuclease SbcCD subunit C
4193 AZFR01000136.1 GCA001435215_01000 CDS open 227456-228637 _na     393_aa sbcD Nuclease SbcCD subunit D
4194 AZFR01000136.1 GCA001435215_01001 CDS open 229117-230742 _na     541_aa Peptide ABC transporter substrate-binding protein
4195 AZFR01000136.1 GCA001435215_01002 CDS open 230756-231076 _na     106_aa Thioredoxin
4196 AZFR01000136.1 GCA001435215_01003 CDS open 231489-232067 _na     192_aa sdpI SdpI family protein
4197 AZFR01000136.1 GCA001435215_01004 CDS open 232214-233137 _na     307_aa yidC1 Membrane protein insertase YidC 1
4198 AZFR01000136.1 GCA001435215_01005 CDS open 233201-233473 _na     90_aa acyP Acylphosphatase
4199 AZFR01000136.1 GCA001435215_01006 CDS open 233740-234507 _na     255_aa spoU rRNA methylase%2C SpoU family
4200 AZFR01000136.1 GCA001435215_01007 CDS open 234608-235117 _na     169_aa rnaY HD domain-containing protein
4201 AZFR01000136.1 GCA001435215_01008 CDS open 235140-235499 _na     119_aa hxlR Transcription regulator%2C MarR family
4202 AZFR01000136.1 GCA001435215_01009 CDS open 235827-236873 _na     348_aa pheS phenylalanine--tRNA ligase subunit alpha
4203 AZFR01000136.1 GCA001435215_01010 CDS open 236882-239299 _na     805_aa pheT phenylalanine--tRNA ligase subunit beta
4204 AZFR01000136.1 GCA001435215_01011 CDS open 239461-240651 _na     396_aa mltG Endolytic murein transglycosylase
4205 AZFR01000136.1 GCA001435215_01012 CDS open 240670-241299 _na     209_aa udk uridine kinase
4206 AZFR01000136.1 GCA001435215_01013 CDS open 241409-241891 _na     160_aa greA transcription elongation factor GreA
4207 AZFR01000136.1 GCA001435215_01014 CDS open 243025-243747 _na     240_aa liaF LiaF transmembrane domain-containing protein
4208 AZFR01000136.1 GCA001435215_01015 CDS open 243748-244203 _na     151_aa lytTR HTH LytTR-type domain-containing protein
4209 AZFR01000136.1 GCA001435215_01016 CDS open 244388-244690 _na     100_aa yneR Iron-sulfur cluster biosynthesis protein
4210 AZFR01000136.1 GCA001435215_01017 CDS open 244807-247452 _na     881_aa yfhO Integral membrane protein
4211 AZFR01000136.1 GCA001435215_01018 CDS open 247652-249688 _na     678_aa ftsI Transpeptidase (Penicillin binding protein 2B)
4212 AZFR01000136.1 GCA001435215_01019 CDS open 249814-249963 _na     49_aa rpmG 50S ribosomal protein L33
4213 AZFR01000136.1 GCA001435215_01020 CDS open 250111-250677 _na     188_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
4214 AZFR01000136.1 GCA001435215_01021 CDS open 250664-251347 _na     227_aa Rhomboid family intramembrane serine protease
4215 AZFR01000136.1 GCA001435215_01022 CDS open 251366-251587 _na     73_aa yqgQ DUF910 domain-containing protein
4216 AZFR01000136.1 GCA001435215_01023 CDS open 251605-252567 _na     320_aa nagC Glucokinase
4217 AZFR01000136.1 GCA001435215_01024 CDS open 252838-253473 _na     211_aa pepE Dipeptidase
4218 AZFR01000136.1 GCA001435215_01025 CDS open 253701-254114 _na     137_aa pspE Hydroxyacylglutathione hydrolase
4219 AZFR01000136.1 GCA001435215_01026 CDS open 254164-254340 _na     58_aa Extracellular protein
4220 AZFR01000136.1 GCA001435215_01027 CDS open 254439-255173 _na     244_aa ugpQ Glycerophosphodiester phosphodiesterase
4221 AZFR01000136.1 GCA001435215_01028 CDS open 255178-256113 _na     311_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
4222 AZFR01000136.1 GCA001435215_01029 CDS open 256225-256605 _na     126_aa soxR Glutamine synthetase repressor%2C MerR family
4223 AZFR01000136.1 GCA001435215_01030 CDS open 256649-257995 _na     448_aa glnA type I glutamate--ammonia ligase
4224 AZFR01000136.1 GCA001435215_01031 CDS open 258178-259065 _na     295_aa sbcC Exonuclease SbcC
4225 AZFR01000136.1 GCA001435215_01032 CDS open 259055-260011 _na     318_aa hypothetical protein
4226 AZFR01000136.1 GCA001435215_01033 CDS open 260028-260567 _na     179_aa dut2 2-deoxyuridine 5-triphosphate nucleotidohydrolase (dUTPase)
4227 AZFR01000136.1 GCA001435215_01034 CDS open 260615-260953 _na     112_aa Prophage protein
4228 AZFR01000136.1 GCA001435215_01035 CDS open 261011-261211 _na     66_aa Transcription regulator
4229 AZFR01000136.1 GCA001435215_01037 CDS open 261952-262077 _na     41_aa hypothetical protein
4230 AZFR01000136.1 GCA001435215_01038 CDS open 262168-262323 _na     51_aa hypothetical protein
4231 AZFR01000136.1 GCA001435215_01039 CDS open 262495-262770 _na     91_aa hypothetical protein
4232 AZFR01000136.1 GCA001435215_01040 CDS open 262724-263146 _na     140_aa hypothetical protein
4233 AZFR01000136.1 GCA001435215_01041 CDS open 263469-264098 _na     209_aa tetR Transcription regulator%2C TetR family
4234 AZFR01000136.1 GCA001435215_01042 CDS open 264256-264564 _na     102_aa rplU 50S ribosomal protein L21
4235 AZFR01000136.1 GCA001435215_01043 CDS open 264586-264921 _na     111_aa ysxB Ribosomal processing cysteine protease Prp
4236 AZFR01000136.1 GCA001435215_01044 CDS open 264946-265224 _na     92_aa rpmA 50S ribosomal protein L27
4237 AZFR01000136.1 GCA001435215_01045 CDS open 265416-266477 _na     353_aa pepP Xaa-Pro aminopeptidase
4238 AZFR01000136.1 GCA001435215_01046 CDS open 266548-267105 _na     185_aa efp elongation factor P
4239 AZFR01000136.1 GCA001435215_01047 CDS open 267155-267613 _na     152_aa yloU General stress protein%2C Gls24 family
4240 AZFR01000136.1 GCA001435215_01048 CDS open 267610-268029 _na     139_aa nusB transcription antitermination factor NusB
4241 AZFR01000136.1 GCA001435215_01049 CDS open 268176-269036 _na     286_aa folD Bifunctional protein FolD
4242 AZFR01000136.1 GCA001435215_01050 CDS open 269029-270372 _na     447_aa xseA exodeoxyribonuclease VII large subunit
4243 AZFR01000136.1 GCA001435215_01051 CDS open 270372-270602 _na     76_aa xseB exodeoxyribonuclease VII small subunit
4244 AZFR01000136.1 GCA001435215_01052 CDS open 270595-271485 _na     296_aa ispA Polyprenyl synthetase
4245 AZFR01000136.1 GCA001435215_01053 CDS open 271500-272318 _na     272_aa yqxC rRNA methylase
4246 AZFR01000136.1 GCA001435215_01054 CDS open 272402-272860 _na     152_aa argR2 Arginine repressor
4247 AZFR01000136.1 GCA001435215_01055 CDS open 272963-274657 _na     564_aa recN DNA repair protein RecN
4248 AZFR01000136.1 GCA001435215_01056 CDS open 275035-276219 _na     394_aa opuBA Quaternary amine transport ATP-binding protein
4249 AZFR01000136.1 GCA001435215_01057 CDS open 276216-276845 _na     209_aa opuBB Glycine betaine/carnitine/choline ABC transporter%2C permease protein
4250 AZFR01000136.1 GCA001435215_01058 CDS open 276858-277793 _na     311_aa osmF Glycine betaine/carnitine/choline ABC transporter%2C substrate binding protein
4251 AZFR01000136.1 GCA001435215_01059 CDS open 277793-278446 _na     217_aa opuBB Glycine betaine/carnitine/choline ABC transporter%2C permease protein
4252 AZFR01000136.1 GCA001435215_01060 CDS open 278652-278987 _na     111_aa DUF2642 domain-containing protein
4253 AZFR01000136.1 GCA001435215_01061 CDS open 279180-279800 _na     206_aa gmk guanylate kinase
4254 AZFR01000136.1 GCA001435215_01062 CDS open 279797-280009 _na     70_aa rpoZ DNA-directed RNA polymerase subunit omega
4255 AZFR01000136.1 GCA001435215_01063 CDS open 280173-281399 _na     408_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
4256 AZFR01000136.1 GCA001435215_01064 CDS open 281422-283839 _na     805_aa priA primosomal protein N'
4257 AZFR01000136.1 GCA001435215_01065 CDS open 283863-284816 _na     317_aa fmt methionyl-tRNA formyltransferase
4258 AZFR01000136.1 GCA001435215_01066 CDS open 284813-286156 _na     447_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
4259 AZFR01000136.1 GCA001435215_01067 CDS open 286174-286920 _na     248_aa pTC1 Stp1/IreP family PP2C-type Ser/Thr phosphatase
4260 AZFR01000136.1 GCA001435215_01068 CDS open 286917-288941 _na     674_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
4261 AZFR01000136.1 GCA001435215_01069 CDS open 289026-289922 _na     298_aa rsgA ribosome small subunit-dependent GTPase A
4262 AZFR01000136.1 GCA001435215_01070 CDS open 289932-290585 _na     217_aa rpe ribulose-phosphate 3-epimerase
4263 AZFR01000136.1 GCA001435215_01071 CDS open 290585-291244 _na     219_aa thiN thiamine diphosphokinase
4264 AZFR01000136.1 GCA001435215_01072 CDS open 291605-291790 _na     61_aa rpmB 50S ribosomal protein L28
4265 AZFR01000136.1 GCA001435215_01073 CDS open 292026-292388 _na     120_aa yloU Alkaline shock protein
4266 AZFR01000136.1 GCA001435215_01074 CDS open 292419-294131 _na     570_aa fakA DhaL domain-containing protein
4267 AZFR01000136.1 GCA001435215_01075 CDS open 294274-296313 _na     679_aa recG ATP-dependent DNA helicase RecG
4268 AZFR01000136.1 GCA001435215_01076 CDS open 296356-297402 _na     348_aa plsX phosphate acyltransferase PlsX
4269 AZFR01000136.1 GCA001435215_01077 CDS open 297441-297686 _na     81_aa acpP acyl carrier protein
4270 AZFR01000136.1 GCA001435215_01078 CDS open 298102-298797 _na     231_aa rnc ribonuclease III
4271 AZFR01000136.1 GCA001435215_01079 CDS open 298828-302385 _na     1185_aa smc chromosome segregation protein SMC
4272 AZFR01000136.1 GCA001435215_01080 CDS open 302404-303942 _na     512_aa ftsY signal recognition particle-docking protein FtsY
4273 AZFR01000136.1 GCA001435215_01081 CDS open 304120-304467 _na     115_aa ylxM putative DNA-binding protein
4274 AZFR01000136.1 GCA001435215_01082 CDS open 304490-305938 _na     482_aa ffh signal recognition particle protein
4275 AZFR01000136.1 GCA001435215_01083 CDS open 306035-306307 _na     90_aa rpsP 30S ribosomal protein S16
4276 AZFR01000136.1 GCA001435215_01084 CDS open 306325-306582 _na     85_aa khpA RNA-binding protein KhpA
4277 AZFR01000136.1 GCA001435215_01085 CDS open 306741-307265 _na     174_aa rimM ribosome maturation factor RimM
4278 AZFR01000136.1 GCA001435215_01086 CDS open 307265-308005 _na     246_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
4279 AZFR01000136.1 GCA001435215_01087 CDS open 308163-308519 _na     118_aa rplS 50S ribosomal protein L19
4280 AZFR01000136.1 GCA001435215_01088 CDS open 308954-309274 _na     106_aa Gar-IM
4281 AZFR01000136.1 GCA001435215_00802 gene open 3013-3513
4282 AZFR01000136.1 GCA001435215_00803 gene open 3654-4397 elaC
4283 AZFR01000136.1 GCA001435215_00804 gene open 4684-5082 spxA
4284 AZFR01000136.1 GCA001435215_00805 gene open 5218-5946 mecA
4285 AZFR01000136.1 GCA001435215_00806 gene open 6119-7204
4286 AZFR01000136.1 GCA001435215_00807 gene open 7282-9093 pepF
4287 AZFR01000136.1 GCA001435215_00814 gene open 10239-10781 apt
4288 AZFR01000136.1 GCA001435215_00815 gene open 10784-11857 nCS2
4289 AZFR01000136.1 GCA001435215_00816 gene open 12052-12573
4290 AZFR01000136.1 GCA001435215_00817 gene open 12765-13283 rimL
4291 AZFR01000136.1 GCA001435215_00818 gene open 13397-14233 yfcE
4292 AZFR01000136.1 GCA001435215_00819 gene open 14832-15059
4293 AZFR01000136.1 GCA001435215_00820 gene open 15072-16397 mntH
4294 AZFR01000136.1 GCA001435215_00821 gene open 16369-17343 hemH
4295 AZFR01000136.1 GCA001435215_00822 gene open 17676-19058 lysP
4296 AZFR01000136.1 GCA001435215_00823 gene open 19172-20101 mmuM
4297 AZFR01000136.1 GCA001435215_00824 gene open 20500-21999
4298 AZFR01000136.1 GCA001435215_00825 gene open 22076-22795
4299 AZFR01000136.1 GCA001435215_00826 gene open 23009-24196 metK
4300 AZFR01000136.1 GCA001435215_00827 gene open 24332-25834 araJ
4301 AZFR01000136.1 GCA001435215_00828 gene open 26219-33268 mreB
4302 AZFR01000136.1 GCA001435215_00829 gene open 33395-35029
4303 AZFR01000136.1 GCA001435215_00830 gene open 35029-36564 rfaB
4304 AZFR01000136.1 GCA001435215_00831 gene open 36575-38101
4305 AZFR01000136.1 GCA001435215_00832 gene open 38131-38328
4306 AZFR01000136.1 GCA001435215_00833 gene open 38415-38942 gcd14
4307 AZFR01000136.1 GCA001435215_00834 gene open 39011-39661
4308 AZFR01000136.1 GCA001435215_00835 gene open 40159-42585 leuS
4309 AZFR01000136.1 GCA001435215_00836 gene open 43110-44780 spoVB
4310 AZFR01000136.1 GCA001435215_00837 gene open 44788-45528 rsuA
4311 AZFR01000136.1 GCA001435215_00838 gene open 45668-46504 nnrD
4312 AZFR01000136.1 GCA001435215_00839 gene open 46631-48034 pepV
4313 AZFR01000136.1 GCA001435215_00840 gene open 48061-48567 uspA
4314 AZFR01000136.1 GCA001435215_00841 gene open 48913-50013 malK
4315 AZFR01000136.1 GCA001435215_00842 gene open 49988-50953 ugpA
4316 AZFR01000136.1 GCA001435215_00843 gene open 50953-51795
4317 AZFR01000136.1 GCA001435215_00844 gene open 51792-53144 ugpB
4318 AZFR01000136.1 GCA001435215_00845 gene open 53165-53851 ugpQ
4319 AZFR01000136.1 GCA001435215_00846 gene open 54043-54690 dck
4320 AZFR01000136.1 GCA001435215_00847 gene open 54795-55175 mscL
4321 AZFR01000136.1 GCA001435215_00848 gene open 55520-58471 tagG
4322 AZFR01000136.1 GCA001435215_00849 gene open 58878-59036
4323 AZFR01000136.1 GCA001435215_00850 gene open 59057-59794
4324 AZFR01000136.1 GCA001435215_00851 gene open 59791-60648 rbbA
4325 AZFR01000136.1 GCA001435215_00852 gene open 60799-61785 rbbA
4326 AZFR01000136.1 GCA001435215_00853 gene open 62121-64520
4327 AZFR01000136.1 GCA001435215_00854 gene open 64844-65647 msrA
4328 AZFR01000136.1 GCA001435215_00855 gene open 66130-66951 cof
4329 AZFR01000136.1 GCA001435215_00856 gene open 67081-67689
4330 AZFR01000136.1 GCA001435215_00857 gene open 67897-68361 tnpA
4331 AZFR01000136.1 GCA001435215_00858 gene open 68740-70002 yesM
4332 AZFR01000136.1 GCA001435215_00859 gene open 70008-70775 lytT
4333 AZFR01000136.1 GCA001435215_00860 gene open 70943-71281
4334 AZFR01000136.1 GCA001435215_00861 gene open 71500-71871
4335 AZFR01000136.1 GCA001435215_00862 gene open 71910-72596
4336 AZFR01000136.1 GCA001435215_00863 gene open 73246-73722 marR
4337 AZFR01000136.1 GCA001435215_00864 gene open 73839-74351
4338 AZFR01000136.1 GCA001435215_00865 gene open 74466-74753
4339 AZFR01000136.1 GCA001435215_00866 gene open 74818-77085 uvrA
4340 AZFR01000136.1 GCA001435215_00869 gene open 77937-78362
4341 AZFR01000136.1 GCA001435215_00870 gene open 78375-78494
4342 AZFR01000136.1 GCA001435215_00871 gene open 78527-79540
4343 AZFR01000136.1 GCA001435215_00872 gene open 79646-80167 gtrA
4344 AZFR01000136.1 GCA001435215_00873 gene open 80268-80627
4345 AZFR01000136.1 GCA001435215_00874 gene open 80700-82556 metF
4346 AZFR01000136.1 GCA001435215_00875 gene open 82570-84876 metE
4347 AZFR01000136.1 GCA001435215_00876 gene open 85765-87402
4348 AZFR01000136.1 GCA001435215_00877 gene open 87380-88555 sat
4349 AZFR01000136.1 GCA001435215_00878 gene open 88558-89181 cysC
4350 AZFR01000136.1 GCA001435215_00879 gene open 89171-90127
4351 AZFR01000136.1 GCA001435215_00880 gene open 90344-92083
4352 AZFR01000136.1 GCA001435215_00881 gene open 92592-94367 trkA
4353 AZFR01000136.1 GCA001435215_00882 gene open 94643-96013 norM
4354 AZFR01000136.1 GCA001435215_00883 gene open 96160-96405
4355 AZFR01000136.1 GCA001435215_00886 gene open 96793-97239 elaA
4356 AZFR01000136.1 GCA001435215_00887 gene open 97511-99199 argS
4357 AZFR01000136.1 GCA001435215_00888 gene open 99398-99874
4358 AZFR01000136.1 GCA001435215_00889 gene open 100133-102127 lolE
4359 AZFR01000136.1 GCA001435215_00890 gene open 102696-103352
4360 AZFR01000136.1 GCA001435215_00891 gene open 103486-106014
4361 AZFR01000136.1 GCA001435215_00892 gene open 106240-106689
4362 AZFR01000136.1 GCA001435215_00893 gene open 106993-107331 celC
4363 AZFR01000136.1 GCA001435215_00894 gene open 107328-107627
4364 AZFR01000136.1 GCA001435215_00895 gene open 107661-109016 celB
4365 AZFR01000136.1 GCA001435215_00896 gene open 109019-110491 bglB
4366 AZFR01000136.1 GCA001435215_00897 gene open 110503-110901
4367 AZFR01000136.1 GCA001435215_00898 gene open 111118-111687
4368 AZFR01000136.1 GCA001435215_00899 gene open 111684-112295 erfK
4369 AZFR01000136.1 GCA001435215_00900 gene open 112564-112800 dltC
4370 AZFR01000136.1 GCA001435215_00901 gene open 112909-114360 aRO8
4371 AZFR01000136.1 GCA001435215_00902 gene open 114596-115204 argO
4372 AZFR01000136.1 GCA001435215_00903 gene open 115270-116391 aspB
4373 AZFR01000136.1 GCA001435215_00904 gene open 116570-117031 argR
4374 AZFR01000136.1 GCA001435215_00905 gene open 117109-117231
4375 AZFR01000136.1 GCA001435215_00906 gene open 117529-119658 mrcB
4376 AZFR01000136.1 GCA001435215_00907 gene open 119749-120093 ylbF
4377 AZFR01000136.1 GCA001435215_00908 gene open 120163-121383 sbcD
4378 AZFR01000136.1 GCA001435215_00909 gene open 121370-123850 yhaN
4379 AZFR01000136.1 GCA001435215_00910 gene open 123861-124841 yhaM
4380 AZFR01000136.1 GCA001435215_00911 gene open 125274-126434
4381 AZFR01000136.1 GCA001435215_00912 gene open 126525-127496 ctpA
4382 AZFR01000136.1 GCA001435215_00913 gene open 127682-128629 lysR
4383 AZFR01000136.1 GCA001435215_00914 gene open 128973-129587 ssuE
4384 AZFR01000136.1 GCA001435215_00915 gene open 129590-132028 urdA
4385 AZFR01000136.1 GCA001435215_00916 gene open 132116-132676
4386 AZFR01000136.1 GCA001435215_00917 gene open 132747-133187 rCL
4387 AZFR01000136.1 GCA001435215_00918 gene open 134047-135042 wcaA
4388 AZFR01000136.1 GCA001435215_00919 gene open 135039-137075
4389 AZFR01000136.1 GCA001435215_00920 gene open 137257-137379
4390 AZFR01000136.1 GCA001435215_00921 gene open 137503-140052 yfhO
4391 AZFR01000136.1 GCA001435215_00922 gene open 140569-141636 ribD
4392 AZFR01000136.1 GCA001435215_00923 gene open 141637-142239 ribC
4393 AZFR01000136.1 GCA001435215_00924 gene open 142241-143455 ribA
4394 AZFR01000136.1 GCA001435215_00925 gene open 143452-143931 ribH
4395 AZFR01000136.1 GCA001435215_00926 gene open 143962-144522
4396 AZFR01000136.1 GCA001435215_00927 gene open 144699-145262
4397 AZFR01000136.1 GCA001435215_00928 gene open 145351-145992 crp
4398 AZFR01000136.1 GCA001435215_00929 gene open 146127-146753 acrR
4399 AZFR01000136.1 GCA001435215_00930 gene open 146907-148223 fadH2
4400 AZFR01000136.1 GCA001435215_00931 gene open 148523-151810
4401 AZFR01000136.1 GCA001435215_00932 gene open 151816-152187 cscD
4402 AZFR01000136.1 GCA001435215_00933 gene open 152247-153293
4403 AZFR01000136.1 GCA001435215_00934 gene open 153303-153983 cscB
4404 AZFR01000136.1 GCA001435215_00935 gene open 154003-154707
4405 AZFR01000136.1 GCA001435215_00936 gene open 155001-155948 draG
4406 AZFR01000136.1 GCA001435215_00937 gene open 156115-157011 prsA1
4407 AZFR01000136.1 GCA001435215_00938 gene open 157243-157584
4408 AZFR01000136.1 GCA001435215_00939 gene open 157595-158047 hinT
4409 AZFR01000136.1 GCA001435215_00940 gene open 158247-158984 rbbA
4410 AZFR01000136.1 GCA001435215_00941 gene open 158977-160182 ecsB
4411 AZFR01000136.1 GCA001435215_00942 gene open 160301-161086 cotS
4412 AZFR01000136.1 GCA001435215_00943 gene open 161172-161816 trmB
4413 AZFR01000136.1 GCA001435215_00944 gene open 161957-162280
4414 AZFR01000136.1 GCA001435215_00945 gene open 162449-163090 ytpR
4415 AZFR01000136.1 GCA001435215_00946 gene open 163123-166119 ftsK
4416 AZFR01000136.1 GCA001435215_00947 gene open 166182-167492 murC
4417 AZFR01000136.1 GCA001435215_00948 gene open 167781-167945
4418 AZFR01000136.1 GCA001435215_00949 gene open 167962-169950 feoB
4419 AZFR01000136.1 GCA001435215_00950 gene open 169952-170176 feoA
4420 AZFR01000136.1 GCA001435215_00951 gene open 170432-171229 sufC
4421 AZFR01000136.1 GCA001435215_00952 gene open 171242-172543 sufD
4422 AZFR01000136.1 GCA001435215_00953 gene open 172527-173765 csdA
4423 AZFR01000136.1 GCA001435215_00954 gene open 173752-174219 sufU
4424 AZFR01000136.1 GCA001435215_00955 gene open 174216-175622 sufB
4425 AZFR01000136.1 GCA001435215_00956 gene open 175916-176254 paaD
4426 AZFR01000136.1 GCA001435215_00957 gene open 176278-177165 hipB
4427 AZFR01000136.1 GCA001435215_00958 gene open 177705-178421 ybhL
4428 AZFR01000136.1 GCA001435215_00959 gene open 178683-181331 polA
4429 AZFR01000136.1 GCA001435215_00960 gene open 181343-182167 mutM
4430 AZFR01000136.1 GCA001435215_00961 gene open 182177-182770 coaE
4431 AZFR01000136.1 GCA001435215_00962 gene open 182812-183327 nrdR
4432 AZFR01000136.1 GCA001435215_00963 gene open 183349-184752 dnaB
4433 AZFR01000136.1 GCA001435215_00964 gene open 184756-185691 dnaI
4434 AZFR01000136.1 GCA001435215_00965 gene open 185922-187988 thrS
4435 AZFR01000136.1 GCA001435215_00966 gene open 188231-188731 infC
4436 AZFR01000136.1 GCA001435215_00967 gene open 188753-188947 rpmI
4437 AZFR01000136.1 GCA001435215_00968 gene open 188984-189340 rplT
4438 AZFR01000136.1 GCA001435215_00969 gene open 189584-189895
4439 AZFR01000136.1 GCA001435215_00970 gene open 190063-191325 rarA
4440 AZFR01000136.1 GCA001435215_00971 gene open 192057-192461
4441 AZFR01000136.1 GCA001435215_00972 gene open 192833-193582
4442 AZFR01000136.1 GCA001435215_00973 gene open 194914-195864 cas1e
4443 AZFR01000136.1 GCA001435215_00974 gene open 195861-196751 cas2e
4444 AZFR01000136.1 GCA001435215_00975 gene open 197750-200497
4445 AZFR01000136.1 GCA001435215_00976 gene open 200503-202233
4446 AZFR01000136.1 GCA001435215_00977 gene open 202247-202852 casB
4447 AZFR01000136.1 GCA001435215_00978 gene open 202852-203931 cas7e
4448 AZFR01000136.1 GCA001435215_00979 gene open 203912-204619 cas5e
4449 AZFR01000136.1 GCA001435215_00980 gene open 204633-205304 cas6e
4450 AZFR01000136.1 GCA001435215_00981 gene open 206034-207347 bcsA
4451 AZFR01000136.1 GCA001435215_00982 gene open 207351-207833
4452 AZFR01000136.1 GCA001435215_00983 gene open 208474-209004 yqeG
4453 AZFR01000136.1 GCA001435215_00984 gene open 209001-210137 yqeH
4454 AZFR01000136.1 GCA001435215_00985 gene open 210208-210522 yhbY
4455 AZFR01000136.1 GCA001435215_00986 gene open 210535-211170 nadD
4456 AZFR01000136.1 GCA001435215_00987 gene open 211154-211771 yqeK
4457 AZFR01000136.1 GCA001435215_00988 gene open 211789-212145 rsfS
4458 AZFR01000136.1 GCA001435215_00989 gene open 212142-212876 ubiG
4459 AZFR01000136.1 GCA001435215_00990 gene open 212890-214041 tmcAL
4460 AZFR01000136.1 GCA001435215_00991 gene open 214166-214720 yceD
4461 AZFR01000136.1 GCA001435215_00992 gene open 215249-215833 ykoI
4462 AZFR01000136.1 GCA001435215_00993 gene open 215969-216931 fieF
4463 AZFR01000136.1 GCA001435215_00994 gene open 217326-218762 gndA
4464 AZFR01000136.1 GCA001435215_00995 gene open 218931-220280 rarA
4465 AZFR01000136.1 GCA001435215_00996 gene open 220471-221157 ompR
4466 AZFR01000136.1 GCA001435215_00997 gene open 221157-222800 walK
4467 AZFR01000136.1 GCA001435215_00998 gene open 223161-224129
4468 AZFR01000136.1 GCA001435215_00999 gene open 224268-227453 sbcC
4469 AZFR01000136.1 GCA001435215_01000 gene open 227456-228637 sbcD
4470 AZFR01000136.1 GCA001435215_01001 gene open 229117-230742
4471 AZFR01000136.1 GCA001435215_01002 gene open 230756-231076
4472 AZFR01000136.1 GCA001435215_01003 gene open 231489-232067 sdpI
4473 AZFR01000136.1 GCA001435215_01004 gene open 232214-233137 yidC1
4474 AZFR01000136.1 GCA001435215_01005 gene open 233201-233473 acyP
4475 AZFR01000136.1 GCA001435215_01006 gene open 233740-234507 spoU
4476 AZFR01000136.1 GCA001435215_01007 gene open 234608-235117 rnaY
4477 AZFR01000136.1 GCA001435215_01008 gene open 235140-235499 hxlR
4478 AZFR01000136.1 GCA001435215_01009 gene open 235827-236873 pheS
4479 AZFR01000136.1 GCA001435215_01010 gene open 236882-239299 pheT
4480 AZFR01000136.1 GCA001435215_01011 gene open 239461-240651 mltG
4481 AZFR01000136.1 GCA001435215_01012 gene open 240670-241299 udk
4482 AZFR01000136.1 GCA001435215_01013 gene open 241409-241891 greA
4483 AZFR01000136.1 GCA001435215_01014 gene open 243025-243747 liaF
4484 AZFR01000136.1 GCA001435215_01015 gene open 243748-244203 lytTR
4485 AZFR01000136.1 GCA001435215_01016 gene open 244388-244690 yneR
4486 AZFR01000136.1 GCA001435215_01017 gene open 244807-247452 yfhO
4487 AZFR01000136.1 GCA001435215_01018 gene open 247652-249688 ftsI
4488 AZFR01000136.1 GCA001435215_01019 gene open 249814-249963 rpmG
4489 AZFR01000136.1 GCA001435215_01020 gene open 250111-250677 fAU1
4490 AZFR01000136.1 GCA001435215_01021 gene open 250664-251347
4491 AZFR01000136.1 GCA001435215_01022 gene open 251366-251587 yqgQ
4492 AZFR01000136.1 GCA001435215_01023 gene open 251605-252567 nagC
4493 AZFR01000136.1 GCA001435215_01024 gene open 252838-253473 pepE
4494 AZFR01000136.1 GCA001435215_01025 gene open 253701-254114 pspE
4495 AZFR01000136.1 GCA001435215_01026 gene open 254164-254340
4496 AZFR01000136.1 GCA001435215_01027 gene open 254439-255173 ugpQ
4497 AZFR01000136.1 GCA001435215_01028 gene open 255178-256113 miaA
4498 AZFR01000136.1 GCA001435215_01029 gene open 256225-256605 soxR
4499 AZFR01000136.1 GCA001435215_01030 gene open 256649-257995 glnA
4500 AZFR01000136.1 GCA001435215_01031 gene open 258178-259065 sbcC