HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium animalis (GCA_001546435.1)

Select a Genome:
BAKTA Annotations for GCA_001546435.1
Genome Selected: Fusobacterium animalis
ContigsBases CDSrRNA tmRNAtRNA
199 2392347 2313 4 1 9
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4688 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4688 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 KQ956795.1 GCA001546435_02239 gene open 18565-19395 cfbC
4502 KQ956795.1 GCA001546435_02240 gene open 19398-21053 cfbD
4503 KQ956795.1 GCA001546435_02241 gene open 21076-22128
4504 KQ956795.1 GCA001546435_02242 gene open 22145-23140 fepD
4505 KQ956795.1 GCA001546435_02243 gene open 23143-23928 fepC
4506 KQ956795.1 GCA001546435_02244 gene open 24061-25116 afuA
4507 KQ956795.1 GCA001546435_02245 gene open 25135-26817
4508 KQ956795.1 GCA001546435_02246 gene open 26832-27902 malK
4509 KQ956795.1 GCA001546435_02247 gene open 28153-30339 nrdD
4510 KQ956795.1 GCA001546435_02248 gene open 30344-30850 nrdG
4511 KQ956796.1 repeat_region open 8636-8938 CRISPR array with 5 repeats of length 31%2C consensus sequence AATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 34
4512 KQ956796.1 repeat_region open 9095-9332 CRISPR array with 4 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 35
4513 KQ956796.1 repeat_region open 9524-9760 CRISPR array with 4 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 35
4514 KQ956796.1 repeat_region open 9924-10296 CRISPR array with 6 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 36
4515 KQ956796.1 repeat_region open 10449-10686 CRISPR array with 4 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 36
4516 KQ956796.1 repeat_region open 10842-11078 CRISPR array with 4 repeats of length 31%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAATA and spacer length 34
4517 KQ956796.1 repeat_region open 11236-11473 CRISPR array with 4 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 35
4518 KQ956796.1 repeat_region open 11633-12394 CRISPR array with 12 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 35
4519 KQ956796.1 repeat_region open 12559-12926 CRISPR array with 6 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 35
4520 KQ956796.1 repeat_region open 13152-13511 CRISPR array with 6 repeats of length 30%2C consensus sequence ATGAACTAAAAACTTGAAAAGTTTTGAAAT and spacer length 36
4521 KQ956796.1 GCA001546435_02249 CDS open 2-445 _na     147_aa hypothetical protein
4522 KQ956796.1 GCA001546435_02250 CDS open 460-2187 _na     575_aa CRISPR-associated protein Csh1
4523 KQ956796.1 GCA001546435_02251 CDS open 2187-3134 _na     315_aa CRISPR-associated protein
4524 KQ956796.1 GCA001546435_02252 CDS open 3137-3907 _na     256_aa cas5b type I-B CRISPR-associated protein Cas5b
4525 KQ956796.1 GCA001546435_02253 CDS open 3977-6514 _na     845_aa CRISPR-associated helicase/endonuclease Cas3
4526 KQ956796.1 GCA001546435_02254 CDS open 6525-7013 _na     162_aa cas4 CRISPR-associated protein Cas4
4527 KQ956796.1 GCA001546435_02255 CDS open 7025-8023 _na     332_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
4528 KQ956796.1 GCA001546435_02256 CDS open 8042-8326 _na     94_aa cas2 CRISPR-associated endonuclease Cas2
4529 KQ956796.1 GCA001546435_02249 gene open 2-445
4530 KQ956796.1 GCA001546435_02250 gene open 460-2187
4531 KQ956796.1 GCA001546435_02251 gene open 2187-3134
4532 KQ956796.1 GCA001546435_02252 gene open 3137-3907 cas5b
4533 KQ956796.1 GCA001546435_02253 gene open 3977-6514
4534 KQ956796.1 GCA001546435_02254 gene open 6525-7013 cas4
4535 KQ956796.1 GCA001546435_02255 gene open 7025-8023 cas1b
4536 KQ956796.1 GCA001546435_02256 gene open 8042-8326 cas2
4537 KQ956797.1 GCA001546435_02257 CDS open 50-319 _na     89_aa Txe/YoeB family addiction module toxin
4538 KQ956797.1 GCA001546435_02258 CDS open 303-563 _na     86_aa Antitoxin
4539 KQ956797.1 GCA001546435_02259 CDS open 762-1544 _na     260_aa Outer membrane protein
4540 KQ956797.1 GCA001546435_02260 CDS open 1563-2249 _na     228_aa ybhL Inner membrane protein YbhL
4541 KQ956797.1 GCA001546435_02261 CDS open 2275-4773 _na     832_aa Carrier domain-containing protein
4542 KQ956797.1 GCA001546435_02262 CDS open 4785-4934 _na     49_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4543 KQ956797.1 GCA001546435_02263 CDS open 4943-5263 _na     106_aa ttcA tRNA(Ile)-lysidine/2-thiocytidine synthase N-terminal domain-containing protein
4544 KQ956797.1 GCA001546435_02257 gene open 50-319
4545 KQ956797.1 GCA001546435_02258 gene open 303-563
4546 KQ956797.1 GCA001546435_02259 gene open 762-1544
4547 KQ956797.1 GCA001546435_02260 gene open 1563-2249 ybhL
4548 KQ956797.1 GCA001546435_02261 gene open 2275-4773
4549 KQ956797.1 GCA001546435_02262 gene open 4785-4934
4550 KQ956797.1 GCA001546435_02263 gene open 4943-5263 ttcA
4551 KQ956798.1 repeat_region open 6527-6770 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTGAGAGTAATGTTATTTTAAATAGATTCAAAAC and spacer length 30
4552 KQ956798.1 repeat_region open 6919-7182 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTGAGAGTAATGTTATTTTAAATAGATTCAAAAC and spacer length 30
4553 KQ956798.1 GCA001546435_02264 CDS open 280-4383 _na     1367_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
4554 KQ956798.1 GCA001546435_02265 CDS open 4406-5284 _na     292_aa cas1 type II CRISPR-associated endonuclease Cas1
4555 KQ956798.1 GCA001546435_02266 CDS open 5289-5594 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
4556 KQ956798.1 GCA001546435_02267 CDS open 5591-6253 _na     220_aa csn2 type II-A CRISPR-associated protein Csn2
4557 KQ956798.1 GCA001546435_02268 CDS open 7269-7658 _na     129_aa Lipoprotein
4558 KQ956798.1 GCA001546435_02269 CDS open 7868-8371 _na     167_aa Flavodoxin
4559 KQ956798.1 GCA001546435_02270 CDS open 8385-9089 _na     234_aa tcdA THIF-type NAD/FAD binding fold domain-containing protein
4560 KQ956798.1 GCA001546435_02271 CDS open 9286-9795 _na     169_aa Zeta toxin domain-containing protein
4561 KQ956798.1 GCA001546435_02272 CDS open 9795-9971 _na     58_aa hypothetical protein
4562 KQ956798.1 GCA001546435_02273 CDS open 9992-10711 _na     239_aa Fido domain-containing protein
4563 KQ956798.1 GCA001546435_02274 CDS open 10838-11524 _na     228_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
4564 KQ956798.1 GCA001546435_02275 CDS open 11540-12073 _na     177_aa Lipoprotein
4565 KQ956798.1 GCA001546435_02276 CDS open 12091-13278 _na     395_aa nucleotidyltransferase
4566 KQ956798.1 GCA001546435_02277 CDS open 13381-14619 _na     412_aa pepT peptidase T
4567 KQ956798.1 GCA001546435_02278 CDS open 14626-16326 _na     566_aa ygiQ YgiQ family radical SAM protein
4568 KQ956798.1 GCA001546435_02264 gene open 280-4383 cas9
4569 KQ956798.1 GCA001546435_02265 gene open 4406-5284 cas1
4570 KQ956798.1 GCA001546435_02266 gene open 5289-5594 cas2
4571 KQ956798.1 GCA001546435_02267 gene open 5591-6253 csn2
4572 KQ956798.1 GCA001546435_02268 gene open 7269-7658
4573 KQ956798.1 GCA001546435_02269 gene open 7868-8371
4574 KQ956798.1 GCA001546435_02270 gene open 8385-9089 tcdA
4575 KQ956798.1 GCA001546435_02271 gene open 9286-9795
4576 KQ956798.1 GCA001546435_02272 gene open 9795-9971
4577 KQ956798.1 GCA001546435_02273 gene open 9992-10711
4578 KQ956798.1 GCA001546435_02274 gene open 10838-11524 gpmA
4579 KQ956798.1 GCA001546435_02275 gene open 11540-12073
4580 KQ956798.1 GCA001546435_02276 gene open 12091-13278
4581 KQ956798.1 GCA001546435_02277 gene open 13381-14619 pepT
4582 KQ956798.1 GCA001546435_02278 gene open 14626-16326 ygiQ
4583 KQ956799.1 GCA001546435_02279 CDS open 1560-1973 _na     137_aa hypothetical protein
4584 KQ956799.1 GCA001546435_02279 gene open 1560-1973
4585 KQ956800.1 GCA001546435_02280 CDS open 461-1630 _na     389_aa macA Macrolide-specific efflux protein MacA
4586 KQ956800.1 GCA001546435_02281 CDS open 2378-3028 _na     216_aa trmR tRNA 5-hydroxyuridine methyltransferase
4587 KQ956800.1 GCA001546435_02282 CDS open 3022-4329 _na     435_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
4588 KQ956800.1 GCA001546435_02283 CDS open 4431-5441 _na     336_aa pxpC Carboxyltransferase domain-containing protein
4589 KQ956800.1 GCA001546435_02284 CDS open 5434-6183 _na     249_aa pxpB 5-oxoprolinase subunit PxpB
4590 KQ956800.1 GCA001546435_02285 CDS open 6206-7393 _na     395_aa mntH Transporter%2C branched chain amino acid:cation symporter (LIVCS) family protein
4591 KQ956800.1 GCA001546435_02286 CDS open 7407-8180 _na     257_aa pxpA 5-oxoprolinase subunit A
4592 KQ956800.1 GCA001546435_02288 CDS open 8645-9757 _na     370_aa Bacteriophage integrase
4593 KQ956800.1 GCA001546435_02289 CDS open 9882-10730 _na     282_aa dinD DNA damage-inducible protein D
4594 KQ956800.1 GCA001546435_02290 CDS open 10825-11223 _na     132_aa DUF1456 domain-containing protein
4595 KQ956800.1 GCA001546435_02291 CDS open 11239-12114 _na     291_aa hypothetical protein
4596 KQ956800.1 GCA001546435_02292 CDS open 12126-12422 _na     98_aa DNA-binding helix-turn-helix protein
4597 KQ956800.1 GCA001546435_02293 CDS open 12684-12869 _na     61_aa Toxin-antitoxin system%2C antitoxin component%2C Xre family
4598 KQ956800.1 GCA001546435_02294 CDS open 12887-13621 _na     244_aa Phage antirepressor protein
4599 KQ956800.1 GCA001546435_02295 CDS open 13633-13956 _na     107_aa hypothetical protein
4600 KQ956800.1 GCA001546435_02296 CDS open 13971-14204 _na     77_aa hypothetical protein
4601 KQ956800.1 GCA001546435_02297 CDS open 14219-14347 _na     42_aa hypothetical protein
4602 KQ956800.1 GCA001546435_02298 CDS open 14337-14468 _na     43_aa hypothetical protein
4603 KQ956800.1 GCA001546435_02299 CDS open 14478-14663 _na     61_aa Helix-turn-helix domain-containing protein
4604 KQ956800.1 GCA001546435_02300 CDS open 14660-14761 _na     33_aa hypothetical protein
4605 KQ956800.1 GCA001546435_02301 CDS open 14827-15159 _na     110_aa hypothetical protein
4606 KQ956800.1 GCA001546435_02302 CDS open 15173-15511 _na     112_aa DUF4440 domain-containing protein
4607 KQ956800.1 GCA001546435_02303 CDS open 15495-15794 _na     99_aa TRASH domain-containing protein
4608 KQ956800.1 GCA001546435_02304 CDS open 15791-16018 _na     75_aa Phage protein
4609 KQ956800.1 GCA001546435_02305 CDS open 16022-16627 _na     201_aa HNH nuclease domain-containing protein
4610 KQ956800.1 GCA001546435_02306 CDS open 16624-17352 _na     242_aa DNA polymerase III subunit beta
4611 KQ956800.1 GCA001546435_02307 CDS open 17368-17553 _na     61_aa copG Ribbon-helix-helix protein CopG domain-containing protein
4612 KQ956800.1 GCA001546435_02308 CDS open 17553-18059 _na     168_aa Siphovirus Gp157 family protein
4613 KQ956800.1 GCA001546435_02309 CDS open 18069-18644 _na     191_aa Exonuclease
4614 KQ956800.1 GCA001546435_02310 CDS open 18650-19303 _na     217_aa ATP-binding protein
4615 KQ956800.1 GCA001546435_02311 CDS open 19322-19909 _na     195_aa DUF669 domain-containing protein
4616 KQ956800.1 GCA001546435_02312 CDS open 19922-22207 _na     761_aa Toprim domain-containing protein
4617 KQ956800.1 GCA001546435_02313 CDS open 22607-22780 _na     57_aa hypothetical protein
4618 KQ956800.1 GCA001546435_02314 CDS open 22793-23566 _na     257_aa ruvC Holliday junction resolvase RuvC
4619 KQ956800.1 GCA001546435_02315 CDS open 23570-24004 _na     144_aa DUF3310 domain-containing protein
4620 KQ956800.1 GCA001546435_02316 CDS open 24009-24476 _na     155_aa Dynein heavy chain 2
4621 KQ956800.1 GCA001546435_02317 CDS open 24620-24844 _na     74_aa hypothetical protein
4622 KQ956800.1 GCA001546435_02318 CDS open 24828-25109 _na     93_aa hypothetical protein
4623 KQ956800.1 GCA001546435_02319 CDS open 25096-25584 _na     162_aa yopX YopX protein domain-containing protein
4624 KQ956800.1 GCA001546435_02320 CDS open 25587-25850 _na     87_aa Phage protein
4625 KQ956800.1 GCA001546435_02321 CDS open 25831-26124 _na     97_aa Phage protein
4626 KQ956800.1 GCA001546435_02322 CDS open 26124-26636 _na     170_aa dUTP diphosphatase
4627 KQ956800.1 GCA001546435_02323 CDS open 26636-27079 _na     147_aa Transcriptional regulator
4628 KQ956800.1 GCA001546435_02324 CDS open 27441-27791 _na     116_aa chaN Haem-binding uptake Tiki superfamily ChaN domain-containing protein
4629 KQ956800.1 GCA001546435_02325 CDS open 27809-28249 _na     146_aa Terminase small subunit
4630 KQ956800.1 GCA001546435_02326 CDS open 28242-29516 _na     424_aa PBSX family phage terminase large subunit
4631 KQ956800.1 GCA001546435_02327 CDS open 29529-30845 _na     438_aa phage portal protein
4632 KQ956800.1 GCA001546435_02328 CDS open 30829-32253 _na     474_aa Phage protein F-like protein
4633 KQ956800.1 GCA001546435_02329 CDS open 32256-32501 _na     81_aa hypothetical protein
4634 KQ956800.1 GCA001546435_02330 CDS open 32671-33246 _na     191_aa DUF4355 domain-containing protein
4635 KQ956800.1 GCA001546435_02331 CDS open 33248-34096 _na     282_aa N4-gp56 family major capsid protein
4636 KQ956800.1 GCA001546435_02280 gene open 461-1630 macA
4637 KQ956800.1 GCA001546435_02281 gene open 2378-3028 trmR
4638 KQ956800.1 GCA001546435_02282 gene open 3022-4329 rsmB
4639 KQ956800.1 GCA001546435_02283 gene open 4431-5441 pxpC
4640 KQ956800.1 GCA001546435_02284 gene open 5434-6183 pxpB
4641 KQ956800.1 GCA001546435_02285 gene open 6206-7393 mntH
4642 KQ956800.1 GCA001546435_02286 gene open 7407-8180 pxpA
4643 KQ956800.1 GCA001546435_02288 gene open 8645-9757
4644 KQ956800.1 GCA001546435_02289 gene open 9882-10730 dinD
4645 KQ956800.1 GCA001546435_02290 gene open 10825-11223
4646 KQ956800.1 GCA001546435_02291 gene open 11239-12114
4647 KQ956800.1 GCA001546435_02292 gene open 12126-12422
4648 KQ956800.1 GCA001546435_02293 gene open 12684-12869
4649 KQ956800.1 GCA001546435_02294 gene open 12887-13621
4650 KQ956800.1 GCA001546435_02295 gene open 13633-13956
4651 KQ956800.1 GCA001546435_02296 gene open 13971-14204
4652 KQ956800.1 GCA001546435_02297 gene open 14219-14347
4653 KQ956800.1 GCA001546435_02298 gene open 14337-14468
4654 KQ956800.1 GCA001546435_02299 gene open 14478-14663
4655 KQ956800.1 GCA001546435_02300 gene open 14660-14761
4656 KQ956800.1 GCA001546435_02301 gene open 14827-15159
4657 KQ956800.1 GCA001546435_02302 gene open 15173-15511
4658 KQ956800.1 GCA001546435_02303 gene open 15495-15794
4659 KQ956800.1 GCA001546435_02304 gene open 15791-16018
4660 KQ956800.1 GCA001546435_02305 gene open 16022-16627
4661 KQ956800.1 GCA001546435_02306 gene open 16624-17352
4662 KQ956800.1 GCA001546435_02307 gene open 17368-17553 copG
4663 KQ956800.1 GCA001546435_02308 gene open 17553-18059
4664 KQ956800.1 GCA001546435_02309 gene open 18069-18644
4665 KQ956800.1 GCA001546435_02310 gene open 18650-19303
4666 KQ956800.1 GCA001546435_02311 gene open 19322-19909
4667 KQ956800.1 GCA001546435_02312 gene open 19922-22207
4668 KQ956800.1 GCA001546435_02313 gene open 22607-22780
4669 KQ956800.1 GCA001546435_02314 gene open 22793-23566 ruvC
4670 KQ956800.1 GCA001546435_02315 gene open 23570-24004
4671 KQ956800.1 GCA001546435_02316 gene open 24009-24476
4672 KQ956800.1 GCA001546435_02317 gene open 24620-24844
4673 KQ956800.1 GCA001546435_02318 gene open 24828-25109
4674 KQ956800.1 GCA001546435_02319 gene open 25096-25584 yopX
4675 KQ956800.1 GCA001546435_02320 gene open 25587-25850
4676 KQ956800.1 GCA001546435_02321 gene open 25831-26124
4677 KQ956800.1 GCA001546435_02322 gene open 26124-26636
4678 KQ956800.1 GCA001546435_02323 gene open 26636-27079
4679 KQ956800.1 GCA001546435_02324 gene open 27441-27791 chaN
4680 KQ956800.1 GCA001546435_02325 gene open 27809-28249
4681 KQ956800.1 GCA001546435_02326 gene open 28242-29516
4682 KQ956800.1 GCA001546435_02327 gene open 29529-30845
4683 KQ956800.1 GCA001546435_02328 gene open 30829-32253
4684 KQ956800.1 GCA001546435_02329 gene open 32256-32501
4685 KQ956800.1 GCA001546435_02330 gene open 32671-33246
4686 KQ956800.1 GCA001546435_02331 gene open 33248-34096
4687 KQ956800.1 GCA001546435_02287 gene open 8396-8472 trnR
4688 KQ956800.1 GCA001546435_02287 tRNA open 8396-8472 trnR tRNA-Arg(tcg)