BAKTAGenome Explorer: Enterococcus casseliflavus (GCA_001558875.2)
Select a Genome:
|
BAKTA Annotations for GCA_001558875.2
|
Search & Sort all 7210 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 7001 | CP014067.2 | GCA001558875_02008 | tRNA | open | 2144020-2144092 | trnA | tRNA-Ala(tgc) | |
| 7002 | CP014067.2 | GCA001558875_02011 | tRNA | open | 2147395-2147468 | trnN | tRNA-Asn(gtt) | |
| 7003 | CP014067.2 | GCA001558875_02012 | tRNA | open | 2147517-2147605 | trnS | tRNA-Ser(gga) | |
| 7004 | CP014067.2 | GCA001558875_02013 | tRNA | open | 2147617-2147688 | trnE | tRNA-Glu(ttc) | |
| 7005 | CP014067.2 | GCA001558875_02014 | tRNA | open | 2147712-2147784 | trnV | tRNA-Val(tac) | |
| 7006 | CP014067.2 | GCA001558875_02015 | tRNA | open | 2147789-2147862 | trnD | tRNA-Asp(gtc) | |
| 7007 | CP014067.2 | GCA001558875_02016 | tRNA | open | 2147899-2147974 | trnF | tRNA-Phe(gaa) | |
| 7008 | CP014067.2 | GCA001558875_02017 | tRNA | open | 2147976-2148056 | trnY | tRNA-Tyr(gta) | |
| 7009 | CP014067.2 | GCA001558875_02018 | tRNA | open | 2148062-2148135 | trnW | tRNA-Trp(cca) | |
| 7010 | CP014067.2 | GCA001558875_02019 | tRNA | open | 2148164-2148236 | trnH | tRNA-His(gtg) | |
| 7011 | CP014067.2 | GCA001558875_02020 | tRNA | open | 2148247-2148318 | trnQ | tRNA-Gln(ttg) | |
| 7012 | CP014067.2 | GCA001558875_02021 | tRNA | open | 2148360-2148430 | trnC | tRNA-Cys(gca) | |
| 7013 | CP014067.2 | GCA001558875_02022 | tRNA | open | 2148458-2148542 | trnL | tRNA-Leu(caa) | |
| 7014 | CP014067.2 | GCA001558875_02142 | tRNA | open | 2264936-2265007 | trnR | tRNA-Arg(cct) | |
| 7015 | CP014067.2 | GCA001558875_02375 | tRNA | open | 2529154-2529236 | trnL | tRNA-Leu(gag) | |
| 7016 | CP014067.2 | GCA001558875_03103 | tRNA | open | 3281619-3281692 | trnR | tRNA-Arg(tct) | |
| 7017 | CP014067.2 | GCA001558875_03461 | tRNA | open | 3695312-3695393 | trnL | tRNA-Leu(cag) | |
| 7018 | CP014068.2 | GCA001558875_03495 | gene | open | 2674-2851 | RefB11 | ||
| 7019 | CP014068.2 | GCA001558875_03507 | gene | open | 8776-8873 | drum | ||
| 7020 | CP014068.2 | GCA001558875_03558 | gene | open | 57417-57600 | rli28 | ||
| 7021 | CP014068.2 | GCA001558875_03560 | gene | open | 57665-57750 | ratA | ||
| 7022 | CP014068.2 | GCA001558875_03495 | ncRNA | open | 2674-2851 | Enterococcus sRNA B11 | ||
| 7023 | CP014068.2 | GCA001558875_03507 | ncRNA | open | 8776-8873 | drum RNA | ||
| 7024 | CP014068.2 | GCA001558875_03558 | ncRNA | open | 57417-57600 | Listeria sRNA rli28 | ||
| 7025 | CP014068.2 | GCA001558875_03560 | ncRNA | open | 57665-57750 | ratA | RNA anti-toxin A | |
| 7026 | CP014068.2 | repeat_region | open | 22381-22589 | CRISPR array with 3 repeats of length 41%2C consensus sequence CATATTTGTGACACTTGACGTATCCCATGAACTGACATCAA and spacer length 38 | |||
| 7027 | CP014068.2 | GCA001558875_03492 | CDS | open | 2-1327 | _na 441_aa | Y-family DNA polymerase | |
| 7028 | CP014068.2 | GCA001558875_03493 | CDS | open | 1311-1814 | _na 167_aa | hypothetical protein | |
| 7029 | CP014068.2 | GCA001558875_03494 | CDS | open | 1907-2494 | _na 195_aa | Abasic site processing protein | |
| 7030 | CP014068.2 | GCA001558875_03496 | CDS | open | 2721-2822 | _na 33_aa | Type I toxin-antitoxin system Fst family toxin | |
| 7031 | CP014068.2 | GCA001558875_03497 | CDS | open | 3167-3412 | _na 81_aa | hypothetical protein | |
| 7032 | CP014068.2 | GCA001558875_03498 | CDS | open | 3653-4267 | _na 204_aa | spoIVCA | Transposon Tn552 DNA-invertase bin3 |
| 7033 | CP014068.2 | GCA001558875_03499 | CDS | open | 4534-5223 | _na 229_aa | TIR domain-containing protein | |
| 7034 | CP014068.2 | GCA001558875_03501 | CDS | open | 6219-6461 | _na 80_aa | Transcriptional regulator | |
| 7035 | CP014068.2 | GCA001558875_03502 | CDS | open | 6910-7152 | _na 80_aa | hypothetical protein | |
| 7036 | CP014068.2 | GCA001558875_03503 | CDS | open | 7281-7586 | _na 101_aa | hypothetical protein | |
| 7037 | CP014068.2 | GCA001558875_03504 | CDS | open | 7673-7888 | _na 71_aa | DUF2187 domain-containing protein | |
| 7038 | CP014068.2 | GCA001558875_03505 | CDS | open | 7956-8156 | _na 66_aa | Cold shock-like protein CspLA | |
| 7039 | CP014068.2 | GCA001558875_03506 | CDS | open | 8548-8721 | _na 57_aa | Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein | |
| 7040 | CP014068.2 | GCA001558875_03508 | CDS | open | 9153-9845 | _na 230_aa | Fido domain-containing protein | |
| 7041 | CP014068.2 | GCA001558875_03509 | CDS | open | 9894-10493 | _na 199_aa | Tyr recombinase domain-containing protein | |
| 7042 | CP014068.2 | GCA001558875_03510 | CDS | open | 11313-11528 | _na 71_aa | DUF2187 domain-containing protein | |
| 7043 | CP014068.2 | GCA001558875_03511 | CDS | open | 11595-11795 | _na 66_aa | cold-shock protein | |
| 7044 | CP014068.2 | GCA001558875_03512 | CDS | open | 12092-12241 | _na 49_aa | Phage protein | |
| 7045 | CP014068.2 | GCA001558875_03513 | CDS | open | 12317-12520 | _na 67_aa | hypothetical protein | |
| 7046 | CP014068.2 | GCA001558875_03514 | CDS | open | 13761-14315 | _na 184_aa | Lipoprotein | |
| 7047 | CP014068.2 | GCA001558875_03515 | CDS | open | 14332-15537 | _na 401_aa | ABC transporter permease | |
| 7048 | CP014068.2 | GCA001558875_03516 | CDS | open | 15534-16208 | _na 224_aa | ABC transporter domain-containing protein | |
| 7049 | CP014068.2 | GCA001558875_03517 | CDS | open | 16192-17433 | _na 413_aa | hlyD | HlyD family secretion protein |
| 7050 | CP014068.2 | GCA001558875_03518 | CDS | open | 17661-18794 | _na 377_aa | histidine kinase | |
| 7051 | CP014068.2 | GCA001558875_03519 | CDS | open | 18821-19498 | _na 225_aa | vanR | Two-component system response regulator VanR |
| 7052 | CP014068.2 | GCA001558875_03520 | CDS | open | 25119-25532 | _na 137_aa | Phage envelope protein | |
| 7053 | CP014068.2 | GCA001558875_03521 | CDS | open | 25751-26122 | _na 123_aa | DUF7006 domain-containing protein | |
| 7054 | CP014068.2 | GCA001558875_03522 | CDS | open | 26182-27663 | _na 493_aa | M protein trans-acting positive regulator | |
| 7055 | CP014068.2 | GCA001558875_03523 | CDS | open | 27709-28995 | _na 428_aa | Cation transport ATPase | |
| 7056 | CP014068.2 | GCA001558875_03524 | CDS | open | 29058-33698 | _na 1546_aa | WxL domain-containing protein | |
| 7057 | CP014068.2 | GCA001558875_03525 | CDS | open | 33723-34757 | _na 344_aa | Cell surface protein | |
| 7058 | CP014068.2 | GCA001558875_03526 | CDS | open | 34853-35653 | _na 266_aa | WxL domain-containing protein | |
| 7059 | CP014068.2 | GCA001558875_03527 | CDS | open | 35676-35987 | _na 103_aa | LPXTG cell wall anchor domain-containing protein | |
| 7060 | CP014068.2 | GCA001558875_03528 | CDS | open | 36657-37052 | _na 131_aa | DUF7006 domain-containing protein | |
| 7061 | CP014068.2 | GCA001558875_03529 | CDS | open | 37117-38610 | _na 497_aa | M protein trans-acting positive regulator | |
| 7062 | CP014068.2 | GCA001558875_03530 | CDS | open | 38652-39935 | _na 427_aa | helix-turn-helix domain-containing protein | |
| 7063 | CP014068.2 | GCA001558875_03531 | CDS | open | 39995-42994 | _na 999_aa | WxL domain-containing protein | |
| 7064 | CP014068.2 | GCA001558875_03532 | CDS | open | 42978-44039 | _na 353_aa | DUF916 DUF3324 domains-containing protein | |
| 7065 | CP014068.2 | GCA001558875_03533 | CDS | open | 44135-44935 | _na 266_aa | WxL domain-containing protein | |
| 7066 | CP014068.2 | GCA001558875_03534 | CDS | open | 44958-45266 | _na 102_aa | LPXTG cell wall anchor domain-containing protein | |
| 7067 | CP014068.2 | GCA001558875_03535 | CDS | open | 46018-46140 | _na 40_aa | hypothetical protein | |
| 7068 | CP014068.2 | GCA001558875_03536 | CDS | open | 46158-46655 | _na 165_aa | hypothetical protein | |
| 7069 | CP014068.2 | GCA001558875_03537 | CDS | open | 46985-47218 | _na 77_aa | hypothetical protein | |
| 7070 | CP014068.2 | GCA001558875_03538 | CDS | open | 47230-47499 | _na 89_aa | LIM zinc-binding domain-containing protein | |
| 7071 | CP014068.2 | GCA001558875_03539 | CDS | open | 47507-48169 | _na 220_aa | DUF2786 domain-containing protein | |
| 7072 | CP014068.2 | GCA001558875_03540 | CDS | open | 48177-48422 | _na 81_aa | hypothetical protein | |
| 7073 | CP014068.2 | GCA001558875_03541 | CDS | open | 48406-48588 | _na 60_aa | hypothetical protein | |
| 7074 | CP014068.2 | GCA001558875_03542 | CDS | open | 48748-49227 | _na 159_aa | hypothetical protein | |
| 7075 | CP014068.2 | GCA001558875_03543 | CDS | open | 49264-50088 | _na 274_aa | pcfJ | PcfJ domain-containing protein |
| 7076 | CP014068.2 | GCA001558875_03544 | CDS | open | 50085-50540 | _na 151_aa | PcfK-like protein | |
| 7077 | CP014068.2 | GCA001558875_03545 | CDS | open | 50605-51045 | _na 146_aa | MPN domain-containing protein | |
| 7078 | CP014068.2 | GCA001558875_03546 | CDS | open | 51633-52358 | _na 241_aa | Type VII secretion system protein EssD-like domain-containing protein | |
| 7079 | CP014068.2 | GCA001558875_03547 | CDS | open | 52416-52640 | _na 74_aa | hypothetical protein | |
| 7080 | CP014068.2 | GCA001558875_03548 | CDS | open | 52624-52740 | _na 38_aa | hypothetical protein | |
| 7081 | CP014068.2 | GCA001558875_03549 | CDS | open | 52685-52987 | _na 100_aa | Phage protein | |
| 7082 | CP014068.2 | GCA001558875_03550 | CDS | open | 53068-53829 | _na 253_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 7083 | CP014068.2 | GCA001558875_03551 | CDS | open | 53878-54117 | _na 79_aa | GIY-YIG domain-containing protein | |
| 7084 | CP014068.2 | GCA001558875_03552 | CDS | open | 54184-54510 | _na 108_aa | hypothetical protein | |
| 7085 | CP014068.2 | GCA001558875_03553 | CDS | open | 55048-55536 | _na 162_aa | Single-stranded DNA-binding protein | |
| 7086 | CP014068.2 | GCA001558875_03554 | CDS | open | 55567-55746 | _na 59_aa | hypothetical protein | |
| 7087 | CP014068.2 | GCA001558875_03555 | CDS | open | 55746-56024 | _na 92_aa | dksA | DksA C4-type domain-containing protein |
| 7088 | CP014068.2 | GCA001558875_03556 | CDS | open | 56103-56255 | _na 50_aa | hypothetical protein | |
| 7089 | CP014068.2 | GCA001558875_03557 | CDS | open | 56276-56800 | _na 174_aa | Large polyvalent protein associated domain-containing protein | |
| 7090 | CP014068.2 | GCA001558875_03559 | CDS | open | 57491-57634 | _na 47_aa | pepG1 | type I toxin-antitoxin system toxin PepG1 |
| 7091 | CP014068.2 | GCA001558875_03561 | CDS | open | 57937-58749 | _na 270_aa | replication-relaxation family protein | |
| 7092 | CP014068.2 | GCA001558875_03562 | CDS | open | 59487-61661 | _na 724_aa | Type VI secretion protein | |
| 7093 | CP014068.2 | GCA001558875_03563 | CDS | open | 61664-64009 | _na 781_aa | ytxH | YtxH domain-containing protein |
| 7094 | CP014068.2 | GCA001558875_03564 | CDS | open | 64023-66515 | _na 830_aa | Type VI secretion protein | |
| 7095 | CP014068.2 | GCA001558875_03565 | CDS | open | 66500-66925 | _na 141_aa | Conjugal transfer protein | |
| 7096 | CP014068.2 | GCA001558875_03566 | CDS | open | 66936-67199 | _na 87_aa | hypothetical protein | |
| 7097 | CP014068.2 | GCA001558875_03567 | CDS | open | 67230-68252 | _na 340_aa | Conjugal transfer protein | |
| 7098 | CP014068.2 | GCA001558875_03568 | CDS | open | 68245-68559 | _na 104_aa | hypothetical protein | |
| 7099 | CP014068.2 | GCA001558875_03569 | CDS | open | 68574-69209 | _na 211_aa | Nuclear transport factor 2 family protein | |
| 7100 | CP014068.2 | GCA001558875_03570 | CDS | open | 69227-70225 | _na 332_aa | Peptidase M23 | |
| 7101 | CP014068.2 | GCA001558875_03571 | CDS | open | 70222-71901 | _na 559_aa | FIVAR domain-containing protein | |
| 7102 | CP014068.2 | GCA001558875_03572 | CDS | open | 71918-72931 | _na 337_aa | Tetratricopeptide repeat protein | |
| 7103 | CP014068.2 | GCA001558875_03573 | CDS | open | 72944-73219 | _na 91_aa | hypothetical protein | |
| 7104 | CP014068.2 | GCA001558875_03574 | CDS | open | 73221-73658 | _na 145_aa | DUF2922 domain-containing protein | |
| 7105 | CP014068.2 | GCA001558875_03575 | CDS | open | 73728-75095 | _na 455_aa | N-acetylmuramoyl-L-alanine amidase | |
| 7106 | CP014068.2 | GCA001558875_03576 | CDS | open | 75292-78543 | _na 1083_aa | spaA | SpaA isopeptide-forming pilin-related protein |
| 7107 | CP014068.2 | GCA001558875_03577 | CDS | open | 78691-79524 | _na 277_aa | lysM | LysM domain-containing protein |
| 7108 | CP014068.2 | GCA001558875_03578 | CDS | open | 79664-79903 | _na 79_aa | Helix-turn-helix domain-containing protein | |
| 7109 | CP014068.2 | GCA001558875_03579 | CDS | open | 79927-80343 | _na 138_aa | hypothetical protein | |
| 7110 | CP014068.2 | GCA001558875_03580 | CDS | open | 80638-80862 | _na 74_aa | hypothetical protein | |
| 7111 | CP014068.2 | GCA001558875_03581 | CDS | open | 80828-81097 | _na 89_aa | hypothetical protein | |
| 7112 | CP014068.2 | GCA001558875_03582 | CDS | open | 81427-81846 | _na 139_aa | hypothetical protein | |
| 7113 | CP014068.2 | GCA001558875_03583 | CDS | open | 82890-83123 | _na 77_aa | hypothetical protein | |
| 7114 | CP014068.2 | GCA001558875_03584 | CDS | open | 83223-83375 | _na 50_aa | hypothetical protein | |
| 7115 | CP014068.2 | GCA001558875_03585 | CDS | open | 83503-83790 | _na 95_aa | prgN | type III secretion system protein PrgN |
| 7116 | CP014068.2 | GCA001558875_03586 | CDS | open | 83923-84957 | _na 344_aa | replication initiator protein A | |
| 7117 | CP014068.2 | GCA001558875_03587 | CDS | open | 85812-86237 | _na 141_aa | repC | Replication-associated protein RepC |
| 7118 | CP014068.2 | GCA001558875_03588 | CDS | open | 86255-87067 | _na 270_aa | Sporulation initiation inhibitor protein Soj | |
| 7119 | CP014068.2 | GCA001558875_03492 | gene | open | 2-1327 | |||
| 7120 | CP014068.2 | GCA001558875_03493 | gene | open | 1311-1814 | |||
| 7121 | CP014068.2 | GCA001558875_03494 | gene | open | 1907-2494 | |||
| 7122 | CP014068.2 | GCA001558875_03496 | gene | open | 2721-2822 | |||
| 7123 | CP014068.2 | GCA001558875_03497 | gene | open | 3167-3412 | |||
| 7124 | CP014068.2 | GCA001558875_03498 | gene | open | 3653-4267 | spoIVCA | ||
| 7125 | CP014068.2 | GCA001558875_03499 | gene | open | 4534-5223 | |||
| 7126 | CP014068.2 | GCA001558875_03501 | gene | open | 6219-6461 | |||
| 7127 | CP014068.2 | GCA001558875_03502 | gene | open | 6910-7152 | |||
| 7128 | CP014068.2 | GCA001558875_03503 | gene | open | 7281-7586 | |||
| 7129 | CP014068.2 | GCA001558875_03504 | gene | open | 7673-7888 | |||
| 7130 | CP014068.2 | GCA001558875_03505 | gene | open | 7956-8156 | |||
| 7131 | CP014068.2 | GCA001558875_03506 | gene | open | 8548-8721 | |||
| 7132 | CP014068.2 | GCA001558875_03508 | gene | open | 9153-9845 | |||
| 7133 | CP014068.2 | GCA001558875_03509 | gene | open | 9894-10493 | |||
| 7134 | CP014068.2 | GCA001558875_03510 | gene | open | 11313-11528 | |||
| 7135 | CP014068.2 | GCA001558875_03511 | gene | open | 11595-11795 | |||
| 7136 | CP014068.2 | GCA001558875_03512 | gene | open | 12092-12241 | |||
| 7137 | CP014068.2 | GCA001558875_03513 | gene | open | 12317-12520 | |||
| 7138 | CP014068.2 | GCA001558875_03514 | gene | open | 13761-14315 | |||
| 7139 | CP014068.2 | GCA001558875_03515 | gene | open | 14332-15537 | |||
| 7140 | CP014068.2 | GCA001558875_03516 | gene | open | 15534-16208 | |||
| 7141 | CP014068.2 | GCA001558875_03517 | gene | open | 16192-17433 | hlyD | ||
| 7142 | CP014068.2 | GCA001558875_03518 | gene | open | 17661-18794 | |||
| 7143 | CP014068.2 | GCA001558875_03519 | gene | open | 18821-19498 | vanR | ||
| 7144 | CP014068.2 | GCA001558875_03520 | gene | open | 25119-25532 | |||
| 7145 | CP014068.2 | GCA001558875_03521 | gene | open | 25751-26122 | |||
| 7146 | CP014068.2 | GCA001558875_03522 | gene | open | 26182-27663 | |||
| 7147 | CP014068.2 | GCA001558875_03523 | gene | open | 27709-28995 | |||
| 7148 | CP014068.2 | GCA001558875_03524 | gene | open | 29058-33698 | |||
| 7149 | CP014068.2 | GCA001558875_03525 | gene | open | 33723-34757 | |||
| 7150 | CP014068.2 | GCA001558875_03526 | gene | open | 34853-35653 | |||
| 7151 | CP014068.2 | GCA001558875_03527 | gene | open | 35676-35987 | |||
| 7152 | CP014068.2 | GCA001558875_03528 | gene | open | 36657-37052 | |||
| 7153 | CP014068.2 | GCA001558875_03529 | gene | open | 37117-38610 | |||
| 7154 | CP014068.2 | GCA001558875_03530 | gene | open | 38652-39935 | |||
| 7155 | CP014068.2 | GCA001558875_03531 | gene | open | 39995-42994 | |||
| 7156 | CP014068.2 | GCA001558875_03532 | gene | open | 42978-44039 | |||
| 7157 | CP014068.2 | GCA001558875_03533 | gene | open | 44135-44935 | |||
| 7158 | CP014068.2 | GCA001558875_03534 | gene | open | 44958-45266 | |||
| 7159 | CP014068.2 | GCA001558875_03535 | gene | open | 46018-46140 | |||
| 7160 | CP014068.2 | GCA001558875_03536 | gene | open | 46158-46655 | |||
| 7161 | CP014068.2 | GCA001558875_03537 | gene | open | 46985-47218 | |||
| 7162 | CP014068.2 | GCA001558875_03538 | gene | open | 47230-47499 | |||
| 7163 | CP014068.2 | GCA001558875_03539 | gene | open | 47507-48169 | |||
| 7164 | CP014068.2 | GCA001558875_03540 | gene | open | 48177-48422 | |||
| 7165 | CP014068.2 | GCA001558875_03541 | gene | open | 48406-48588 | |||
| 7166 | CP014068.2 | GCA001558875_03542 | gene | open | 48748-49227 | |||
| 7167 | CP014068.2 | GCA001558875_03543 | gene | open | 49264-50088 | pcfJ | ||
| 7168 | CP014068.2 | GCA001558875_03544 | gene | open | 50085-50540 | |||
| 7169 | CP014068.2 | GCA001558875_03545 | gene | open | 50605-51045 | |||
| 7170 | CP014068.2 | GCA001558875_03546 | gene | open | 51633-52358 | |||
| 7171 | CP014068.2 | GCA001558875_03547 | gene | open | 52416-52640 | |||
| 7172 | CP014068.2 | GCA001558875_03548 | gene | open | 52624-52740 | |||
| 7173 | CP014068.2 | GCA001558875_03549 | gene | open | 52685-52987 | |||
| 7174 | CP014068.2 | GCA001558875_03550 | gene | open | 53068-53829 | |||
| 7175 | CP014068.2 | GCA001558875_03551 | gene | open | 53878-54117 | |||
| 7176 | CP014068.2 | GCA001558875_03552 | gene | open | 54184-54510 | |||
| 7177 | CP014068.2 | GCA001558875_03553 | gene | open | 55048-55536 | |||
| 7178 | CP014068.2 | GCA001558875_03554 | gene | open | 55567-55746 | |||
| 7179 | CP014068.2 | GCA001558875_03555 | gene | open | 55746-56024 | dksA | ||
| 7180 | CP014068.2 | GCA001558875_03556 | gene | open | 56103-56255 | |||
| 7181 | CP014068.2 | GCA001558875_03557 | gene | open | 56276-56800 | |||
| 7182 | CP014068.2 | GCA001558875_03559 | gene | open | 57491-57634 | pepG1 | ||
| 7183 | CP014068.2 | GCA001558875_03561 | gene | open | 57937-58749 | |||
| 7184 | CP014068.2 | GCA001558875_03562 | gene | open | 59487-61661 | |||
| 7185 | CP014068.2 | GCA001558875_03563 | gene | open | 61664-64009 | ytxH | ||
| 7186 | CP014068.2 | GCA001558875_03564 | gene | open | 64023-66515 | |||
| 7187 | CP014068.2 | GCA001558875_03565 | gene | open | 66500-66925 | |||
| 7188 | CP014068.2 | GCA001558875_03566 | gene | open | 66936-67199 | |||
| 7189 | CP014068.2 | GCA001558875_03567 | gene | open | 67230-68252 | |||
| 7190 | CP014068.2 | GCA001558875_03568 | gene | open | 68245-68559 | |||
| 7191 | CP014068.2 | GCA001558875_03569 | gene | open | 68574-69209 | |||
| 7192 | CP014068.2 | GCA001558875_03570 | gene | open | 69227-70225 | |||
| 7193 | CP014068.2 | GCA001558875_03571 | gene | open | 70222-71901 | |||
| 7194 | CP014068.2 | GCA001558875_03572 | gene | open | 71918-72931 | |||
| 7195 | CP014068.2 | GCA001558875_03573 | gene | open | 72944-73219 | |||
| 7196 | CP014068.2 | GCA001558875_03574 | gene | open | 73221-73658 | |||
| 7197 | CP014068.2 | GCA001558875_03575 | gene | open | 73728-75095 | |||
| 7198 | CP014068.2 | GCA001558875_03576 | gene | open | 75292-78543 | spaA | ||
| 7199 | CP014068.2 | GCA001558875_03577 | gene | open | 78691-79524 | lysM | ||
| 7200 | CP014068.2 | GCA001558875_03578 | gene | open | 79664-79903 | |||
| 7201 | CP014068.2 | GCA001558875_03579 | gene | open | 79927-80343 | |||
| 7202 | CP014068.2 | GCA001558875_03580 | gene | open | 80638-80862 | |||
| 7203 | CP014068.2 | GCA001558875_03581 | gene | open | 80828-81097 | |||
| 7204 | CP014068.2 | GCA001558875_03582 | gene | open | 81427-81846 | |||
| 7205 | CP014068.2 | GCA001558875_03583 | gene | open | 82890-83123 | |||
| 7206 | CP014068.2 | GCA001558875_03584 | gene | open | 83223-83375 | |||
| 7207 | CP014068.2 | GCA001558875_03585 | gene | open | 83503-83790 | prgN | ||
| 7208 | CP014068.2 | GCA001558875_03586 | gene | open | 83923-84957 | |||
| 7209 | CP014068.2 | GCA001558875_03587 | gene | open | 85812-86237 | repC | ||
| 7210 | CP014068.2 | GCA001558875_03588 | gene | open | 86255-87067 |

