HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus gordonii (GCA_001588775.1)

Select a Genome:
BAKTA Annotations for GCA_001588775.1
Genome Selected: Streptococcus gordonii
ContigsBases CDSrRNA tmRNAtRNA
50 2164498 2040 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4215 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4215 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 LAVZ01000022.1 GCA001588775_00952 CDS open 514-837 _na     107_aa Transposase
4002 LAVZ01000022.1 GCA001588775_00953 CDS open 905-1231 _na     108_aa IS3-Spn1
4003 LAVZ01000022.1 GCA001588775_00954 CDS open 1674-2519 _na     281_aa Alpha/beta hydrolase
4004 LAVZ01000022.1 GCA001588775_00955 CDS open 2694-3653 _na     319_aa Glucokinase
4005 LAVZ01000022.1 GCA001588775_00956 CDS open 3752-4591 _na     279_aa thyA thymidylate synthase
4006 LAVZ01000022.1 GCA001588775_00957 CDS open 4722-5222 _na     166_aa LPXTG cell wall anchor domain-containing protein
4007 LAVZ01000022.1 GCA001588775_00958 CDS open 5368-5880 _na     170_aa Dihydrofolate reductase
4008 LAVZ01000022.1 GCA001588775_00959 CDS open 6089-7318 _na     409_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
4009 LAVZ01000022.1 GCA001588775_00960 CDS open 7328-7921 _na     197_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
4010 LAVZ01000022.1 GCA001588775_00961 CDS open 8055-8744 _na     229_aa Autolysin%2C N-acetylmuramidase-like protein
4011 LAVZ01000022.1 GCA001588775_00962 CDS open 8872-9669 _na     265_aa Formate-nitrate transporter
4012 LAVZ01000022.1 GCA001588775_00963 CDS open 9763-10587 _na     274_aa Esterase superfamily
4013 LAVZ01000022.1 GCA001588775_00964 CDS open 10637-11377 _na     246_aa Esterase
4014 LAVZ01000022.1 GCA001588775_00965 CDS open 11390-12556 _na     388_aa ATP-grasp domain-containing protein
4015 LAVZ01000022.1 GCA001588775_00966 CDS open 12773-13741 _na     322_aa acoA Acetoin:2%2C6-dichlorophenolindophenol oxidoreductase subunit alpha
4016 LAVZ01000022.1 GCA001588775_00967 CDS open 13758-14750 _na     330_aa acoB Acetoin dehydrogenase
4017 LAVZ01000022.1 GCA001588775_00968 CDS open 14679-15149 _na     156_aa hypothetical protein
4018 LAVZ01000022.1 GCA001588775_00969 CDS open 15324-16367 _na     347_aa aceF dihydrolipoamide acetyltransferase
4019 LAVZ01000022.1 GCA001588775_00970 CDS open 16440-18146 _na     568_aa lpdA dihydrolipoyl dehydrogenase
4020 LAVZ01000022.1 GCA001588775_00971 CDS open 18213-19202 _na     329_aa lplA lipoate--protein ligase
4021 LAVZ01000022.1 GCA001588775_00972 CDS open 19282-21360 _na     692_aa Bacteriocin-associated integral membrane protein
4022 LAVZ01000022.1 GCA001588775_00973 CDS open 21362-21994 _na     210_aa ATP-binding transport protein
4023 LAVZ01000022.1 GCA001588775_00974 CDS open 22071-23141 _na     356_aa xerS tyrosine recombinase XerS
4024 LAVZ01000022.1 GCA001588775_00975 CDS open 23318-23677 _na     119_aa mepB MepB protein
4025 LAVZ01000022.1 GCA001588775_00951 gene open 7-279
4026 LAVZ01000022.1 GCA001588775_00952 gene open 514-837
4027 LAVZ01000022.1 GCA001588775_00953 gene open 905-1231
4028 LAVZ01000022.1 GCA001588775_00954 gene open 1674-2519
4029 LAVZ01000022.1 GCA001588775_00955 gene open 2694-3653
4030 LAVZ01000022.1 GCA001588775_00956 gene open 3752-4591 thyA
4031 LAVZ01000022.1 GCA001588775_00957 gene open 4722-5222
4032 LAVZ01000022.1 GCA001588775_00958 gene open 5368-5880
4033 LAVZ01000022.1 GCA001588775_00959 gene open 6089-7318 clpX
4034 LAVZ01000022.1 GCA001588775_00960 gene open 7328-7921 yihA
4035 LAVZ01000022.1 GCA001588775_00961 gene open 8055-8744
4036 LAVZ01000022.1 GCA001588775_00962 gene open 8872-9669
4037 LAVZ01000022.1 GCA001588775_00963 gene open 9763-10587
4038 LAVZ01000022.1 GCA001588775_00964 gene open 10637-11377
4039 LAVZ01000022.1 GCA001588775_00965 gene open 11390-12556
4040 LAVZ01000022.1 GCA001588775_00966 gene open 12773-13741 acoA
4041 LAVZ01000022.1 GCA001588775_00967 gene open 13758-14750 acoB
4042 LAVZ01000022.1 GCA001588775_00968 gene open 14679-15149
4043 LAVZ01000022.1 GCA001588775_00969 gene open 15324-16367 aceF
4044 LAVZ01000022.1 GCA001588775_00970 gene open 16440-18146 lpdA
4045 LAVZ01000022.1 GCA001588775_00971 gene open 18213-19202 lplA
4046 LAVZ01000022.1 GCA001588775_00972 gene open 19282-21360
4047 LAVZ01000022.1 GCA001588775_00973 gene open 21362-21994
4048 LAVZ01000022.1 GCA001588775_00974 gene open 22071-23141 xerS
4049 LAVZ01000022.1 GCA001588775_00975 gene open 23318-23677 mepB
4050 LAVZ01000023.1 GCA001588775_00976 gene open 1-2854 rrl
4051 LAVZ01000023.1 GCA001588775_00978 gene open 3101-4657 rrs
4052 LAVZ01000023.1 GCA001588775_00976 rRNA open 1-2854 rrl 23S ribosomal RNA
4053 LAVZ01000023.1 GCA001588775_00978 rRNA open 3101-4657 rrs 16S ribosomal RNA
4054 LAVZ01000023.1 GCA001588775_00977 gene open 2974-3046 trnA
4055 LAVZ01000023.1 GCA001588775_00977 tRNA open 2974-3046 trnA tRNA-Ala(tgc)
4056 LAVZ01000026.1 GCA001588775_00979 CDS open 58-435 _na     125_aa hemagglutinin
4057 LAVZ01000026.1 GCA001588775_00980 CDS open 438-842 _na     134_aa hypothetical protein
4058 LAVZ01000026.1 GCA001588775_00981 CDS open 1041-1607 _na     188_aa Knr4/Smi1-like domain-containing protein
4059 LAVZ01000026.1 GCA001588775_00982 CDS open 1674-2060 _na     128_aa Imm48 family immunity protein
4060 LAVZ01000026.1 GCA001588775_00983 CDS open 2260-2805 _na     181_aa Lipoprotein
4061 LAVZ01000026.1 GCA001588775_00984 CDS open 3061-3906 _na     281_aa Metallophosphoesterase family protein
4062 LAVZ01000026.1 GCA001588775_00985 CDS open 3913-5577 _na     554_aa hypothetical protein
4063 LAVZ01000026.1 GCA001588775_00986 CDS open 5692-6297 _na     201_aa Oxygen-insensitive NAD(P)H nitroreductase
4064 LAVZ01000026.1 GCA001588775_00987 CDS open 6343-7746 _na     467_aa pepV dipeptidase PepV
4065 LAVZ01000026.1 GCA001588775_00988 CDS open 7800-8384 _na     194_aa Uracil DNA glycosylase
4066 LAVZ01000026.1 GCA001588775_00989 CDS open 8397-8885 _na     162_aa YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein
4067 LAVZ01000026.1 GCA001588775_00990 CDS open 8939-9259 _na     106_aa tfoX TfoX N-terminal domain-containing protein
4068 LAVZ01000026.1 GCA001588775_00991 CDS open 9426-9875 _na     149_aa marR Transcriptional regulator%2C MarR family
4069 LAVZ01000026.1 GCA001588775_00992 CDS open 10052-11020 _na     322_aa Enoyl reductase (ER) domain-containing protein
4070 LAVZ01000026.1 GCA001588775_00993 CDS open 11031-11327 _na     98_aa Rhodanese family protein
4071 LAVZ01000026.1 GCA001588775_00994 CDS open 11438-12187 _na     249_aa ldcB LD-carboxypeptidase LdcB/DacB
4072 LAVZ01000026.1 GCA001588775_00995 CDS open 12248-12538 _na     96_aa AraC-type arabinose-binding/dimerisation domain-containing protein
4073 LAVZ01000026.1 GCA001588775_00996 CDS open 12628-13500 _na     290_aa Cell wall-binding protein
4074 LAVZ01000026.1 GCA001588775_00997 CDS open 14300-16300 _na     666_aa putative cell wall protein
4075 LAVZ01000026.1 GCA001588775_00998 CDS open 16525-17952 _na     475_aa SCP domain-containing protein
4076 LAVZ01000026.1 GCA001588775_00999 CDS open 18107-18391 _na     94_aa rpmE2 type B 50S ribosomal protein L31
4077 LAVZ01000026.1 GCA001588775_01000 CDS open 18448-19392 _na     314_aa DHH subfamily 1 protein
4078 LAVZ01000026.1 GCA001588775_01001 CDS open 19509-19952 _na     147_aa flavodoxin
4079 LAVZ01000026.1 GCA001588775_01002 CDS open 20103-21269 _na     388_aa Permease
4080 LAVZ01000026.1 GCA001588775_01003 CDS open 21259-22494 _na     411_aa TPR domain protein
4081 LAVZ01000026.1 GCA001588775_01004 CDS open 22615-23334 _na     239_aa budA acetolactate decarboxylase
4082 LAVZ01000026.1 GCA001588775_01005 CDS open 27804-28358 _na     184_aa hypothetical protein
4083 LAVZ01000026.1 GCA001588775_01006 CDS open 28392-29237 _na     281_aa hypothetical protein
4084 LAVZ01000026.1 GCA001588775_00979 gene open 58-435
4085 LAVZ01000026.1 GCA001588775_00980 gene open 438-842
4086 LAVZ01000026.1 GCA001588775_00981 gene open 1041-1607
4087 LAVZ01000026.1 GCA001588775_00982 gene open 1674-2060
4088 LAVZ01000026.1 GCA001588775_00983 gene open 2260-2805
4089 LAVZ01000026.1 GCA001588775_00984 gene open 3061-3906
4090 LAVZ01000026.1 GCA001588775_00985 gene open 3913-5577
4091 LAVZ01000026.1 GCA001588775_00986 gene open 5692-6297
4092 LAVZ01000026.1 GCA001588775_00987 gene open 6343-7746 pepV
4093 LAVZ01000026.1 GCA001588775_00988 gene open 7800-8384
4094 LAVZ01000026.1 GCA001588775_00989 gene open 8397-8885
4095 LAVZ01000026.1 GCA001588775_00990 gene open 8939-9259 tfoX
4096 LAVZ01000026.1 GCA001588775_00991 gene open 9426-9875 marR
4097 LAVZ01000026.1 GCA001588775_00992 gene open 10052-11020
4098 LAVZ01000026.1 GCA001588775_00993 gene open 11031-11327
4099 LAVZ01000026.1 GCA001588775_00994 gene open 11438-12187 ldcB
4100 LAVZ01000026.1 GCA001588775_00995 gene open 12248-12538
4101 LAVZ01000026.1 GCA001588775_00996 gene open 12628-13500
4102 LAVZ01000026.1 GCA001588775_00997 gene open 14300-16300
4103 LAVZ01000026.1 GCA001588775_00998 gene open 16525-17952
4104 LAVZ01000026.1 GCA001588775_00999 gene open 18107-18391 rpmE2
4105 LAVZ01000026.1 GCA001588775_01000 gene open 18448-19392
4106 LAVZ01000026.1 GCA001588775_01001 gene open 19509-19952
4107 LAVZ01000026.1 GCA001588775_01002 gene open 20103-21269
4108 LAVZ01000026.1 GCA001588775_01003 gene open 21259-22494
4109 LAVZ01000026.1 GCA001588775_01004 gene open 22615-23334 budA
4110 LAVZ01000026.1 GCA001588775_01005 gene open 27804-28358
4111 LAVZ01000026.1 GCA001588775_01006 gene open 28392-29237
4112 LAVZ01000027.1 GCA001588775_01007 CDS open 1195-2100 _na     301_aa hypothetical protein
4113 LAVZ01000027.1 GCA001588775_01008 CDS open 2134-2979 _na     281_aa hypothetical protein
4114 LAVZ01000027.1 GCA001588775_01007 gene open 1195-2100
4115 LAVZ01000027.1 GCA001588775_01008 gene open 2134-2979
4116 LAVZ01000028.1 GCA001588775_01009 CDS open 364-1614 _na     416_aa beta-ketoacyl synthase N-terminal-like domain-containing protein
4117 LAVZ01000028.1 GCA001588775_01010 CDS open 1607-2857 _na     416_aa beta-ketoacyl-[acyl-carrier-protein] synthase family protein
4118 LAVZ01000028.1 GCA001588775_01011 CDS open 2850-3785 _na     311_aa SRPBCC family protein
4119 LAVZ01000028.1 GCA001588775_01012 CDS open 3787-4239 _na     150_aa hypothetical protein
4120 LAVZ01000028.1 GCA001588775_01013 CDS open 4223-5233 _na     336_aa NAD(P)-dependent oxidoreductase
4121 LAVZ01000028.1 GCA001588775_01009 gene open 364-1614
4122 LAVZ01000028.1 GCA001588775_01010 gene open 1607-2857
4123 LAVZ01000028.1 GCA001588775_01011 gene open 2850-3785
4124 LAVZ01000028.1 GCA001588775_01012 gene open 3787-4239
4125 LAVZ01000028.1 GCA001588775_01013 gene open 4223-5233
4126 LAVZ01000030.1 repeat_region open 133-462 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 30
4127 LAVZ01000032.1 GCA001588775_01110 gene open 1378-1440 Spy392987
4128 LAVZ01000032.1 GCA001588775_01110 ncRNA open 1378-1440 S. pyogenes antisense RNA 392987
4129 LAVZ01000032.1 GCA001588775_01109 CDS open 318-1292 _na     324_aa tnp IS256 family transposase
4130 LAVZ01000032.1 GCA001588775_01109 gene open 318-1292 tnp
4131 LAVZ01000033.1 GCA001588775_01111 CDS open 31-483 _na     150_aa MutT/nudix family protein
4132 LAVZ01000033.1 GCA001588775_01112 CDS open 641-1531 _na     296_aa deoR Transcriptional regulator%2C DeoR family
4133 LAVZ01000033.1 GCA001588775_01113 CDS open 1591-2196 _na     201_aa GyrI-like small molecule binding domain-containing protein
4134 LAVZ01000033.1 GCA001588775_01114 CDS open 2277-4508 _na     743_aa clpE ATP dependent Clp protease%2C ATP-binding subunit%2C ClpE
4135 LAVZ01000033.1 GCA001588775_01115 CDS open 4761-4991 _na     76_aa Cytoplasmic protein
4136 LAVZ01000033.1 GCA001588775_01116 CDS open 5124-5978 _na     284_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
4137 LAVZ01000033.1 GCA001588775_01117 CDS open 5975-6748 _na     257_aa Haloacid dehalogenase-like hydrolase
4138 LAVZ01000033.1 GCA001588775_01118 CDS open 6856-7698 _na     280_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
4139 LAVZ01000033.1 GCA001588775_01119 CDS open 7854-9194 _na     446_aa xseA exodeoxyribonuclease VII large subunit
4140 LAVZ01000033.1 GCA001588775_01120 CDS open 9172-9384 _na     70_aa xseB exodeoxyribonuclease VII small subunit
4141 LAVZ01000033.1 GCA001588775_01121 CDS open 9381-10256 _na     291_aa Putative synthase or transferase
4142 LAVZ01000033.1 GCA001588775_01122 CDS open 10249-11064 _na     271_aa ftsJ Cell division protein FtsJ
4143 LAVZ01000033.1 GCA001588775_01111 gene open 31-483
4144 LAVZ01000033.1 GCA001588775_01112 gene open 641-1531 deoR
4145 LAVZ01000033.1 GCA001588775_01113 gene open 1591-2196
4146 LAVZ01000033.1 GCA001588775_01114 gene open 2277-4508 clpE
4147 LAVZ01000033.1 GCA001588775_01115 gene open 4761-4991
4148 LAVZ01000033.1 GCA001588775_01116 gene open 5124-5978 folD
4149 LAVZ01000033.1 GCA001588775_01117 gene open 5975-6748
4150 LAVZ01000033.1 GCA001588775_01118 gene open 6856-7698
4151 LAVZ01000033.1 GCA001588775_01119 gene open 7854-9194 xseA
4152 LAVZ01000033.1 GCA001588775_01120 gene open 9172-9384 xseB
4153 LAVZ01000033.1 GCA001588775_01121 gene open 9381-10256
4154 LAVZ01000033.1 GCA001588775_01122 gene open 10249-11064 ftsJ
4155 LAVZ01000034.1 GCA001588775_01123 CDS open 395-961 _na     188_aa SMI1/KNR4 family protein
4156 LAVZ01000034.1 GCA001588775_01124 CDS open 1013-1552 _na     179_aa DUF1851 domain-containing protein
4157 LAVZ01000034.1 GCA001588775_01125 CDS open 1564-2238 _na     224_aa Novel toxin 15 domain-containing protein
4158 LAVZ01000034.1 GCA001588775_01123 gene open 395-961
4159 LAVZ01000034.1 GCA001588775_01124 gene open 1013-1552
4160 LAVZ01000034.1 GCA001588775_01125 gene open 1564-2238
4161 LAVZ01000035.1 GCA001588775_01126 CDS open 14-304 _na     96_aa hypothetical protein
4162 LAVZ01000035.1 GCA001588775_01127 CDS open 297-854 _na     185_aa ABC transporter ATP-binding protein
4163 LAVZ01000035.1 GCA001588775_01128 CDS open 899-1120 _na     73_aa hypothetical protein
4164 LAVZ01000035.1 GCA001588775_01129 CDS open 1234-2244 _na     336_aa ABC transporter permease
4165 LAVZ01000035.1 GCA001588775_01130 CDS open 2244-2948 _na     234_aa ABC transporter ATP-binding protein
4166 LAVZ01000035.1 GCA001588775_01131 CDS open 2951-3718 _na     255_aa isoprenylcysteine carboxylmethyltransferase family protein
4167 LAVZ01000035.1 GCA001588775_01126 gene open 14-304
4168 LAVZ01000035.1 GCA001588775_01127 gene open 297-854
4169 LAVZ01000035.1 GCA001588775_01128 gene open 899-1120
4170 LAVZ01000035.1 GCA001588775_01129 gene open 1234-2244
4171 LAVZ01000035.1 GCA001588775_01130 gene open 2244-2948
4172 LAVZ01000035.1 GCA001588775_01131 gene open 2951-3718
4173 LAVZ01000036.1 GCA001588775_01132 CDS open 60-542 _na     160_aa comR1 Competence specific sigma factor ComR1
4174 LAVZ01000036.1 GCA001588775_01132 gene open 60-542 comR1
4175 LAVZ01000037.1 GCA001588775_01133 gene open 35-105 trnG
4176 LAVZ01000037.1 GCA001588775_01134 gene open 119-191 trnF
4177 LAVZ01000037.1 GCA001588775_01135 gene open 195-268 trnfM
4178 LAVZ01000037.1 GCA001588775_01136 gene open 288-377 trnS
4179 LAVZ01000037.1 GCA001588775_01137 gene open 394-467 trnI
4180 LAVZ01000037.1 GCA001588775_01138 gene open 481-554 trnM
4181 LAVZ01000037.1 GCA001588775_01133 tRNA open 35-105 trnG tRNA-Gly(tcc)
4182 LAVZ01000037.1 GCA001588775_01134 tRNA open 119-191 trnF tRNA-Phe(gaa)
4183 LAVZ01000037.1 GCA001588775_01135 tRNA open 195-268 trnfM tRNA-fMet(cat)
4184 LAVZ01000037.1 GCA001588775_01136 tRNA open 288-377 trnS tRNA-Ser(tga)
4185 LAVZ01000037.1 GCA001588775_01137 tRNA open 394-467 trnI tRNA-Ile2(cat)
4186 LAVZ01000037.1 GCA001588775_01138 tRNA open 481-554 trnM tRNA-Met(cat)
4187 LAVZ01000038.1 GCA001588775_01139 gene open 7-80 trnP
4188 LAVZ01000038.1 GCA001588775_01140 gene open 109-182 trnR
4189 LAVZ01000038.1 GCA001588775_01141 gene open 196-281 trnL
4190 LAVZ01000038.1 GCA001588775_01142 gene open 287-358 trnG
4191 LAVZ01000038.1 GCA001588775_01143 gene open 379-451 trnT
4192 LAVZ01000038.1 GCA001588775_01144 gene open 462-543 trnL
4193 LAVZ01000038.1 GCA001588775_01145 gene open 549-621 trnK
4194 LAVZ01000038.1 GCA001588775_01146 gene open 649-721 trnD
4195 LAVZ01000038.1 GCA001588775_01139 tRNA open 7-80 trnP tRNA-Pro(tgg)
4196 LAVZ01000038.1 GCA001588775_01140 tRNA open 109-182 trnR tRNA-Arg(acg)
4197 LAVZ01000038.1 GCA001588775_01141 tRNA open 196-281 trnL tRNA-Leu(taa)
4198 LAVZ01000038.1 GCA001588775_01142 tRNA open 287-358 trnG tRNA-Gly(gcc)
4199 LAVZ01000038.1 GCA001588775_01143 tRNA open 379-451 trnT tRNA-Thr(tgt)
4200 LAVZ01000038.1 GCA001588775_01144 tRNA open 462-543 trnL tRNA-Leu(tag)
4201 LAVZ01000038.1 GCA001588775_01145 tRNA open 549-621 trnK tRNA-Lys(ttt)
4202 LAVZ01000038.1 GCA001588775_01146 tRNA open 649-721 trnD tRNA-Asp(gtc)
4203 LAVZ01000040.1 GCA001588775_01245 CDS open 290-832 _na     180_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
4204 LAVZ01000040.1 GCA001588775_01246 CDS open 917-1372 _na     151_aa Competence protein F like protein%2C phosphoribosyltransferase domain
4205 LAVZ01000040.1 GCA001588775_01245 gene open 290-832 hpf
4206 LAVZ01000040.1 GCA001588775_01246 gene open 917-1372
4207 LAVZ01000041.1 GCA001588775_01247 CDS open 140-613 _na     157_aa hypothetical protein
4208 LAVZ01000041.1 GCA001588775_01248 CDS open 627-1169 _na     180_aa aNKYR Ankyrin repeat protein
4209 LAVZ01000041.1 GCA001588775_01249 CDS open 1156-1491 _na     111_aa DUF2185 domain-containing protein
4210 LAVZ01000041.1 GCA001588775_01247 gene open 140-613
4211 LAVZ01000041.1 GCA001588775_01248 gene open 627-1169 aNKYR
4212 LAVZ01000041.1 GCA001588775_01249 gene open 1156-1491
4213 LAVZ01000042.1 GCA001588775_01250 CDS open 70-318 _na     82_aa hypothetical protein
4214 LAVZ01000042.1 GCA001588775_01250 gene open 70-318
4215 LAVZ01000047.1 repeat_region open 50-313 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 30