HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Eikenella corrodens (GCA_001648265.1)

Select a Genome:
BAKTA Annotations for GCA_001648265.1
Genome Selected: Eikenella corrodens
ContigsBases CDSrRNA tmRNAtRNA
35 2,408,287 2333 5 1 50
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4795 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4795 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 LXSH01000013.1 GCA001648265_00767 CDS open 33791-34498 _na     235_aa B3/B4 tRNA-binding domain-containing protein
1502 LXSH01000013.1 GCA001648265_00768 CDS open 34574-35017 _na     147_aa Sugar-phosphate isomerase%2C RpiB/LacA/LacB family
1503 LXSH01000013.1 GCA001648265_00769 CDS open 35125-36870 _na     581_aa yqiK Band 7 domain-containing protein
1504 LXSH01000013.1 GCA001648265_00770 CDS open 37330-39567 _na     745_aa fhuE TonB-dependent siderophore receptor
1505 LXSH01000013.1 GCA001648265_00771 CDS open 39861-41654 _na     597_aa yddA ABC transporter domain-containing protein
1506 LXSH01000013.1 GCA001648265_00772 CDS open 41845-42399 _na     184_aa DUF304 domain-containing protein
1507 LXSH01000013.1 GCA001648265_00773 CDS open 42436-43857 _na     473_aa DUF304 domain-containing protein
1508 LXSH01000013.1 GCA001648265_00774 CDS open 43939-44454 _na     171_aa WGR domain-containing protein
1509 LXSH01000013.1 GCA001648265_00775 CDS open 44517-45185 _na     222_aa NfeD-like C-terminal domain-containing protein
1510 LXSH01000013.1 GCA001648265_00776 CDS open 45279-45977 _na     232_aa rimL N-acetyltransferase domain-containing protein
1511 LXSH01000013.1 GCA001648265_00777 CDS open 46065-46973 _na     302_aa tPR Sel1 repeat family protein
1512 LXSH01000013.1 GCA001648265_00778 CDS open 47091-47390 _na     99_aa ybgE Cyd operon protein YbgE
1513 LXSH01000013.1 GCA001648265_00779 CDS open 47438-47665 _na     75_aa DUF1772 domain-containing protein
1514 LXSH01000013.1 GCA001648265_00780 CDS open 47777-48445 _na     222_aa pspA PspA/IM30 family protein
1515 LXSH01000013.1 GCA001648265_00781 CDS open 48500-49000 _na     166_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1516 LXSH01000013.1 GCA001648265_00782 CDS open 49231-49641 _na     136_aa hslR RNA-binding S4 domain-containing protein
1517 LXSH01000013.1 GCA001648265_00783 CDS open 49726-50478 _na     250_aa sIMPL SIMPL domain-containing protein
1518 LXSH01000013.1 GCA001648265_00784 CDS open 50625-51476 _na     283_aa ypfJ Neutral zinc metallopeptidase
1519 LXSH01000013.1 GCA001648265_00785 CDS open 51870-52874 _na     334_aa ilvE branched-chain-amino-acid transaminase
1520 LXSH01000013.1 GCA001648265_00786 CDS open 53324-54751 _na     475_aa alsT Amino acid carrier protein
1521 LXSH01000013.1 GCA001648265_00787 CDS open 54969-56228 _na     419_aa sstT serine/threonine transporter SstT
1522 LXSH01000013.1 GCA001648265_00788 CDS open 56414-57400 _na     328_aa sbmA putative transporter
1523 LXSH01000013.1 GCA001648265_00789 CDS open 57614-59407 _na     597_aa trpE Para-aminobenzoate synthase
1524 LXSH01000013.1 GCA001648265_00790 CDS open 59823-60629 _na     268_aa hydroxymethylpyrimidine kinase
1525 LXSH01000013.1 GCA001648265_00791 CDS open 60652-61452 _na     266_aa thiM hydroxyethylthiazole kinase
1526 LXSH01000013.1 GCA001648265_00792 CDS open 62115-62606 _na     163_aa greB transcription elongation factor GreB
1527 LXSH01000013.1 GCA001648265_00793 CDS open 62646-64037 _na     463_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
1528 LXSH01000013.1 GCA001648265_00794 CDS open 64318-65358 _na     346_aa pilT Twitching motility protein PilT
1529 LXSH01000013.1 GCA001648265_00795 CDS open 65386-67077 _na     563_aa Bacterial type II secretion system protein E domain-containing protein
1530 LXSH01000013.1 GCA001648265_00796 CDS open 67346-68245 _na     299_aa rarD EamA family transporter RarD
1531 LXSH01000013.1 GCA001648265_00797 CDS open 68353-69846 _na     497_aa Patatin
1532 LXSH01000013.1 GCA001648265_00798 CDS open 70036-71529 _na     497_aa ppx exopolyphosphatase
1533 LXSH01000013.1 GCA001648265_00799 CDS open 71833-73023 _na     396_aa Lysozyme inhibitor LprI-like N-terminal domain-containing protein
1534 LXSH01000013.1 GCA001648265_00800 CDS open 73077-73613 _na     178_aa mutT GDP-mannose pyrophosphatase
1535 LXSH01000013.1 GCA001648265_00801 CDS open 73656-73967 _na     103_aa HLGFF motif protein
1536 LXSH01000013.1 GCA001648265_00802 CDS open 73967-74146 _na     59_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
1537 LXSH01000013.1 GCA001648265_00803 CDS open 74143-75450 _na     435_aa Major facilitator superfamily (MFS) profile domain-containing protein
1538 LXSH01000013.1 GCA001648265_00804 CDS open 75601-76596 _na     331_aa mltG Endolytic murein transglycosylase
1539 LXSH01000013.1 GCA001648265_00805 CDS open 76598-77200 _na     200_aa yciB Inner membrane-spanning protein YciB
1540 LXSH01000013.1 GCA001648265_00806 CDS open 77357-77974 _na     205_aa tmk dTMP kinase
1541 LXSH01000013.1 GCA001648265_00807 CDS open 78064-78465 _na     133_aa DUF4375 domain-containing protein
1542 LXSH01000013.1 GCA001648265_00808 CDS open 78523-80505 _na     660_aa tkt transketolase
1543 LXSH01000013.1 GCA001648265_00809 CDS open 80929-82953 _na     674_aa oPT OPT family oligopeptide transporter
1544 LXSH01000013.1 GCA001648265_00810 CDS open 83297-84700 _na     467_aa clcA Chloride channel protein EriC
1545 LXSH01000013.1 GCA001648265_00812 CDS open 85530-87785 _na     751_aa norB Nitric oxide reductase subunit B cytochrome c-like domain-containing protein
1546 LXSH01000013.1 GCA001648265_00813 CDS open 88003-88611 _na     202_aa Knr4/Smi1-like domain-containing protein
1547 LXSH01000013.1 GCA001648265_00814 CDS open 88785-90407 _na     540_aa fixX Electron transfer flavoprotein-ubiquinone oxidoreductase
1548 LXSH01000013.1 GCA001648265_00815 CDS open 90668-90778 _na     36_aa Methionine/alanine importer small subunit
1549 LXSH01000013.1 GCA001648265_00816 CDS open 90775-92307 _na     510_aa yocR Transporter
1550 LXSH01000013.1 GCA001648265_00817 CDS open 92614-93495 _na     293_aa rhaT EamA domain-containing protein
1551 LXSH01000013.1 GCA001648265_00818 CDS open 93576-94547 _na     323_aa Arabinose 5-phosphate isomerase
1552 LXSH01000013.1 GCA001648265_00819 CDS open 94633-95658 _na     341_aa tal transaldolase
1553 LXSH01000013.1 GCA001648265_00820 CDS open 95730-96707 _na     325_aa rhuM Fido domain-containing protein
1554 LXSH01000013.1 GCA001648265_00821 CDS open 96724-97815 _na     363_aa Conjugal transfer protein
1555 LXSH01000013.1 GCA001648265_00822 CDS open 97993-98448 _na     151_aa Diamine acetyltransferase
1556 LXSH01000013.1 GCA001648265_00823 CDS open 98581-99309 _na     242_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1557 LXSH01000013.1 GCA001648265_00824 CDS open 99430-101292 _na     620_aa Peptidoglycan binding-like domain-containing protein
1558 LXSH01000013.1 GCA001648265_00825 CDS open 101455-102906 _na     483_aa adhE Aldehyde dehydrogenase domain-containing protein
1559 LXSH01000013.1 GCA001648265_00826 CDS open 103176-104315 _na     379_aa obgE GTPase ObgE
1560 LXSH01000013.1 GCA001648265_00827 CDS open 104337-104702 _na     121_aa DUF4878 domain-containing protein
1561 LXSH01000013.1 GCA001648265_00828 CDS open 104755-105237 _na     160_aa nlpE Copper resistance protein NlpE
1562 LXSH01000013.1 GCA001648265_00829 CDS open 105355-105648 _na     97_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
1563 LXSH01000013.1 GCA001648265_00830 CDS open 105971-106483 _na     170_aa ssb Single-stranded DNA-binding protein
1564 LXSH01000013.1 GCA001648265_00831 CDS open 106473-107861 _na     462_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
1565 LXSH01000013.1 GCA001648265_00832 CDS open 108018-108743 _na     241_aa DUF4304 domain-containing protein
1566 LXSH01000013.1 GCA001648265_00833 CDS open 108868-109497 _na     209_aa mltE Transglycosylase SLT domain-containing protein
1567 LXSH01000013.1 GCA001648265_00732 gene open 588-950
1568 LXSH01000013.1 GCA001648265_00733 gene open 962-2047 nagZ
1569 LXSH01000013.1 GCA001648265_00734 gene open 2210-2992 fkpA
1570 LXSH01000013.1 GCA001648265_00735 gene open 3060-3542
1571 LXSH01000013.1 GCA001648265_00736 gene open 3677-4624 ansA
1572 LXSH01000013.1 GCA001648265_00737 gene open 4713-5657 tehA
1573 LXSH01000013.1 GCA001648265_00738 gene open 5973-7391 glnA
1574 LXSH01000013.1 GCA001648265_00739 gene open 7551-8297 rsuA
1575 LXSH01000013.1 GCA001648265_00740 gene open 8383-9033
1576 LXSH01000013.1 GCA001648265_00741 gene open 9181-9960 kdsB
1577 LXSH01000013.1 GCA001648265_00742 gene open 9957-10139 trm112
1578 LXSH01000013.1 GCA001648265_00743 gene open 10256-11287 lpxK
1579 LXSH01000013.1 GCA001648265_00744 gene open 11309-11809 folA
1580 LXSH01000013.1 GCA001648265_00745 gene open 11960-12445 ribH
1581 LXSH01000013.1 GCA001648265_00746 gene open 12470-12907 nusB
1582 LXSH01000013.1 GCA001648265_00747 gene open 13124-14584 trkG
1583 LXSH01000013.1 GCA001648265_00748 gene open 14651-15196
1584 LXSH01000013.1 GCA001648265_00749 gene open 15289-15669
1585 LXSH01000013.1 GCA001648265_00750 gene open 15833-17692 mltE
1586 LXSH01000013.1 GCA001648265_00751 gene open 18065-18835 glpC
1587 LXSH01000013.1 GCA001648265_00752 gene open 18832-19530 lutC
1588 LXSH01000013.1 GCA001648265_00753 gene open 19527-20981 lutB
1589 LXSH01000013.1 GCA001648265_00754 gene open 21187-22743 lldP
1590 LXSH01000013.1 GCA001648265_00755 gene open 22863-23213 phnB
1591 LXSH01000013.1 GCA001648265_00756 gene open 23318-25939 alaS
1592 LXSH01000013.1 GCA001648265_00757 gene open 26245-27318 rlhA
1593 LXSH01000013.1 GCA001648265_00758 gene open 27569-28438
1594 LXSH01000013.1 GCA001648265_00759 gene open 28532-28903
1595 LXSH01000013.1 GCA001648265_00760 gene open 28875-29126
1596 LXSH01000013.1 GCA001648265_00761 gene open 29168-30088 rlhA
1597 LXSH01000013.1 GCA001648265_00762 gene open 30100-30543 ubiT
1598 LXSH01000013.1 GCA001648265_00763 gene open 30789-31586 focA
1599 LXSH01000013.1 GCA001648265_00764 gene open 31780-32208
1600 LXSH01000013.1 GCA001648265_00765 gene open 32205-32675 paaI
1601 LXSH01000013.1 GCA001648265_00766 gene open 32806-33663 scpA
1602 LXSH01000013.1 GCA001648265_00767 gene open 33791-34498
1603 LXSH01000013.1 GCA001648265_00768 gene open 34574-35017
1604 LXSH01000013.1 GCA001648265_00769 gene open 35125-36870 yqiK
1605 LXSH01000013.1 GCA001648265_00770 gene open 37330-39567 fhuE
1606 LXSH01000013.1 GCA001648265_00771 gene open 39861-41654 yddA
1607 LXSH01000013.1 GCA001648265_00772 gene open 41845-42399
1608 LXSH01000013.1 GCA001648265_00773 gene open 42436-43857
1609 LXSH01000013.1 GCA001648265_00774 gene open 43939-44454
1610 LXSH01000013.1 GCA001648265_00775 gene open 44517-45185
1611 LXSH01000013.1 GCA001648265_00776 gene open 45279-45977 rimL
1612 LXSH01000013.1 GCA001648265_00777 gene open 46065-46973 tPR
1613 LXSH01000013.1 GCA001648265_00778 gene open 47091-47390 ybgE
1614 LXSH01000013.1 GCA001648265_00779 gene open 47438-47665
1615 LXSH01000013.1 GCA001648265_00780 gene open 47777-48445 pspA
1616 LXSH01000013.1 GCA001648265_00781 gene open 48500-49000
1617 LXSH01000013.1 GCA001648265_00782 gene open 49231-49641 hslR
1618 LXSH01000013.1 GCA001648265_00783 gene open 49726-50478 sIMPL
1619 LXSH01000013.1 GCA001648265_00784 gene open 50625-51476 ypfJ
1620 LXSH01000013.1 GCA001648265_00785 gene open 51870-52874 ilvE
1621 LXSH01000013.1 GCA001648265_00786 gene open 53324-54751 alsT
1622 LXSH01000013.1 GCA001648265_00787 gene open 54969-56228 sstT
1623 LXSH01000013.1 GCA001648265_00788 gene open 56414-57400 sbmA
1624 LXSH01000013.1 GCA001648265_00789 gene open 57614-59407 trpE
1625 LXSH01000013.1 GCA001648265_00790 gene open 59823-60629
1626 LXSH01000013.1 GCA001648265_00791 gene open 60652-61452 thiM
1627 LXSH01000013.1 GCA001648265_00792 gene open 62115-62606 greB
1628 LXSH01000013.1 GCA001648265_00793 gene open 62646-64037 araJ
1629 LXSH01000013.1 GCA001648265_00794 gene open 64318-65358 pilT
1630 LXSH01000013.1 GCA001648265_00795 gene open 65386-67077
1631 LXSH01000013.1 GCA001648265_00796 gene open 67346-68245 rarD
1632 LXSH01000013.1 GCA001648265_00797 gene open 68353-69846
1633 LXSH01000013.1 GCA001648265_00798 gene open 70036-71529 ppx
1634 LXSH01000013.1 GCA001648265_00799 gene open 71833-73023
1635 LXSH01000013.1 GCA001648265_00800 gene open 73077-73613 mutT
1636 LXSH01000013.1 GCA001648265_00801 gene open 73656-73967
1637 LXSH01000013.1 GCA001648265_00802 gene open 73967-74146 ccoS
1638 LXSH01000013.1 GCA001648265_00803 gene open 74143-75450
1639 LXSH01000013.1 GCA001648265_00804 gene open 75601-76596 mltG
1640 LXSH01000013.1 GCA001648265_00805 gene open 76598-77200 yciB
1641 LXSH01000013.1 GCA001648265_00806 gene open 77357-77974 tmk
1642 LXSH01000013.1 GCA001648265_00807 gene open 78064-78465
1643 LXSH01000013.1 GCA001648265_00808 gene open 78523-80505 tkt
1644 LXSH01000013.1 GCA001648265_00809 gene open 80929-82953 oPT
1645 LXSH01000013.1 GCA001648265_00810 gene open 83297-84700 clcA
1646 LXSH01000013.1 GCA001648265_00812 gene open 85530-87785 norB
1647 LXSH01000013.1 GCA001648265_00813 gene open 88003-88611
1648 LXSH01000013.1 GCA001648265_00814 gene open 88785-90407 fixX
1649 LXSH01000013.1 GCA001648265_00815 gene open 90668-90778
1650 LXSH01000013.1 GCA001648265_00816 gene open 90775-92307 yocR
1651 LXSH01000013.1 GCA001648265_00817 gene open 92614-93495 rhaT
1652 LXSH01000013.1 GCA001648265_00818 gene open 93576-94547
1653 LXSH01000013.1 GCA001648265_00819 gene open 94633-95658 tal
1654 LXSH01000013.1 GCA001648265_00820 gene open 95730-96707 rhuM
1655 LXSH01000013.1 GCA001648265_00821 gene open 96724-97815
1656 LXSH01000013.1 GCA001648265_00822 gene open 97993-98448
1657 LXSH01000013.1 GCA001648265_00823 gene open 98581-99309 tACO1
1658 LXSH01000013.1 GCA001648265_00824 gene open 99430-101292
1659 LXSH01000013.1 GCA001648265_00825 gene open 101455-102906 adhE
1660 LXSH01000013.1 GCA001648265_00826 gene open 103176-104315 obgE
1661 LXSH01000013.1 GCA001648265_00827 gene open 104337-104702
1662 LXSH01000013.1 GCA001648265_00828 gene open 104755-105237 nlpE
1663 LXSH01000013.1 GCA001648265_00829 gene open 105355-105648 yfaE
1664 LXSH01000013.1 GCA001648265_00830 gene open 105971-106483 ssb
1665 LXSH01000013.1 GCA001648265_00831 gene open 106473-107861 araJ
1666 LXSH01000013.1 GCA001648265_00832 gene open 108018-108743
1667 LXSH01000013.1 GCA001648265_00833 gene open 108868-109497 mltE
1668 LXSH01000013.1 GCA001648265_00811 gene open 84984-85077 trnS
1669 LXSH01000013.1 GCA001648265_00811 tRNA open 84984-85077 trnS tRNA-Ser(gct)
1670 LXSH01000014.1 GCA001648265_00834 CDS open 10-972 _na     320_aa IS110 family transposase
1671 LXSH01000014.1 GCA001648265_00834 gene open 10-972
1672 LXSH01000015.1 GCA001648265_00835 CDS open 262-756 _na     164_aa Amino acid permease/ SLC12A domain-containing protein
1673 LXSH01000015.1 GCA001648265_00836 CDS open 910-1062 _na     50_aa Alternative ribosome-rescue factor A
1674 LXSH01000015.1 GCA001648265_00837 CDS open 1268-2533 _na     421_aa gdhA Glutamate dehydrogenase
1675 LXSH01000015.1 GCA001648265_00838 CDS open 2786-3130 _na     114_aa Alternative ribosome-rescue factor A
1676 LXSH01000015.1 GCA001648265_00839 CDS open 3267-4103 _na     278_aa rlmJ Ribosomal RNA large subunit methyltransferase J
1677 LXSH01000015.1 GCA001648265_00840 CDS open 4660-6165 _na     501_aa tPR Sel1 repeat family protein
1678 LXSH01000015.1 GCA001648265_00841 CDS open 6415-6765 _na     116_aa erpA iron-sulfur cluster insertion protein ErpA
1679 LXSH01000015.1 GCA001648265_00842 CDS open 6973-8223 _na     416_aa Serine hydroxymethyltransferase
1680 LXSH01000015.1 GCA001648265_00843 CDS open 8601-8999 _na     132_aa cutA Divalent-cation tolerance protein CutA
1681 LXSH01000015.1 GCA001648265_00844 CDS open 9081-9716 _na     211_aa Serine aminopeptidase S33 domain-containing protein
1682 LXSH01000015.1 GCA001648265_00845 CDS open 9818-11344 _na     508_aa ilvA threonine ammonia-lyase%2C biosynthetic
1683 LXSH01000015.1 GCA001648265_00846 CDS open 11626-12867 _na     413_aa dacC serine-type D-Ala-D-Ala carboxypeptidase
1684 LXSH01000015.1 GCA001648265_00847 CDS open 12943-13719 _na     258_aa hypothetical protein
1685 LXSH01000015.1 GCA001648265_00848 CDS open 13824-14585 _na     253_aa Surface-adhesin protein E-like domain-containing protein
1686 LXSH01000015.1 GCA001648265_00849 CDS open 14701-15477 _na     258_aa Gram-negative pili assembly chaperone domain protein
1687 LXSH01000015.1 GCA001648265_00850 CDS open 15601-16410 _na     269_aa hypothetical protein
1688 LXSH01000015.1 GCA001648265_00851 CDS open 16485-17567 _na     360_aa Methyltransferase
1689 LXSH01000015.1 GCA001648265_00852 CDS open 17722-18420 _na     232_aa murU N-acetylmuramate alpha-1-phosphate uridylyltransferase MurU
1690 LXSH01000015.1 GCA001648265_00853 CDS open 18746-19903 _na     385_aa rlmL THUMP domain-containing protein
1691 LXSH01000015.1 GCA001648265_00854 CDS open 20064-21080 _na     338_aa mutY A/G-specific adenine glycosylase
1692 LXSH01000015.1 GCA001648265_00855 CDS open 21186-22103 _na     305_aa eamA EamA domain-containing protein
1693 LXSH01000015.1 GCA001648265_00856 CDS open 22149-22400 _na     83_aa ydhL DUF1289 domain-containing protein
1694 LXSH01000015.1 GCA001648265_00857 CDS open 22646-24364 _na     572_aa argS arginine--tRNA ligase
1695 LXSH01000015.1 GCA001648265_00858 CDS open 24407-24802 _na     131_aa fluC Fluoride-specific ion channel FluC
1696 LXSH01000015.1 GCA001648265_00859 CDS open 24907-25605 _na     232_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
1697 LXSH01000015.1 GCA001648265_00860 CDS open 25712-25972 _na     86_aa hfq RNA chaperone Hfq
1698 LXSH01000015.1 GCA001648265_00861 CDS open 26267-26968 _na     233_aa radC DNA repair protein RadC
1699 LXSH01000015.1 GCA001648265_00835 gene open 262-756
1700 LXSH01000015.1 GCA001648265_00836 gene open 910-1062
1701 LXSH01000015.1 GCA001648265_00837 gene open 1268-2533 gdhA
1702 LXSH01000015.1 GCA001648265_00838 gene open 2786-3130
1703 LXSH01000015.1 GCA001648265_00839 gene open 3267-4103 rlmJ
1704 LXSH01000015.1 GCA001648265_00840 gene open 4660-6165 tPR
1705 LXSH01000015.1 GCA001648265_00841 gene open 6415-6765 erpA
1706 LXSH01000015.1 GCA001648265_00842 gene open 6973-8223
1707 LXSH01000015.1 GCA001648265_00843 gene open 8601-8999 cutA
1708 LXSH01000015.1 GCA001648265_00844 gene open 9081-9716
1709 LXSH01000015.1 GCA001648265_00845 gene open 9818-11344 ilvA
1710 LXSH01000015.1 GCA001648265_00846 gene open 11626-12867 dacC
1711 LXSH01000015.1 GCA001648265_00847 gene open 12943-13719
1712 LXSH01000015.1 GCA001648265_00848 gene open 13824-14585
1713 LXSH01000015.1 GCA001648265_00849 gene open 14701-15477
1714 LXSH01000015.1 GCA001648265_00850 gene open 15601-16410
1715 LXSH01000015.1 GCA001648265_00851 gene open 16485-17567
1716 LXSH01000015.1 GCA001648265_00852 gene open 17722-18420 murU
1717 LXSH01000015.1 GCA001648265_00853 gene open 18746-19903 rlmL
1718 LXSH01000015.1 GCA001648265_00854 gene open 20064-21080 mutY
1719 LXSH01000015.1 GCA001648265_00855 gene open 21186-22103 eamA
1720 LXSH01000015.1 GCA001648265_00856 gene open 22149-22400 ydhL
1721 LXSH01000015.1 GCA001648265_00857 gene open 22646-24364 argS
1722 LXSH01000015.1 GCA001648265_00858 gene open 24407-24802 fluC
1723 LXSH01000015.1 GCA001648265_00859 gene open 24907-25605 mtnN
1724 LXSH01000015.1 GCA001648265_00860 gene open 25712-25972 hfq
1725 LXSH01000015.1 GCA001648265_00861 gene open 26267-26968 radC
1726 LXSH01000016.1 GCA001648265_00889 gene open 24705-25059 RNaseP_bact_a
1727 LXSH01000016.1 GCA001648265_00889 ncRNA open 24705-25059 Bacterial RNase P class A
1728 LXSH01000016.1 repeat_region open 111469-112809 CRISPR array with 21 repeats of length 31%2C consensus sequence CAGCCGCCTTCGGGCGGCTGTGTGTTGAAAC and spacer length 34
1729 LXSH01000016.1 GCA001648265_00862 CDS open 414-1244 _na     276_aa hisJ ABC transporter arginine-binding protein 2
1730 LXSH01000016.1 GCA001648265_00863 CDS open 1409-1756 _na     115_aa vOC Lactoylglutathione lyase
1731 LXSH01000016.1 GCA001648265_00864 CDS open 1837-2586 _na     249_aa DUF4261 domain-containing protein
1732 LXSH01000016.1 GCA001648265_00865 CDS open 2704-3519 _na     271_aa pflA pyruvate formate lyase 1-activating protein
1733 LXSH01000016.1 GCA001648265_00866 CDS open 3715-5994 _na     759_aa pflB formate C-acetyltransferase
1734 LXSH01000016.1 GCA001648265_00867 CDS open 6346-6795 _na     149_aa Apolipoprotein N-acyltransferase
1735 LXSH01000016.1 GCA001648265_00869 CDS open 6944-7504 _na     186_aa efp elongation factor P
1736 LXSH01000016.1 GCA001648265_00870 CDS open 7624-8121 _na     165_aa yecA YecA family protein
1737 LXSH01000016.1 GCA001648265_00871 CDS open 8206-8952 _na     248_aa uppS isoprenyl transferase
1738 LXSH01000016.1 GCA001648265_00872 CDS open 9041-9598 _na     185_aa frr ribosome recycling factor
1739 LXSH01000016.1 GCA001648265_00873 CDS open 9958-10440 _na     160_aa Ricin B lectin domain-containing protein
1740 LXSH01000016.1 GCA001648265_00874 CDS open 10546-11625 _na     359_aa pheA prephenate dehydratase
1741 LXSH01000016.1 GCA001648265_00875 CDS open 11942-13195 _na     417_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
1742 LXSH01000016.1 GCA001648265_00876 CDS open 13305-13589 _na     94_aa hypothetical protein
1743 LXSH01000016.1 GCA001648265_00877 CDS open 13857-14831 _na     324_aa yheT AB hydrolase-1 domain-containing protein
1744 LXSH01000016.1 GCA001648265_00878 CDS open 14957-15670 _na     237_aa pyrH UMP kinase
1745 LXSH01000016.1 GCA001648265_00879 CDS open 16012-16482 _na     156_aa dps Ferritin/DPS protein domain-containing protein
1746 LXSH01000016.1 GCA001648265_00880 CDS open 16787-17191 _na     134_aa Secreted protein
1747 LXSH01000016.1 GCA001648265_00881 CDS open 17483-18103 _na     206_aa thiE thiamine phosphate synthase
1748 LXSH01000016.1 GCA001648265_00882 CDS open 18225-18971 _na     248_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
1749 LXSH01000016.1 GCA001648265_00883 CDS open 18779-19330 _na     183_aa hypothetical protein
1750 LXSH01000016.1 GCA001648265_00884 CDS open 19467-20042 _na     191_aa ubiX Flavin prenyltransferase UbiX
1751 LXSH01000016.1 GCA001648265_00885 CDS open 20371-21306 _na     311_aa czcD Cation efflux protein cytoplasmic domain-containing protein
1752 LXSH01000016.1 GCA001648265_00886 CDS open 21477-21908 _na     143_aa ribN EamA domain-containing protein
1753 LXSH01000016.1 GCA001648265_00887 CDS open 22151-23062 _na     303_aa rssA PNPLA domain-containing protein
1754 LXSH01000016.1 GCA001648265_00888 CDS open 23396-24367 _na     323_aa rpfE Cofactor-independent phosphoglycerate mutase
1755 LXSH01000016.1 GCA001648265_00890 CDS open 25229-25435 _na     68_aa Glycine zipper 2TM domain-containing protein
1756 LXSH01000016.1 GCA001648265_00891 CDS open 25543-25989 _na     148_aa Copper resistance protein D domain-containing protein
1757 LXSH01000016.1 GCA001648265_00892 CDS open 26285-26710 _na     141_aa rimP ribosome maturation factor RimP
1758 LXSH01000016.1 GCA001648265_00893 CDS open 26747-28243 _na     498_aa nusA Transcription termination/antitermination protein NusA
1759 LXSH01000016.1 GCA001648265_00894 CDS open 28259-31024 _na     921_aa infB translation initiation factor IF-2
1760 LXSH01000016.1 GCA001648265_00895 CDS open 31385-31717 _na     110_aa hypothetical protein
1761 LXSH01000016.1 GCA001648265_00896 CDS open 31741-32112 _na     123_aa rbfA 30S ribosome-binding factor RbfA
1762 LXSH01000016.1 GCA001648265_00897 CDS open 32225-33133 _na     302_aa mMP0363 AAA+ ATPase domain-containing protein
1763 LXSH01000016.1 GCA001648265_00898 CDS open 33130-34038 _na     302_aa mMP0362 DUF58 domain-containing protein
1764 LXSH01000016.1 GCA001648265_00899 CDS open 34109-34561 _na     150_aa dut dUTP diphosphatase
1765 LXSH01000016.1 GCA001648265_00900 CDS open 34673-35419 _na     248_aa fabG 3-oxoacyl-ACP reductase FabG
1766 LXSH01000016.1 GCA001648265_00901 CDS open 35487-36413 _na     308_aa fabD ACP S-malonyltransferase
1767 LXSH01000016.1 GCA001648265_00902 CDS open 36676-38142 _na     488_aa guaB IMP dehydrogenase
1768 LXSH01000016.1 GCA001648265_00903 CDS open 38299-38766 _na     155_aa DUF4124 domain-containing protein
1769 LXSH01000016.1 GCA001648265_00904 CDS open 38838-40664 _na     608_aa uvrC excinuclease ABC subunit UvrC
1770 LXSH01000016.1 GCA001648265_00905 CDS open 40676-41266 _na     196_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1771 LXSH01000016.1 GCA001648265_00906 CDS open 41496-42296 _na     266_aa Lipoprotein
1772 LXSH01000016.1 GCA001648265_00907 CDS open 42523-43341 _na     272_aa Lipoprotein
1773 LXSH01000016.1 GCA001648265_00908 CDS open 43510-44355 _na     281_aa Uroporphyrinogen-III synthase
1774 LXSH01000016.1 GCA001648265_00909 CDS open 44438-45691 _na     417_aa hemX Heme biosynthesis operon protein HemX
1775 LXSH01000016.1 GCA001648265_00910 CDS open 45688-46908 _na     406_aa hemYx Putative hemY protein
1776 LXSH01000016.1 GCA001648265_00911 CDS open 47155-48996 _na     613_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1777 LXSH01000016.1 GCA001648265_00912 CDS open 49217-49693 _na     158_aa Lipoprotein
1778 LXSH01000016.1 GCA001648265_00913 CDS open 49794-50375 _na     193_aa ruvA Holliday junction branch migration protein RuvA
1779 LXSH01000016.1 GCA001648265_00914 CDS open 50543-51157 _na     204_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1780 LXSH01000016.1 GCA001648265_00915 CDS open 51289-52698 _na     469_aa pepB leucyl aminopeptidase
1781 LXSH01000016.1 GCA001648265_00916 CDS open 52794-53306 _na     170_aa Lipocalin-like domain-containing protein
1782 LXSH01000016.1 GCA001648265_00917 CDS open 53471-53836 _na     121_aa Periplasmic protein
1783 LXSH01000016.1 GCA001648265_00918 CDS open 54010-54594 _na     194_aa pgpB Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
1784 LXSH01000016.1 GCA001648265_00919 CDS open 54910-56247 _na     445_aa nCS2 Permease
1785 LXSH01000016.1 GCA001648265_00920 CDS open 56411-57901 _na     496_aa aes subtype B tannase
1786 LXSH01000016.1 GCA001648265_00921 CDS open 58014-58496 _na     160_aa DUF2059 domain-containing protein
1787 LXSH01000016.1 GCA001648265_00922 CDS open 58535-59860 _na     441_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
1788 LXSH01000016.1 GCA001648265_00923 CDS open 60053-60352 _na     99_aa Transmembrane protein
1789 LXSH01000016.1 GCA001648265_00924 CDS open 60377-61822 _na     481_aa nuoN NADH-quinone oxidoreductase subunit NuoN
1790 LXSH01000016.1 GCA001648265_00925 CDS open 61832-63334 _na     500_aa nuoM NADH-quinone oxidoreductase subunit M
1791 LXSH01000016.1 GCA001648265_00926 CDS open 63418-64581 _na     387_aa Restriction endonuclease type II NgoFVII N-terminal domain-containing protein
1792 LXSH01000016.1 GCA001648265_00927 CDS open 64665-64985 _na     106_aa manC Cupin domain protein
1793 LXSH01000016.1 GCA001648265_00928 CDS open 65039-67048 _na     669_aa nuoL NADH-quinone oxidoreductase subunit L
1794 LXSH01000016.1 GCA001648265_00929 CDS open 67166-67471 _na     101_aa nuoK NADH-quinone oxidoreductase subunit NuoK
1795 LXSH01000016.1 GCA001648265_00930 CDS open 67468-68220 _na     250_aa nuoJ NADH-quinone oxidoreductase subunit J
1796 LXSH01000016.1 GCA001648265_00931 CDS open 68221-68967 _na     248_aa HTH OST-type domain-containing protein
1797 LXSH01000016.1 GCA001648265_00932 CDS open 69037-69516 _na     159_aa nuoI NADH-quinone oxidoreductase subunit NuoI
1798 LXSH01000016.1 GCA001648265_00933 CDS open 69571-69966 _na     131_aa CENP-V/GFA domain-containing protein
1799 LXSH01000016.1 GCA001648265_00934 CDS open 70042-71115 _na     357_aa nuoH NADH-quinone oxidoreductase subunit NuoH
1800 LXSH01000016.1 GCA001648265_00935 CDS open 71115-73370 _na     751_aa nuoG NADH-quinone oxidoreductase subunit NuoG
1801 LXSH01000016.1 GCA001648265_00936 CDS open 73512-74807 _na     431_aa nuoF NADH-quinone oxidoreductase subunit NuoF
1802 LXSH01000016.1 GCA001648265_00937 CDS open 74994-75467 _na     157_aa nuoE NADH-quinone oxidoreductase subunit NuoE
1803 LXSH01000016.1 GCA001648265_00938 CDS open 75467-76723 _na     418_aa nuoD NADH-quinone oxidoreductase subunit D
1804 LXSH01000016.1 GCA001648265_00939 CDS open 76713-77303 _na     196_aa nuoC NADH-quinone oxidoreductase subunit C
1805 LXSH01000016.1 GCA001648265_00940 CDS open 77313-77792 _na     159_aa nuoB NADH-quinone oxidoreductase subunit B
1806 LXSH01000016.1 GCA001648265_00941 CDS open 77783-78151 _na     122_aa nuoA NADH-quinone oxidoreductase subunit A
1807 LXSH01000016.1 GCA001648265_00942 CDS open 78587-80008 _na     473_aa mgtE magnesium transporter
1808 LXSH01000016.1 GCA001648265_00943 CDS open 80224-80718 _na     164_aa DUF1841 domain-containing protein
1809 LXSH01000016.1 GCA001648265_00944 CDS open 80739-81311 _na     190_aa RDD domain-containing protein
1810 LXSH01000016.1 GCA001648265_00945 CDS open 81504-82025 _na     173_aa DUF3465 domain-containing protein
1811 LXSH01000016.1 GCA001648265_00946 CDS open 82182-83399 _na     405_aa Uracil permease
1812 LXSH01000016.1 GCA001648265_00947 CDS open 83735-84232 _na     165_aa YbhB/YbcL family Raf kinase inhibitor-like protein
1813 LXSH01000016.1 GCA001648265_00948 CDS open 84362-85960 _na     532_aa opgE Arylsulfatase
1814 LXSH01000016.1 GCA001648265_00949 CDS open 86143-87102 _na     319_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
1815 LXSH01000016.1 GCA001648265_00950 CDS open 87318-88256 _na     312_aa cysK cysteine synthase A
1816 LXSH01000016.1 GCA001648265_00951 CDS open 88418-88879 _na     153_aa Prokaryotic membrane lipolipid attachment site family protein
1817 LXSH01000016.1 GCA001648265_00952 CDS open 89359-90297 _na     312_aa pip prolyl aminopeptidase
1818 LXSH01000016.1 GCA001648265_00953 CDS open 90533-91930 _na     465_aa aspA aspartate ammonia-lyase
1819 LXSH01000016.1 GCA001648265_00954 CDS open 92751-95036 _na     761_aa CRISPR-associated helicase/endonuclease Cas3
1820 LXSH01000016.1 GCA001648265_00955 CDS open 95211-98009 _na     932_aa DEAD/DEAH box helicase
1821 LXSH01000016.1 GCA001648265_00956 CDS open 98038-99135 _na     365_aa Chromosome segregation protein SMC
1822 LXSH01000016.1 GCA001648265_00957 CDS open 99132-99782 _na     216_aa DUF4276 domain-containing protein
1823 LXSH01000016.1 GCA001648265_00958 CDS open 99779-101485 _na     568_aa site-specific DNA-methyltransferase (adenine-specific)
1824 LXSH01000016.1 GCA001648265_00959 CDS open 101478-101870 _na     130_aa yhcG YhcG N-terminal domain-containing protein
1825 LXSH01000016.1 GCA001648265_00960 CDS open 101882-104593 _na     903_aa DEAD/DEAH box helicase family protein
1826 LXSH01000016.1 GCA001648265_00961 CDS open 104693-105370 _na     225_aa cas5c type I-C CRISPR-associated protein Cas5c
1827 LXSH01000016.1 GCA001648265_00962 CDS open 105367-107145 _na     592_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
1828 LXSH01000016.1 GCA001648265_00963 CDS open 107157-108023 _na     288_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
1829 LXSH01000016.1 GCA001648265_00964 CDS open 108039-108689 _na     216_aa cas4 CRISPR-associated protein Cas4
1830 LXSH01000016.1 GCA001648265_00965 CDS open 108723-109718 _na     331_aa hypothetical protein
1831 LXSH01000016.1 GCA001648265_00966 CDS open 109898-110911 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
1832 LXSH01000016.1 GCA001648265_00967 CDS open 110986-111279 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
1833 LXSH01000016.1 GCA001648265_00968 CDS open 112967-113722 _na     251_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
1834 LXSH01000016.1 GCA001648265_00969 CDS open 113953-114168 _na     71_aa rpmE 50S ribosomal protein L31
1835 LXSH01000016.1 GCA001648265_00970 CDS open 114299-114898 _na     199_aa diphosphoinositol-polyphosphate diphosphatase
1836 LXSH01000016.1 GCA001648265_00971 CDS open 115108-116112 _na     334_aa dusB tRNA dihydrouridine synthase DusB
1837 LXSH01000016.1 GCA001648265_00972 CDS open 116214-116453 _na     79_aa fis DNA-binding transcriptional regulator Fis
1838 LXSH01000016.1 GCA001648265_00973 CDS open 116516-117004 _na     162_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
1839 LXSH01000016.1 GCA001648265_00974 CDS open 117250-117732 _na     160_aa ProQ/FinO domain-containing protein
1840 LXSH01000016.1 GCA001648265_00975 CDS open 117886-118965 _na     359_aa Tle cognate immunity protein 4 C-terminal domain-containing protein
1841 LXSH01000016.1 GCA001648265_00976 CDS open 119114-120457 _na     447_aa DUF4034 domain-containing protein
1842 LXSH01000016.1 GCA001648265_00977 CDS open 120626-121489 _na     287_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
1843 LXSH01000016.1 GCA001648265_00978 CDS open 121626-121859 _na     77_aa Colicin immunity protein
1844 LXSH01000016.1 GCA001648265_00979 CDS open 121872-122654 _na     260_aa trpA tryptophan synthase subunit alpha
1845 LXSH01000016.1 GCA001648265_00980 CDS open 122714-124069 _na     451_aa UPF0210 protein HMPREF0476_1016
1846 LXSH01000016.1 GCA001648265_00981 CDS open 124096-124908 _na     270_aa HTH OST-type domain-containing protein
1847 LXSH01000016.1 GCA001648265_00982 CDS open 125063-125353 _na     96_aa aCT ACT domain-containing protein
1848 LXSH01000016.1 GCA001648265_00983 CDS open 125451-126221 _na     256_aa phnD Phosphate ABC transporter substrate-binding protein
1849 LXSH01000016.1 GCA001648265_00986 CDS open 126946-127362 _na     138_aa dksA RNA polymerase-binding protein DksA
1850 LXSH01000016.1 GCA001648265_00987 CDS open 127455-128015 _na     186_aa YGGT family protein
1851 LXSH01000016.1 GCA001648265_00988 CDS open 128022-128816 _na     264_aa proC pyrroline-5-carboxylate reductase
1852 LXSH01000016.1 GCA001648265_00989 CDS open 128932-129477 _na     181_aa Knr4/Smi1-like domain-containing protein
1853 LXSH01000016.1 GCA001648265_00990 CDS open 129586-130287 _na     233_aa yggS Pyridoxal phosphate homeostasis protein
1854 LXSH01000016.1 GCA001648265_00991 CDS open 130287-131090 _na     267_aa nadE NH(3)-dependent NAD(+) synthetase
1855 LXSH01000016.1 GCA001648265_00992 CDS open 131098-131454 _na     118_aa Hexosyltransferase
1856 LXSH01000016.1 GCA001648265_00993 CDS open 131865-132401 _na     178_aa [ribosomal protein uS5]-alanine N-acetyltransferase
1857 LXSH01000016.1 GCA001648265_00994 CDS open 132428-132829 _na     133_aa gBBH Gamma-butyrobetaine hydroxylase-like N-terminal domain-containing protein
1858 LXSH01000016.1 GCA001648265_00995 CDS open 132817-133191 _na     124_aa Lipoprotein
1859 LXSH01000016.1 GCA001648265_00996 CDS open 133221-133577 _na     118_aa Lipoprotein
1860 LXSH01000016.1 GCA001648265_00997 CDS open 133608-134345 _na     245_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
1861 LXSH01000016.1 GCA001648265_00998 CDS open 134745-135320 _na     191_aa ISXO2-like transposase domain-containing protein
1862 LXSH01000016.1 GCA001648265_01001 CDS open 135925-138237 _na     770_aa rnr ribonuclease R
1863 LXSH01000016.1 GCA001648265_01002 CDS open 138622-139917 _na     431_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
1864 LXSH01000016.1 GCA001648265_01003 CDS open 140167-141351 _na     394_aa efeO iron uptake system protein EfeO
1865 LXSH01000016.1 GCA001648265_01004 CDS open 141376-142230 _na     284_aa efeU iron uptake transporter permease EfeU
1866 LXSH01000016.1 GCA001648265_01005 CDS open 142416-142802 _na     128_aa Lipoprotein
1867 LXSH01000016.1 GCA001648265_01006 CDS open 142952-143851 _na     299_aa prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
1868 LXSH01000016.1 GCA001648265_01007 CDS open 144430-146196 _na     588_aa recD exodeoxyribonuclease V subunit alpha
1869 LXSH01000016.1 GCA001648265_01008 CDS open 146544-147953 _na     469_aa leuC 3-isopropylmalate dehydratase large subunit
1870 LXSH01000016.1 GCA001648265_01009 CDS open 148098-148505 _na     135_aa Secreted protein
1871 LXSH01000016.1 GCA001648265_01010 CDS open 148557-149198 _na     213_aa dATP/dGTP diphosphohydrolase N-terminal domain-containing protein
1872 LXSH01000016.1 GCA001648265_01011 CDS open 149350-149538 _na     62_aa Entericidin EcnAB
1873 LXSH01000016.1 GCA001648265_01012 CDS open 149645-150286 _na     213_aa 3-isopropylmalate dehydratase small subunit
1874 LXSH01000016.1 GCA001648265_01013 CDS open 150375-150704 _na     109_aa PepSY domain-containing protein
1875 LXSH01000016.1 GCA001648265_01014 CDS open 150769-151137 _na     122_aa Pyrimidine dimer DNA glycosylase
1876 LXSH01000016.1 GCA001648265_01015 CDS open 151141-152097 _na     318_aa Nitroreductase domain-containing protein
1877 LXSH01000016.1 GCA001648265_01016 CDS open 152199-152870 _na     223_aa DUF2625 domain-containing protein
1878 LXSH01000016.1 GCA001648265_01017 CDS open 152904-153371 _na     155_aa YhcH/YjgK/YiaL family protein
1879 LXSH01000016.1 GCA001648265_01018 CDS open 153500-154342 _na     280_aa ytpQ DUF1444 domain-containing protein
1880 LXSH01000016.1 GCA001648265_01019 CDS open 154381-155226 _na     281_aa DUF1444 domain-containing protein
1881 LXSH01000016.1 GCA001648265_01020 CDS open 155304-156374 _na     356_aa leuB 3-isopropylmalate dehydrogenase
1882 LXSH01000016.1 GCA001648265_01021 CDS open 156457-156798 _na     113_aa phnA Alkylphosphonate utilization operon protein PhnA
1883 LXSH01000016.1 GCA001648265_01022 CDS open 156895-157998 _na     367_aa aroC chorismate synthase
1884 LXSH01000016.1 GCA001648265_01023 CDS open 158159-160039 _na     626_aa mutL DNA mismatch repair endonuclease MutL
1885 LXSH01000016.1 GCA001648265_01024 CDS open 160393-161283 _na     296_aa sucD succinate--CoA ligase subunit alpha
1886 LXSH01000016.1 GCA001648265_01025 CDS open 161294-162460 _na     388_aa sucC ADP-forming succinate--CoA ligase subunit beta
1887 LXSH01000016.1 GCA001648265_01026 CDS open 162920-163579 _na     219_aa dck Deoxynucleoside kinase domain-containing protein
1888 LXSH01000016.1 GCA001648265_01027 CDS open 163649-164143 _na     164_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1889 LXSH01000016.1 GCA001648265_01028 CDS open 164277-165650 _na     457_aa pcnB Poly(A) polymerase I
1890 LXSH01000016.1 GCA001648265_01029 CDS open 165810-165995 _na     61_aa DUF3460 domain-containing protein
1891 LXSH01000016.1 GCA001648265_01030 CDS open 166011-166703 _na     230_aa trmR O-methyltransferase
1892 LXSH01000016.1 GCA001648265_01031 CDS open 166694-167359 _na     221_aa cpoB Outer membrane lipoprotein BamD-like domain-containing protein
1893 LXSH01000016.1 GCA001648265_01032 CDS open 167434-169017 _na     527_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1894 LXSH01000016.1 GCA001648265_01033 CDS open 169124-169618 _na     164_aa DUF3828 domain-containing protein
1895 LXSH01000016.1 GCA001648265_01034 CDS open 169703-170419 _na     238_aa DUF6348 domain-containing protein
1896 LXSH01000016.1 GCA001648265_01035 CDS open 170498-171193 _na     231_aa ybhL BAX inhibitor protein
1897 LXSH01000016.1 GCA001648265_01036 CDS open 171399-172214 _na     271_aa aroE shikimate dehydrogenase
1898 LXSH01000016.1 GCA001648265_01037 CDS open 172395-172865 _na     156_aa queF preQ(1) synthase
1899 LXSH01000016.1 GCA001648265_01038 CDS open 172870-173148 _na     92_aa hypothetical protein
1900 LXSH01000016.1 GCA001648265_01039 CDS open 173228-173917 _na     229_aa Lipoprotein
1901 LXSH01000016.1 GCA001648265_01040 CDS open 174041-174760 _na     239_aa yhhQ 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter
1902 LXSH01000016.1 GCA001648265_01041 CDS open 175329-176006 _na     225_aa YgjP-like metallopeptidase domain-containing protein
1903 LXSH01000016.1 GCA001648265_01042 CDS open 176106-176606 _na     166_aa DUF3592 domain-containing protein
1904 LXSH01000016.1 GCA001648265_01043 CDS open 176757-177371 _na     204_aa prfH peptide chain release factor H
1905 LXSH01000016.1 GCA001648265_01044 CDS open 177375-178070 _na     231_aa hypothetical protein
1906 LXSH01000016.1 GCA001648265_01045 CDS open 178075-179214 _na     379_aa rtcB RNA ligase RtcB family protein
1907 LXSH01000016.1 GCA001648265_01046 CDS open 179661-180017 _na     118_aa Roadblock/LC7 domain-containing protein
1908 LXSH01000016.1 GCA001648265_01047 CDS open 180536-181378 _na     280_aa folP dihydropteroate synthase
1909 LXSH01000016.1 GCA001648265_01048 CDS open 181492-182724 _na     410_aa Major facilitator superfamily (MFS) profile domain-containing protein
1910 LXSH01000016.1 GCA001648265_01049 CDS open 182736-183143 _na     135_aa Extensin
1911 LXSH01000016.1 GCA001648265_01050 CDS open 183514-185553 _na     679_aa Vibriobactin receptor
1912 LXSH01000016.1 GCA001648265_01051 CDS open 185710-186297 _na     195_aa acrR HTH tetR-type domain-containing protein
1913 LXSH01000016.1 GCA001648265_01052 CDS open 186467-186694 _na     75_aa tusA Sulfurtransferase TusA
1914 LXSH01000016.1 GCA001648265_01053 CDS open 186815-187852 _na     345_aa pyrC dihydroorotase
1915 LXSH01000016.1 GCA001648265_01054 CDS open 187932-188699 _na     255_aa xth exodeoxyribonuclease III
1916 LXSH01000016.1 GCA001648265_01055 CDS open 188800-188994 _na     64_aa iscX Fe-S cluster assembly protein IscX
1917 LXSH01000016.1 GCA001648265_01056 CDS open 189049-189390 _na     113_aa fdx ISC system 2Fe-2S type ferredoxin
1918 LXSH01000016.1 GCA001648265_01057 CDS open 189494-190546 _na     350_aa mltB lytic murein transglycosylase B
1919 LXSH01000016.1 GCA001648265_01058 CDS open 190663-191940 _na     425_aa amiC N-acetylmuramoyl-L-alanine amidase
1920 LXSH01000016.1 GCA001648265_01059 CDS open 191910-192392 _na     160_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1921 LXSH01000016.1 GCA001648265_01060 CDS open 192479-193138 _na     219_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1922 LXSH01000016.1 GCA001648265_01061 CDS open 193236-193874 _na     212_aa cytC553 Cytochrome c domain-containing protein
1923 LXSH01000016.1 GCA001648265_01062 CDS open 194179-194532 _na     117_aa Bacterial OB-fold domain-containing protein
1924 LXSH01000016.1 GCA001648265_01063 CDS open 194716-195084 _na     122_aa ykoI PepSY domain-containing protein
1925 LXSH01000016.1 GCA001648265_01064 CDS open 195182-196000 _na     272_aa yktD Methyltransferase
1926 LXSH01000016.1 GCA001648265_01065 CDS open 196237-197340 _na     367_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
1927 LXSH01000016.1 GCA001648265_00862 gene open 414-1244 hisJ
1928 LXSH01000016.1 GCA001648265_00863 gene open 1409-1756 vOC
1929 LXSH01000016.1 GCA001648265_00864 gene open 1837-2586
1930 LXSH01000016.1 GCA001648265_00865 gene open 2704-3519 pflA
1931 LXSH01000016.1 GCA001648265_00866 gene open 3715-5994 pflB
1932 LXSH01000016.1 GCA001648265_00867 gene open 6346-6795
1933 LXSH01000016.1 GCA001648265_00869 gene open 6944-7504 efp
1934 LXSH01000016.1 GCA001648265_00870 gene open 7624-8121 yecA
1935 LXSH01000016.1 GCA001648265_00871 gene open 8206-8952 uppS
1936 LXSH01000016.1 GCA001648265_00872 gene open 9041-9598 frr
1937 LXSH01000016.1 GCA001648265_00873 gene open 9958-10440
1938 LXSH01000016.1 GCA001648265_00874 gene open 10546-11625 pheA
1939 LXSH01000016.1 GCA001648265_00875 gene open 11942-13195 murA
1940 LXSH01000016.1 GCA001648265_00876 gene open 13305-13589
1941 LXSH01000016.1 GCA001648265_00877 gene open 13857-14831 yheT
1942 LXSH01000016.1 GCA001648265_00878 gene open 14957-15670 pyrH
1943 LXSH01000016.1 GCA001648265_00879 gene open 16012-16482 dps
1944 LXSH01000016.1 GCA001648265_00880 gene open 16787-17191
1945 LXSH01000016.1 GCA001648265_00881 gene open 17483-18103 thiE
1946 LXSH01000016.1 GCA001648265_00882 gene open 18225-18971 rlmB
1947 LXSH01000016.1 GCA001648265_00883 gene open 18779-19330
1948 LXSH01000016.1 GCA001648265_00884 gene open 19467-20042 ubiX
1949 LXSH01000016.1 GCA001648265_00885 gene open 20371-21306 czcD
1950 LXSH01000016.1 GCA001648265_00886 gene open 21477-21908 ribN
1951 LXSH01000016.1 GCA001648265_00887 gene open 22151-23062 rssA
1952 LXSH01000016.1 GCA001648265_00888 gene open 23396-24367 rpfE
1953 LXSH01000016.1 GCA001648265_00890 gene open 25229-25435
1954 LXSH01000016.1 GCA001648265_00891 gene open 25543-25989
1955 LXSH01000016.1 GCA001648265_00892 gene open 26285-26710 rimP
1956 LXSH01000016.1 GCA001648265_00893 gene open 26747-28243 nusA
1957 LXSH01000016.1 GCA001648265_00894 gene open 28259-31024 infB
1958 LXSH01000016.1 GCA001648265_00895 gene open 31385-31717
1959 LXSH01000016.1 GCA001648265_00896 gene open 31741-32112 rbfA
1960 LXSH01000016.1 GCA001648265_00897 gene open 32225-33133 mMP0363
1961 LXSH01000016.1 GCA001648265_00898 gene open 33130-34038 mMP0362
1962 LXSH01000016.1 GCA001648265_00899 gene open 34109-34561 dut
1963 LXSH01000016.1 GCA001648265_00900 gene open 34673-35419 fabG
1964 LXSH01000016.1 GCA001648265_00901 gene open 35487-36413 fabD
1965 LXSH01000016.1 GCA001648265_00902 gene open 36676-38142 guaB
1966 LXSH01000016.1 GCA001648265_00903 gene open 38299-38766
1967 LXSH01000016.1 GCA001648265_00904 gene open 38838-40664 uvrC
1968 LXSH01000016.1 GCA001648265_00905 gene open 40676-41266 pgsA
1969 LXSH01000016.1 GCA001648265_00906 gene open 41496-42296
1970 LXSH01000016.1 GCA001648265_00907 gene open 42523-43341
1971 LXSH01000016.1 GCA001648265_00908 gene open 43510-44355
1972 LXSH01000016.1 GCA001648265_00909 gene open 44438-45691 hemX
1973 LXSH01000016.1 GCA001648265_00910 gene open 45688-46908 hemYx
1974 LXSH01000016.1 GCA001648265_00911 gene open 47155-48996 glmS
1975 LXSH01000016.1 GCA001648265_00912 gene open 49217-49693
1976 LXSH01000016.1 GCA001648265_00913 gene open 49794-50375 ruvA
1977 LXSH01000016.1 GCA001648265_00914 gene open 50543-51157 nadD
1978 LXSH01000016.1 GCA001648265_00915 gene open 51289-52698 pepB
1979 LXSH01000016.1 GCA001648265_00916 gene open 52794-53306
1980 LXSH01000016.1 GCA001648265_00917 gene open 53471-53836
1981 LXSH01000016.1 GCA001648265_00918 gene open 54010-54594 pgpB
1982 LXSH01000016.1 GCA001648265_00919 gene open 54910-56247 nCS2
1983 LXSH01000016.1 GCA001648265_00920 gene open 56411-57901 aes
1984 LXSH01000016.1 GCA001648265_00921 gene open 58014-58496
1985 LXSH01000016.1 GCA001648265_00922 gene open 58535-59860 miaB
1986 LXSH01000016.1 GCA001648265_00923 gene open 60053-60352
1987 LXSH01000016.1 GCA001648265_00924 gene open 60377-61822 nuoN
1988 LXSH01000016.1 GCA001648265_00925 gene open 61832-63334 nuoM
1989 LXSH01000016.1 GCA001648265_00926 gene open 63418-64581
1990 LXSH01000016.1 GCA001648265_00927 gene open 64665-64985 manC
1991 LXSH01000016.1 GCA001648265_00928 gene open 65039-67048 nuoL
1992 LXSH01000016.1 GCA001648265_00929 gene open 67166-67471 nuoK
1993 LXSH01000016.1 GCA001648265_00930 gene open 67468-68220 nuoJ
1994 LXSH01000016.1 GCA001648265_00931 gene open 68221-68967
1995 LXSH01000016.1 GCA001648265_00932 gene open 69037-69516 nuoI
1996 LXSH01000016.1 GCA001648265_00933 gene open 69571-69966
1997 LXSH01000016.1 GCA001648265_00934 gene open 70042-71115 nuoH
1998 LXSH01000016.1 GCA001648265_00935 gene open 71115-73370 nuoG
1999 LXSH01000016.1 GCA001648265_00936 gene open 73512-74807 nuoF
2000 LXSH01000016.1 GCA001648265_00937 gene open 74994-75467 nuoE