HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Brochothrix thermosphacta (GCA_001715655.1)

Select a Genome:
BAKTA Annotations for GCA_001715655.1
Genome Selected: Brochothrix thermosphacta
ContigsBases CDSrRNA tmRNAtRNA
41 2494302 2408 11 1 85
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5074 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 5074 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 MDLK01000026.1 GCA001715655_00496 CDS open 1906-2490 _na     194_aa leuD 3-isopropylmalate dehydratase small subunit
1002 MDLK01000026.1 GCA001715655_00497 CDS open 2477-3871 _na     464_aa leuC 3-isopropylmalate dehydratase large subunit
1003 MDLK01000026.1 GCA001715655_00498 CDS open 3871-4929 _na     352_aa leuB 3-isopropylmalate dehydrogenase
1004 MDLK01000026.1 GCA001715655_00499 CDS open 4929-6467 _na     512_aa leuA 2-isopropylmalate synthase
1005 MDLK01000026.1 GCA001715655_00500 CDS open 6618-7613 _na     331_aa ilvC ketol-acid reductoisomerase
1006 MDLK01000026.1 GCA001715655_00501 CDS open 7680-8150 _na     156_aa ilvN acetolactate synthase small subunit
1007 MDLK01000026.1 GCA001715655_00502 CDS open 8147-9844 _na     565_aa ilvB biosynthetic-type acetolactate synthase large subunit
1008 MDLK01000026.1 GCA001715655_00503 CDS open 9862-11550 _na     562_aa ilvD dihydroxy-acid dehydratase
1009 MDLK01000026.1 GCA001715655_00504 CDS open 12007-12207 _na     66_aa cspC Cold-shock protein
1010 MDLK01000026.1 GCA001715655_00505 CDS open 12571-13266 _na     231_aa pgpB PAP2 family protein
1011 MDLK01000026.1 GCA001715655_00506 CDS open 13382-14362 _na     326_aa dapF diaminopimelate epimerase
1012 MDLK01000026.1 GCA001715655_00507 CDS open 15095-17875 _na     926_aa ileS isoleucine--tRNA ligase
1013 MDLK01000026.1 GCA001715655_00508 CDS open 18157-18759 _na     200_aa divIVA Cell-division initiation protein
1014 MDLK01000026.1 GCA001715655_00509 CDS open 18875-19648 _na     257_aa ylmH Factor involved in shape determination%2C RNA-binding fold
1015 MDLK01000026.1 GCA001715655_00510 CDS open 19721-20002 _na     93_aa ycf19 Factor involved in shape determination and osmotic tolerance
1016 MDLK01000026.1 GCA001715655_00511 CDS open 20023-20520 _na     165_aa sepF Cell division protein SepF
1017 MDLK01000026.1 GCA001715655_00512 CDS open 20533-21207 _na     224_aa yggS Pyridoxal phosphate homeostasis protein
1018 MDLK01000026.1 GCA001715655_00513 CDS open 21219-22349 _na     376_aa ftsZ cell division protein FtsZ
1019 MDLK01000026.1 GCA001715655_00514 CDS open 22383-23642 _na     419_aa ftsA cell division protein FtsA
1020 MDLK01000026.1 GCA001715655_00515 CDS open 23789-24583 _na     264_aa ftsQ Cell division protein DivIB
1021 MDLK01000026.1 GCA001715655_00516 CDS open 24612-25703 _na     363_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1022 MDLK01000026.1 GCA001715655_00517 CDS open 25837-27189 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1023 MDLK01000026.1 GCA001715655_00518 CDS open 27191-28165 _na     324_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
1024 MDLK01000026.1 GCA001715655_00519 CDS open 28191-29657 _na     488_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
1025 MDLK01000026.1 GCA001715655_00520 CDS open 29694-31943 _na     749_aa pASTA Penicillin-binding protein
1026 MDLK01000026.1 GCA001715655_00521 CDS open 31940-32317 _na     125_aa ftsL cell division protein FtsL
1027 MDLK01000026.1 GCA001715655_00522 CDS open 32357-33292 _na     311_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1028 MDLK01000026.1 GCA001715655_00523 CDS open 33309-33740 _na     143_aa mraZ division/cell wall cluster transcriptional repressor MraZ
1029 MDLK01000026.1 GCA001715655_00524 CDS open 34044-34394 _na     116_aa DUF3397 domain-containing protein
1030 MDLK01000026.1 GCA001715655_00525 CDS open 34574-34753 _na     59_aa rpmF 50S ribosomal protein L32
1031 MDLK01000026.1 GCA001715655_00526 CDS open 34786-35325 _na     179_aa yceD DNA-binding protein
1032 MDLK01000026.1 GCA001715655_00527 CDS open 35491-36660 _na     389_aa tmcAL nucleotidyltransferase
1033 MDLK01000026.1 GCA001715655_00528 CDS open 36739-37797 _na     352_aa sdrC SepM family pheromone-processing serine protease
1034 MDLK01000026.1 GCA001715655_00529 CDS open 37794-38282 _na     162_aa coaD pantetheine-phosphate adenylyltransferase
1035 MDLK01000026.1 GCA001715655_00530 CDS open 38288-38842 _na     184_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1036 MDLK01000026.1 GCA001715655_00531 CDS open 38871-39149 _na     92_aa ylbG DUF2129 domain-containing protein
1037 MDLK01000026.1 GCA001715655_00532 CDS open 39163-39612 _na     149_aa ylbF Regulator
1038 MDLK01000026.1 GCA001715655_00533 CDS open 39674-40738 _na     354_aa ykwD CAP domain-containing protein
1039 MDLK01000026.1 GCA001715655_00534 CDS open 40808-41716 _na     302_aa cyoE heme o synthase
1040 MDLK01000026.1 GCA001715655_00535 CDS open 41923-42840 _na     305_aa ctaA Heme A synthase
1041 MDLK01000026.1 GCA001715655_00536 CDS open 43082-46516 _na     1144_aa pycA pyruvate carboxylase
1042 MDLK01000026.1 GCA001715655_00537 CDS open 46749-47924 _na     391_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1043 MDLK01000026.1 GCA001715655_00538 CDS open 48040-48318 _na     92_aa ylaN UPF0358 protein BTBSAS_30079
1044 MDLK01000026.1 GCA001715655_00539 CDS open 48780-50609 _na     609_aa typA translational GTPase TypA
1045 MDLK01000026.1 GCA001715655_00540 CDS open 50740-51534 _na     264_aa suhB Putative inositol-1-monophosphatase
1046 MDLK01000026.1 GCA001715655_00541 CDS open 51697-52314 _na     205_aa yktB UPF0637 protein BTBSAS_30076
1047 MDLK01000026.1 GCA001715655_00542 CDS open 52547-53491 _na     314_aa corA Magnesium transporter CorA family protein
1048 MDLK01000026.1 GCA001715655_00543 CDS open 53911-54564 _na     217_aa menH Alpha/beta hydrolase
1049 MDLK01000026.1 GCA001715655_00544 CDS open 54578-54847 _na     89_aa yktA UPF0223 protein
1050 MDLK01000026.1 GCA001715655_00545 CDS open 54972-55613 _na     213_aa yczE putative membrane protein YczE
1051 MDLK01000026.1 GCA001715655_00546 CDS open 55805-55993 _na     62_aa Isoleucyl-tRNA synthetase
1052 MDLK01000026.1 GCA001715655_00547 CDS open 56065-56316 _na     83_aa hypothetical protein
1053 MDLK01000026.1 GCA001715655_00548 CDS open 56395-56640 _na     81_aa rbbA ABC transporter ATP-binding protein
1054 MDLK01000026.1 GCA001715655_00549 CDS open 56645-57325 _na     226_aa ABC transporter permease
1055 MDLK01000026.1 GCA001715655_00550 CDS open 57716-59119 _na     467_aa lpdA dihydrolipoyl dehydrogenase
1056 MDLK01000026.1 GCA001715655_00551 CDS open 59123-60442 _na     439_aa aceF Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
1057 MDLK01000026.1 GCA001715655_00552 CDS open 60543-61520 _na     325_aa acoB Alpha-ketoacid dehydrogenase subunit beta
1058 MDLK01000026.1 GCA001715655_00553 CDS open 61522-62037 _na     171_aa 2-oxoisovalerate dehydrogenase subunit alpha
1059 MDLK01000026.1 GCA001715655_00554 CDS open 61997-62104 _na     35_aa hypothetical protein
1060 MDLK01000026.1 GCA001715655_00555 CDS open 62662-63213 _na     183_aa def peptide deformylase
1061 MDLK01000026.1 GCA001715655_00556 CDS open 63248-63886 _na     212_aa traX Conjugal transfer protein TraX
1062 MDLK01000026.1 GCA001715655_00557 CDS open 63905-65092 _na     395_aa gshA Glutamate--cysteine ligase
1063 MDLK01000026.1 GCA001715655_00558 CDS open 65300-66949 _na     549_aa oppA Peptide ABC transporter substrate-binding protein
1064 MDLK01000026.1 GCA001715655_00559 CDS open 67217-67882 _na     221_aa rex redox-sensing transcriptional repressor Rex
1065 MDLK01000026.1 GCA001715655_00560 CDS open 68044-69972 _na     642_aa abc-f ribosomal protection-like ABC-F family protein
1066 MDLK01000026.1 GCA001715655_00561 CDS open 70095-71033 _na     312_aa DUF4097 domain-containing protein
1067 MDLK01000026.1 GCA001715655_00562 CDS open 71030-71632 _na     200_aa DUF1700 domain-containing protein
1068 MDLK01000026.1 GCA001715655_00563 CDS open 71625-71945 _na     106_aa padR PadR family transcriptional regulator
1069 MDLK01000026.1 GCA001715655_00564 CDS open 72115-73266 _na     383_aa ABC transporter permease
1070 MDLK01000026.1 GCA001715655_00565 CDS open 73259-74134 _na     291_aa rbbA ABC transporter ATP-binding protein
1071 MDLK01000026.1 GCA001715655_00566 CDS open 74151-74438 _na     95_aa hypothetical protein
1072 MDLK01000026.1 GCA001715655_00567 CDS open 74743-75765 _na     340_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1073 MDLK01000026.1 GCA001715655_00568 CDS open 75777-77162 _na     461_aa fumC class II fumarate hydratase
1074 MDLK01000026.1 GCA001715655_00569 CDS open 77167-77640 _na     157_aa rimI ribosomal protein S18-alanine N-acetyltransferase
1075 MDLK01000026.1 GCA001715655_00570 CDS open 77640-78344 _na     234_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1076 MDLK01000026.1 GCA001715655_00571 CDS open 78338-78793 _na     151_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1077 MDLK01000026.1 GCA001715655_00572 CDS open 78863-80029 _na     388_aa ftsW Rod shape-determining protein RodA
1078 MDLK01000026.1 GCA001715655_00573 CDS open 80281-81492 _na     403_aa metL1 aspartate kinase
1079 MDLK01000026.1 GCA001715655_00574 CDS open 81858-83021 _na     387_aa argD acetylornithine transaminase
1080 MDLK01000026.1 GCA001715655_00575 CDS open 83022-83771 _na     249_aa argB Acetylglutamate kinase
1081 MDLK01000026.1 GCA001715655_00576 CDS open 83786-84988 _na     400_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
1082 MDLK01000026.1 GCA001715655_00577 CDS open 85004-86029 _na     341_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
1083 MDLK01000026.1 GCA001715655_00578 CDS open 86189-87961 _na     590_aa uvrC excinuclease ABC subunit UvrC
1084 MDLK01000026.1 GCA001715655_00579 CDS open 88134-89120 _na     328_aa hypothetical protein
1085 MDLK01000026.1 GCA001715655_00580 CDS open 89327-89470 _na     47_aa hypothetical protein
1086 MDLK01000026.1 GCA001715655_00581 CDS open 89715-90263 _na     182_aa Lipoprotein
1087 MDLK01000026.1 GCA001715655_00582 CDS open 90282-90794 _na     170_aa Peptidase M10 metallopeptidase domain-containing protein
1088 MDLK01000026.1 GCA001715655_00583 CDS open 91047-91364 _na     105_aa trxA thioredoxin
1089 MDLK01000026.1 GCA001715655_00584 CDS open 91486-93840 _na     784_aa rqcU endonuclease MutS2
1090 MDLK01000026.1 GCA001715655_00585 CDS open 93865-94392 _na     175_aa cvpA Colicin V production membrane protein%2C CvpA
1091 MDLK01000026.1 GCA001715655_00586 CDS open 94610-95212 _na     200_aa fMR2 Nitroreductase domain-containing protein
1092 MDLK01000026.1 GCA001715655_00587 CDS open 95288-97696 _na     802_aa pheT phenylalanine--tRNA ligase subunit beta
1093 MDLK01000026.1 GCA001715655_00588 CDS open 97709-98752 _na     347_aa pheS phenylalanine--tRNA ligase subunit alpha
1094 MDLK01000026.1 GCA001715655_00589 CDS open 99078-99419 _na     113_aa hxlR Transcriptional regulator
1095 MDLK01000026.1 GCA001715655_00590 CDS open 99514-99978 _na     154_aa dut dUTP diphosphatase
1096 MDLK01000026.1 GCA001715655_00591 CDS open 99980-100762 _na     260_aa spoU RNA methyltransferase
1097 MDLK01000026.1 GCA001715655_00592 CDS open 100907-101275 _na     122_aa ysdB Sigma-w pathway protein ysdB
1098 MDLK01000026.1 GCA001715655_00593 CDS open 101701-102774 _na     357_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
1099 MDLK01000026.1 GCA001715655_00594 CDS open 102786-104951 _na     721_aa yrdD DNA topoisomerase 3
1100 MDLK01000026.1 GCA001715655_00595 CDS open 105158-106627 _na     489_aa LPXTG cell wall anchor domain-containing protein
1101 MDLK01000026.1 GCA001715655_00596 CDS open 106876-107409 _na     177_aa Stage II sporulation protein M
1102 MDLK01000026.1 GCA001715655_00597 CDS open 107743-108702 _na     319_aa FIVAR domain-containing protein
1103 MDLK01000026.1 GCA001715655_00598 CDS open 108705-108830 _na     41_aa hypothetical protein
1104 MDLK01000026.1 GCA001715655_00599 CDS open 110109-110609 _na     166_aa ISL3 family transposase
1105 MDLK01000026.1 GCA001715655_00495 gene open 651-1901 ilvA
1106 MDLK01000026.1 GCA001715655_00496 gene open 1906-2490 leuD
1107 MDLK01000026.1 GCA001715655_00497 gene open 2477-3871 leuC
1108 MDLK01000026.1 GCA001715655_00498 gene open 3871-4929 leuB
1109 MDLK01000026.1 GCA001715655_00499 gene open 4929-6467 leuA
1110 MDLK01000026.1 GCA001715655_00500 gene open 6618-7613 ilvC
1111 MDLK01000026.1 GCA001715655_00501 gene open 7680-8150 ilvN
1112 MDLK01000026.1 GCA001715655_00502 gene open 8147-9844 ilvB
1113 MDLK01000026.1 GCA001715655_00503 gene open 9862-11550 ilvD
1114 MDLK01000026.1 GCA001715655_00504 gene open 12007-12207 cspC
1115 MDLK01000026.1 GCA001715655_00505 gene open 12571-13266 pgpB
1116 MDLK01000026.1 GCA001715655_00506 gene open 13382-14362 dapF
1117 MDLK01000026.1 GCA001715655_00507 gene open 15095-17875 ileS
1118 MDLK01000026.1 GCA001715655_00508 gene open 18157-18759 divIVA
1119 MDLK01000026.1 GCA001715655_00509 gene open 18875-19648 ylmH
1120 MDLK01000026.1 GCA001715655_00510 gene open 19721-20002 ycf19
1121 MDLK01000026.1 GCA001715655_00511 gene open 20023-20520 sepF
1122 MDLK01000026.1 GCA001715655_00512 gene open 20533-21207 yggS
1123 MDLK01000026.1 GCA001715655_00513 gene open 21219-22349 ftsZ
1124 MDLK01000026.1 GCA001715655_00514 gene open 22383-23642 ftsA
1125 MDLK01000026.1 GCA001715655_00515 gene open 23789-24583 ftsQ
1126 MDLK01000026.1 GCA001715655_00516 gene open 24612-25703 murG
1127 MDLK01000026.1 GCA001715655_00517 gene open 25837-27189 murD
1128 MDLK01000026.1 GCA001715655_00518 gene open 27191-28165 mraY
1129 MDLK01000026.1 GCA001715655_00519 gene open 28191-29657 murE
1130 MDLK01000026.1 GCA001715655_00520 gene open 29694-31943 pASTA
1131 MDLK01000026.1 GCA001715655_00521 gene open 31940-32317 ftsL
1132 MDLK01000026.1 GCA001715655_00522 gene open 32357-33292 rsmH
1133 MDLK01000026.1 GCA001715655_00523 gene open 33309-33740 mraZ
1134 MDLK01000026.1 GCA001715655_00524 gene open 34044-34394
1135 MDLK01000026.1 GCA001715655_00525 gene open 34574-34753 rpmF
1136 MDLK01000026.1 GCA001715655_00526 gene open 34786-35325 yceD
1137 MDLK01000026.1 GCA001715655_00527 gene open 35491-36660 tmcAL
1138 MDLK01000026.1 GCA001715655_00528 gene open 36739-37797 sdrC
1139 MDLK01000026.1 GCA001715655_00529 gene open 37794-38282 coaD
1140 MDLK01000026.1 GCA001715655_00530 gene open 38288-38842 rsmD
1141 MDLK01000026.1 GCA001715655_00531 gene open 38871-39149 ylbG
1142 MDLK01000026.1 GCA001715655_00532 gene open 39163-39612 ylbF
1143 MDLK01000026.1 GCA001715655_00533 gene open 39674-40738 ykwD
1144 MDLK01000026.1 GCA001715655_00534 gene open 40808-41716 cyoE
1145 MDLK01000026.1 GCA001715655_00535 gene open 41923-42840 ctaA
1146 MDLK01000026.1 GCA001715655_00536 gene open 43082-46516 pycA
1147 MDLK01000026.1 GCA001715655_00537 gene open 46749-47924 ftsW
1148 MDLK01000026.1 GCA001715655_00538 gene open 48040-48318 ylaN
1149 MDLK01000026.1 GCA001715655_00539 gene open 48780-50609 typA
1150 MDLK01000026.1 GCA001715655_00540 gene open 50740-51534 suhB
1151 MDLK01000026.1 GCA001715655_00541 gene open 51697-52314 yktB
1152 MDLK01000026.1 GCA001715655_00542 gene open 52547-53491 corA
1153 MDLK01000026.1 GCA001715655_00543 gene open 53911-54564 menH
1154 MDLK01000026.1 GCA001715655_00544 gene open 54578-54847 yktA
1155 MDLK01000026.1 GCA001715655_00545 gene open 54972-55613 yczE
1156 MDLK01000026.1 GCA001715655_00546 gene open 55805-55993
1157 MDLK01000026.1 GCA001715655_00547 gene open 56065-56316
1158 MDLK01000026.1 GCA001715655_00548 gene open 56395-56640 rbbA
1159 MDLK01000026.1 GCA001715655_00549 gene open 56645-57325
1160 MDLK01000026.1 GCA001715655_00550 gene open 57716-59119 lpdA
1161 MDLK01000026.1 GCA001715655_00551 gene open 59123-60442 aceF
1162 MDLK01000026.1 GCA001715655_00552 gene open 60543-61520 acoB
1163 MDLK01000026.1 GCA001715655_00553 gene open 61522-62037
1164 MDLK01000026.1 GCA001715655_00554 gene open 61997-62104
1165 MDLK01000026.1 GCA001715655_00555 gene open 62662-63213 def
1166 MDLK01000026.1 GCA001715655_00556 gene open 63248-63886 traX
1167 MDLK01000026.1 GCA001715655_00557 gene open 63905-65092 gshA
1168 MDLK01000026.1 GCA001715655_00558 gene open 65300-66949 oppA
1169 MDLK01000026.1 GCA001715655_00559 gene open 67217-67882 rex
1170 MDLK01000026.1 GCA001715655_00560 gene open 68044-69972 abc-f
1171 MDLK01000026.1 GCA001715655_00561 gene open 70095-71033
1172 MDLK01000026.1 GCA001715655_00562 gene open 71030-71632
1173 MDLK01000026.1 GCA001715655_00563 gene open 71625-71945 padR
1174 MDLK01000026.1 GCA001715655_00564 gene open 72115-73266
1175 MDLK01000026.1 GCA001715655_00565 gene open 73259-74134 rbbA
1176 MDLK01000026.1 GCA001715655_00566 gene open 74151-74438
1177 MDLK01000026.1 GCA001715655_00567 gene open 74743-75765 tsaD
1178 MDLK01000026.1 GCA001715655_00568 gene open 75777-77162 fumC
1179 MDLK01000026.1 GCA001715655_00569 gene open 77167-77640 rimI
1180 MDLK01000026.1 GCA001715655_00570 gene open 77640-78344 tsaB
1181 MDLK01000026.1 GCA001715655_00571 gene open 78338-78793 tsaE
1182 MDLK01000026.1 GCA001715655_00572 gene open 78863-80029 ftsW
1183 MDLK01000026.1 GCA001715655_00573 gene open 80281-81492 metL1
1184 MDLK01000026.1 GCA001715655_00574 gene open 81858-83021 argD
1185 MDLK01000026.1 GCA001715655_00575 gene open 83022-83771 argB
1186 MDLK01000026.1 GCA001715655_00576 gene open 83786-84988 argJ
1187 MDLK01000026.1 GCA001715655_00577 gene open 85004-86029 argC
1188 MDLK01000026.1 GCA001715655_00578 gene open 86189-87961 uvrC
1189 MDLK01000026.1 GCA001715655_00579 gene open 88134-89120
1190 MDLK01000026.1 GCA001715655_00580 gene open 89327-89470
1191 MDLK01000026.1 GCA001715655_00581 gene open 89715-90263
1192 MDLK01000026.1 GCA001715655_00582 gene open 90282-90794
1193 MDLK01000026.1 GCA001715655_00583 gene open 91047-91364 trxA
1194 MDLK01000026.1 GCA001715655_00584 gene open 91486-93840 rqcU
1195 MDLK01000026.1 GCA001715655_00585 gene open 93865-94392 cvpA
1196 MDLK01000026.1 GCA001715655_00586 gene open 94610-95212 fMR2
1197 MDLK01000026.1 GCA001715655_00587 gene open 95288-97696 pheT
1198 MDLK01000026.1 GCA001715655_00588 gene open 97709-98752 pheS
1199 MDLK01000026.1 GCA001715655_00589 gene open 99078-99419 hxlR
1200 MDLK01000026.1 GCA001715655_00590 gene open 99514-99978 dut
1201 MDLK01000026.1 GCA001715655_00591 gene open 99980-100762 spoU
1202 MDLK01000026.1 GCA001715655_00592 gene open 100907-101275 ysdB
1203 MDLK01000026.1 GCA001715655_00593 gene open 101701-102774 fni
1204 MDLK01000026.1 GCA001715655_00594 gene open 102786-104951 yrdD
1205 MDLK01000026.1 GCA001715655_00595 gene open 105158-106627
1206 MDLK01000026.1 GCA001715655_00596 gene open 106876-107409
1207 MDLK01000026.1 GCA001715655_00597 gene open 107743-108702
1208 MDLK01000026.1 GCA001715655_00598 gene open 108705-108830
1209 MDLK01000026.1 GCA001715655_00599 gene open 110109-110609
1210 MDLK01000027.1 GCA001715655_00610 gene open 12112-12297 ncr1575
1211 MDLK01000027.1 GCA001715655_00627 gene open 29192-29475 rliD
1212 MDLK01000027.1 GCA001715655_00685 gene open 89473-89656 rli28
1213 MDLK01000027.1 GCA001715655_00610 ncRNA open 12112-12297 Bacillus sRNA ncr1575
1214 MDLK01000027.1 GCA001715655_00627 ncRNA open 29192-29475 rliD Listeria sRNA rliD
1215 MDLK01000027.1 GCA001715655_00685 ncRNA open 89473-89656 Listeria sRNA rli28
1216 MDLK01000027.1 repeat_region open 5950-6279 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTTTAGAGCTGTGTTAAATTGAATGGTATTAAAAC and spacer length 30
1217 MDLK01000027.1 GCA001715655_00600 CDS open 104-4006 _na     1300_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1218 MDLK01000027.1 GCA001715655_00601 CDS open 4022-4894 _na     290_aa cas1 type II CRISPR-associated endonuclease Cas1
1219 MDLK01000027.1 GCA001715655_00602 CDS open 4906-5211 _na     101_aa CRISPR-associated endoribonuclease Cas2
1220 MDLK01000027.1 GCA001715655_00603 CDS open 5208-5891 _na     227_aa csn2 type II-A CRISPR-associated protein Csn2
1221 MDLK01000027.1 GCA001715655_00604 CDS open 6462-8081 _na     539_aa bH3996 GIY-YIG domain-containing protein
1222 MDLK01000027.1 GCA001715655_00605 CDS open 8143-8940 _na     265_aa DUF1129 domain-containing protein
1223 MDLK01000027.1 GCA001715655_00606 CDS open 8921-9283 _na     120_aa padR PadR family transcriptional regulator
1224 MDLK01000027.1 GCA001715655_00607 CDS open 9445-9660 _na     71_aa DUF2768 domain-containing protein
1225 MDLK01000027.1 GCA001715655_00608 CDS open 9675-10112 _na     145_aa GNAT family N-acetyltransferase
1226 MDLK01000027.1 GCA001715655_00609 CDS open 10178-11941 _na     587_aa ParB/Srx family N-terminal domain-containing protein
1227 MDLK01000027.1 GCA001715655_00611 CDS open 12322-13953 _na     543_aa abc-f ribosomal protection-like ABC-F family protein
1228 MDLK01000027.1 GCA001715655_00612 CDS open 14090-14467 _na     125_aa DUF3168 domain-containing protein
1229 MDLK01000027.1 GCA001715655_00613 CDS open 14858-19177 _na     1439_aa polC PolC-type DNA polymerase III
1230 MDLK01000027.1 GCA001715655_00614 CDS open 19521-20090 _na     189_aa amaP alkaline shock response membrane anchor protein AmaP
1231 MDLK01000027.1 GCA001715655_00615 CDS open 20109-20285 _na     58_aa DUF2273 domain-containing protein
1232 MDLK01000027.1 GCA001715655_00616 CDS open 20306-20851 _na     181_aa yloU Alkaline shock protein 23
1233 MDLK01000027.1 GCA001715655_00617 CDS open 20907-21092 _na     61_aa hypothetical protein
1234 MDLK01000027.1 GCA001715655_00618 CDS open 21598-22053 _na     151_aa rimP ribosome maturation factor RimP
1235 MDLK01000027.1 GCA001715655_00619 CDS open 22087-23280 _na     397_aa nusA Transcription termination/antitermination protein NusA
1236 MDLK01000027.1 GCA001715655_00620 CDS open 23301-23582 _na     93_aa rnpM RNase P modulator RnpM
1237 MDLK01000027.1 GCA001715655_00621 CDS open 23572-23883 _na     103_aa rpl7Ae K-turn RNA binding protein
1238 MDLK01000027.1 GCA001715655_00622 CDS open 23898-26231 _na     777_aa infB translation initiation factor IF-2
1239 MDLK01000027.1 GCA001715655_00623 CDS open 26297-26644 _na     115_aa rbfA 30S ribosome-binding factor RbfA
1240 MDLK01000027.1 GCA001715655_00624 CDS open 26726-27655 _na     309_aa truB tRNA pseudouridine(55) synthase TruB
1241 MDLK01000027.1 GCA001715655_00625 CDS open 27689-28639 _na     316_aa ribF bifunctional riboflavin kinase/FAD synthetase
1242 MDLK01000027.1 GCA001715655_00626 CDS open 28780-29049 _na     89_aa rpsO 30S ribosomal protein S15
1243 MDLK01000027.1 GCA001715655_00628 CDS open 29298-31409 _na     703_aa pnp polyribonucleotide nucleotidyltransferase
1244 MDLK01000027.1 GCA001715655_00629 CDS open 31767-32195 _na     142_aa hypothetical protein
1245 MDLK01000027.1 GCA001715655_00630 CDS open 32319-32420 _na     33_aa hypothetical protein
1246 MDLK01000027.1 GCA001715655_00631 CDS open 32741-33016 _na     91_aa yidJ GNAT family N-acetyltransferase
1247 MDLK01000027.1 GCA001715655_00632 CDS open 33131-33571 _na     146_aa yciW Carboxymuconolactone decarboxylase family protein
1248 MDLK01000027.1 GCA001715655_00633 CDS open 33630-34523 _na     297_aa rhaT Putative permease
1249 MDLK01000027.1 GCA001715655_00634 CDS open 34714-36000 _na     428_aa gntR GntR family transcriptional regulator
1250 MDLK01000027.1 GCA001715655_00635 CDS open 36138-37178 _na     346_aa asd aspartate-semialdehyde dehydrogenase
1251 MDLK01000027.1 GCA001715655_00636 CDS open 37209-38423 _na     404_aa dapG aspartate kinase
1252 MDLK01000027.1 GCA001715655_00637 CDS open 38459-39343 _na     294_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
1253 MDLK01000027.1 GCA001715655_00638 CDS open 39381-41057 _na     558_aa rnjA Ribonuclease J
1254 MDLK01000027.1 GCA001715655_00639 CDS open 41124-41690 _na     188_aa tag 3-methyl-adenine DNA glycosylase I%2C constitutive
1255 MDLK01000027.1 GCA001715655_00640 CDS open 41873-43462 _na     529_aa uup ABC transporter ATP-binding protein
1256 MDLK01000027.1 GCA001715655_00641 CDS open 43692-44420 _na     242_aa glnQ Amino acid ABC transporter ATP-binding protein
1257 MDLK01000027.1 GCA001715655_00642 CDS open 44436-45221 _na     261_aa hisJ Glutamine ABC transporter (Glutamine-binding lipoprotein)
1258 MDLK01000027.1 GCA001715655_00643 CDS open 45237-45884 _na     215_aa hisM Amino acid ABC transporter permease
1259 MDLK01000027.1 GCA001715655_00644 CDS open 45897-46547 _na     216_aa hisM Amino acid ABC transporter permease
1260 MDLK01000027.1 GCA001715655_00645 CDS open 46678-47505 _na     275_aa hypothetical protein
1261 MDLK01000027.1 GCA001715655_00646 CDS open 47611-48534 _na     307_aa murB UDP-N-acetylmuramate dehydrogenase
1262 MDLK01000027.1 GCA001715655_00647 CDS open 49225-50340 _na     371_aa ald alanine dehydrogenase
1263 MDLK01000027.1 GCA001715655_00648 CDS open 50343-51722 _na     459_aa ansP Putative amino acid permease
1264 MDLK01000027.1 GCA001715655_00649 CDS open 52726-53016 _na     96_aa IS30 family transposase
1265 MDLK01000027.1 GCA001715655_00650 CDS open 53097-53480 _na     127_aa Resolvase
1266 MDLK01000027.1 GCA001715655_00651 CDS open 53531-53620 _na     29_aa hypothetical protein
1267 MDLK01000027.1 GCA001715655_00652 CDS open 53873-54145 _na     90_aa hypothetical protein
1268 MDLK01000027.1 GCA001715655_00653 CDS open 54369-54599 _na     76_aa hypothetical protein
1269 MDLK01000027.1 GCA001715655_00654 CDS open 54621-55412 _na     263_aa hypothetical protein
1270 MDLK01000027.1 GCA001715655_00655 CDS open 56084-56872 _na     262_aa menH AB hydrolase-1 domain-containing protein
1271 MDLK01000027.1 GCA001715655_00656 CDS open 57913-58620 _na     235_aa talA transaldolase
1272 MDLK01000027.1 GCA001715655_00657 CDS open 58942-59853 _na     303_aa aes Putative Esterase/lipase
1273 MDLK01000027.1 GCA001715655_00658 CDS open 59915-60463 _na     182_aa pncA Isochorismatase
1274 MDLK01000027.1 GCA001715655_00659 CDS open 60518-61942 _na     474_aa aRO8 PLP-dependent aminotransferase family protein
1275 MDLK01000027.1 GCA001715655_00660 CDS open 62068-62955 _na     295_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
1276 MDLK01000027.1 GCA001715655_00661 CDS open 62957-63526 _na     189_aa pdxT pyridoxal 5'-phosphate synthase glutaminase subunit PdxT
1277 MDLK01000027.1 GCA001715655_00662 CDS open 63896-64546 _na     216_aa hP0602 Deoxyribonuclease I
1278 MDLK01000027.1 GCA001715655_00663 CDS open 64606-65514 _na     302_aa alkA DNA-3-methyladenine glycosylase II
1279 MDLK01000027.1 GCA001715655_00664 CDS open 65727-65885 _na     52_aa hypothetical protein
1280 MDLK01000027.1 GCA001715655_00665 CDS open 66460-67164 _na     234_aa lytT DNA-binding response regulator
1281 MDLK01000027.1 GCA001715655_00666 CDS open 67161-68474 _na     437_aa citA GHKL domain-containing protein
1282 MDLK01000027.1 GCA001715655_00667 CDS open 68536-69273 _na     245_aa agrC Accessory regulator AgrC
1283 MDLK01000027.1 GCA001715655_00668 CDS open 69242-69958 _na     238_aa rbbA ABC transporter ATP-binding protein
1284 MDLK01000027.1 GCA001715655_00669 CDS open 69967-70722 _na     251_aa tagG ABC transporter
1285 MDLK01000027.1 GCA001715655_00670 CDS open 70703-71644 _na     313_aa rbbA Putative ABC transporter%2C ATPase component
1286 MDLK01000027.1 GCA001715655_00671 CDS open 72309-73298 _na     329_aa dAP2 Alpha/beta hydrolase
1287 MDLK01000027.1 GCA001715655_00672 CDS open 73409-74131 _na     240_aa soxR HTH merR-type domain-containing protein
1288 MDLK01000027.1 GCA001715655_00673 CDS open 74881-75087 _na     68_aa DUF3976 domain-containing protein
1289 MDLK01000027.1 GCA001715655_00674 CDS open 75205-77001 _na     598_aa lolE Macrolide ABC transporter ATP-binding protein/permease
1290 MDLK01000027.1 GCA001715655_00675 CDS open 77001-78944 _na     647_aa lolD Macrolide ABC transporter ATP-binding protein/permease
1291 MDLK01000027.1 GCA001715655_00676 CDS open 79021-80199 _na     392_aa kdpD histidine kinase
1292 MDLK01000027.1 GCA001715655_00677 CDS open 80192-80881 _na     229_aa ompR DNA-binding response regulator
1293 MDLK01000027.1 GCA001715655_00678 CDS open 81076-82932 _na     618_aa mutL DNA mismatch repair endonuclease MutL
1294 MDLK01000027.1 GCA001715655_00679 CDS open 83063-85711 _na     882_aa mutS DNA mismatch repair protein MutS
1295 MDLK01000027.1 GCA001715655_00680 CDS open 85727-86095 _na     122_aa ymcA Master regulator for biofilm formation via regulation of RNase Y
1296 MDLK01000027.1 GCA001715655_00681 CDS open 86106-86906 _na     266_aa ymdB 2'3' and 3'5' cyclic nucleotide monophosphates phosphodiesterase involved in biofilm formation
1297 MDLK01000027.1 GCA001715655_00682 CDS open 87084-87806 _na     240_aa ppiB Peptidyl-prolyl cis-trans isomerase
1298 MDLK01000027.1 GCA001715655_00683 CDS open 88419-88691 _na     90_aa YdhG-like domain-containing protein
1299 MDLK01000027.1 GCA001715655_00684 CDS open 88982-89257 _na     91_aa hypothetical protein
1300 MDLK01000027.1 GCA001715655_00686 CDS open 90130-91461 _na     443_aa glnA type I glutamate--ammonia ligase
1301 MDLK01000027.1 GCA001715655_00687 CDS open 91493-91852 _na     119_aa soxR Transcriptional regulator (Nitrogen metabolism)
1302 MDLK01000027.1 GCA001715655_00688 CDS open 92056-92988 _na     310_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1303 MDLK01000027.1 GCA001715655_00689 CDS open 92981-93712 _na     243_aa ugpQ Putative glycerophosphodiester phosphodiesterase
1304 MDLK01000027.1 GCA001715655_00690 CDS open 93730-96159 _na     809_aa parC DNA topoisomerase IV subunit A
1305 MDLK01000027.1 GCA001715655_00691 CDS open 96146-98125 _na     659_aa parE DNA topoisomerase IV subunit B
1306 MDLK01000027.1 GCA001715655_00692 CDS open 98643-99254 _na     203_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1307 MDLK01000027.1 GCA001715655_00693 CDS open 99380-100579 _na     399_aa galM Aldose 1-epimerase family protein
1308 MDLK01000027.1 GCA001715655_00694 CDS open 100580-101002 _na     140_aa fadM Acyl-CoA thioesterase
1309 MDLK01000027.1 GCA001715655_00695 CDS open 101130-101912 _na     260_aa codY GTP-sensing pleiotropic transcriptional regulator CodY
1310 MDLK01000027.1 GCA001715655_00696 CDS open 102139-103044 _na     301_aa xerC tyrosine recombinase XerC
1311 MDLK01000027.1 GCA001715655_00697 CDS open 103191-105269 _na     692_aa topA type I DNA topoisomerase
1312 MDLK01000027.1 GCA001715655_00698 CDS open 105605-106387 _na     260_aa dprA DNA-processing protein DprA
1313 MDLK01000027.1 GCA001715655_00699 CDS open 106465-107238 _na     257_aa rnhB ribonuclease HII
1314 MDLK01000027.1 GCA001715655_00700 CDS open 107222-108118 _na     298_aa ylqF ribosome biogenesis GTPase YlqF
1315 MDLK01000027.1 GCA001715655_00701 CDS open 108130-108660 _na     176_aa lepB signal peptidase I
1316 MDLK01000027.1 GCA001715655_00702 CDS open 108939-109445 _na     168_aa lepB signal peptidase I
1317 MDLK01000027.1 GCA001715655_00703 CDS open 109683-110177 _na     164_aa cysC Uridine kinase
1318 MDLK01000027.1 GCA001715655_00704 CDS open 110513-111382 _na     289_aa lysR LysR family transcriptional regulator
1319 MDLK01000027.1 GCA001715655_00705 CDS open 111940-112227 _na     95_aa lysR LysR family transcriptional regulator
1320 MDLK01000027.1 GCA001715655_00706 CDS open 112252-112608 _na     118_aa hypothetical protein
1321 MDLK01000027.1 GCA001715655_00707 CDS open 113043-113852 _na     269_aa cof Hydrolase
1322 MDLK01000027.1 GCA001715655_00708 CDS open 114049-115035 _na     328_aa nagC ROK family protein
1323 MDLK01000027.1 GCA001715655_00709 CDS open 115142-116107 _na     321_aa ldhA Putative hydroxypyruvate reductase%2C NAD(P)H-dependent
1324 MDLK01000027.1 GCA001715655_00710 CDS open 116296-117327 _na     343_aa kdpD histidine kinase
1325 MDLK01000027.1 GCA001715655_00711 CDS open 117324-118013 _na     229_aa ompR DNA-binding response regulator
1326 MDLK01000027.1 GCA001715655_00712 CDS open 118092-118538 _na     148_aa doxX DoxX family protein
1327 MDLK01000027.1 GCA001715655_00713 CDS open 118539-119282 _na     247_aa DM13 domain-containing protein
1328 MDLK01000027.1 GCA001715655_00714 CDS open 119486-119944 _na     152_aa Immunity protein 50
1329 MDLK01000027.1 GCA001715655_00715 CDS open 119978-120346 _na     122_aa yccF YccF domain-containing protein
1330 MDLK01000027.1 GCA001715655_00716 CDS open 120590-122665 _na     691_aa hypothetical protein
1331 MDLK01000027.1 GCA001715655_00717 CDS open 122681-123913 _na     410_aa rtcB 3'-phosphate/5'-hydroxy nucleic acid ligase
1332 MDLK01000027.1 GCA001715655_00718 CDS open 124056-125297 _na     413_aa WYL domain-containing protein
1333 MDLK01000027.1 GCA001715655_00719 CDS open 125290-126267 _na     325_aa WYL domain-containing protein
1334 MDLK01000027.1 GCA001715655_00720 CDS open 126777-127121 _na     114_aa rplS 50S ribosomal protein L19
1335 MDLK01000027.1 GCA001715655_00721 CDS open 127253-128002 _na     249_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
1336 MDLK01000027.1 GCA001715655_00722 CDS open 128002-128520 _na     172_aa rimM ribosome maturation factor RimM
1337 MDLK01000027.1 GCA001715655_00723 CDS open 128527-128919 _na     130_aa ylqD YlqD protein
1338 MDLK01000027.1 GCA001715655_00724 CDS open 129015-129287 _na     90_aa rpsP 30S ribosomal protein S16
1339 MDLK01000027.1 GCA001715655_00725 CDS open 129385-130749 _na     454_aa ffh signal recognition particle protein
1340 MDLK01000027.1 GCA001715655_00726 CDS open 130761-131099 _na     112_aa ylxM putative DNA-binding protein
1341 MDLK01000027.1 GCA001715655_00727 CDS open 131280-131687 _na     135_aa qdoI Cupin domain-containing protein
1342 MDLK01000027.1 GCA001715655_00728 CDS open 131721-132701 _na     326_aa pdxI Putative NAD(P)-dependent aldo/keto reductase
1343 MDLK01000027.1 GCA001715655_00729 CDS open 133033-133485 _na     150_aa yurZ Carboxymuconolactone decarboxylase
1344 MDLK01000027.1 GCA001715655_00730 CDS open 133597-134496 _na     299_aa lysR LysR family transcriptional regulator
1345 MDLK01000027.1 GCA001715655_00731 CDS open 134557-135228 _na     223_aa yeiL Transcriptional regulator YeiL
1346 MDLK01000027.1 GCA001715655_00732 CDS open 135341-135979 _na     212_aa yczE YitT family protein
1347 MDLK01000027.1 GCA001715655_00733 CDS open 136083-136697 _na     204_aa nitroreductase family protein
1348 MDLK01000027.1 GCA001715655_00734 CDS open 136866-137198 _na     110_aa helix-turn-helix domain-containing protein
1349 MDLK01000027.1 GCA001715655_00735 CDS open 137198-137380 _na     60_aa hypothetical protein
1350 MDLK01000027.1 GCA001715655_00736 CDS open 137498-138076 _na     192_aa hypothetical protein
1351 MDLK01000027.1 GCA001715655_00737 CDS open 138114-138746 _na     210_aa hypothetical protein
1352 MDLK01000027.1 GCA001715655_00738 CDS open 138785-139444 _na     219_aa ABC transporter ATP-binding protein
1353 MDLK01000027.1 GCA001715655_00739 CDS open 139445-140188 _na     247_aa hypothetical protein
1354 MDLK01000027.1 GCA001715655_00740 CDS open 140283-140666 _na     127_aa hypothetical protein
1355 MDLK01000027.1 GCA001715655_00741 CDS open 141119-141349 _na     76_aa hypothetical protein
1356 MDLK01000027.1 GCA001715655_00600 gene open 104-4006 cas9
1357 MDLK01000027.1 GCA001715655_00601 gene open 4022-4894 cas1
1358 MDLK01000027.1 GCA001715655_00602 gene open 4906-5211
1359 MDLK01000027.1 GCA001715655_00603 gene open 5208-5891 csn2
1360 MDLK01000027.1 GCA001715655_00604 gene open 6462-8081 bH3996
1361 MDLK01000027.1 GCA001715655_00605 gene open 8143-8940
1362 MDLK01000027.1 GCA001715655_00606 gene open 8921-9283 padR
1363 MDLK01000027.1 GCA001715655_00607 gene open 9445-9660
1364 MDLK01000027.1 GCA001715655_00608 gene open 9675-10112
1365 MDLK01000027.1 GCA001715655_00609 gene open 10178-11941
1366 MDLK01000027.1 GCA001715655_00611 gene open 12322-13953 abc-f
1367 MDLK01000027.1 GCA001715655_00612 gene open 14090-14467
1368 MDLK01000027.1 GCA001715655_00613 gene open 14858-19177 polC
1369 MDLK01000027.1 GCA001715655_00614 gene open 19521-20090 amaP
1370 MDLK01000027.1 GCA001715655_00615 gene open 20109-20285
1371 MDLK01000027.1 GCA001715655_00616 gene open 20306-20851 yloU
1372 MDLK01000027.1 GCA001715655_00617 gene open 20907-21092
1373 MDLK01000027.1 GCA001715655_00618 gene open 21598-22053 rimP
1374 MDLK01000027.1 GCA001715655_00619 gene open 22087-23280 nusA
1375 MDLK01000027.1 GCA001715655_00620 gene open 23301-23582 rnpM
1376 MDLK01000027.1 GCA001715655_00621 gene open 23572-23883 rpl7Ae
1377 MDLK01000027.1 GCA001715655_00622 gene open 23898-26231 infB
1378 MDLK01000027.1 GCA001715655_00623 gene open 26297-26644 rbfA
1379 MDLK01000027.1 GCA001715655_00624 gene open 26726-27655 truB
1380 MDLK01000027.1 GCA001715655_00625 gene open 27689-28639 ribF
1381 MDLK01000027.1 GCA001715655_00626 gene open 28780-29049 rpsO
1382 MDLK01000027.1 GCA001715655_00628 gene open 29298-31409 pnp
1383 MDLK01000027.1 GCA001715655_00629 gene open 31767-32195
1384 MDLK01000027.1 GCA001715655_00630 gene open 32319-32420
1385 MDLK01000027.1 GCA001715655_00631 gene open 32741-33016 yidJ
1386 MDLK01000027.1 GCA001715655_00632 gene open 33131-33571 yciW
1387 MDLK01000027.1 GCA001715655_00633 gene open 33630-34523 rhaT
1388 MDLK01000027.1 GCA001715655_00634 gene open 34714-36000 gntR
1389 MDLK01000027.1 GCA001715655_00635 gene open 36138-37178 asd
1390 MDLK01000027.1 GCA001715655_00636 gene open 37209-38423 dapG
1391 MDLK01000027.1 GCA001715655_00637 gene open 38459-39343 dapA
1392 MDLK01000027.1 GCA001715655_00638 gene open 39381-41057 rnjA
1393 MDLK01000027.1 GCA001715655_00639 gene open 41124-41690 tag
1394 MDLK01000027.1 GCA001715655_00640 gene open 41873-43462 uup
1395 MDLK01000027.1 GCA001715655_00641 gene open 43692-44420 glnQ
1396 MDLK01000027.1 GCA001715655_00642 gene open 44436-45221 hisJ
1397 MDLK01000027.1 GCA001715655_00643 gene open 45237-45884 hisM
1398 MDLK01000027.1 GCA001715655_00644 gene open 45897-46547 hisM
1399 MDLK01000027.1 GCA001715655_00645 gene open 46678-47505
1400 MDLK01000027.1 GCA001715655_00646 gene open 47611-48534 murB
1401 MDLK01000027.1 GCA001715655_00647 gene open 49225-50340 ald
1402 MDLK01000027.1 GCA001715655_00648 gene open 50343-51722 ansP
1403 MDLK01000027.1 GCA001715655_00649 gene open 52726-53016
1404 MDLK01000027.1 GCA001715655_00650 gene open 53097-53480
1405 MDLK01000027.1 GCA001715655_00651 gene open 53531-53620
1406 MDLK01000027.1 GCA001715655_00652 gene open 53873-54145
1407 MDLK01000027.1 GCA001715655_00653 gene open 54369-54599
1408 MDLK01000027.1 GCA001715655_00654 gene open 54621-55412
1409 MDLK01000027.1 GCA001715655_00655 gene open 56084-56872 menH
1410 MDLK01000027.1 GCA001715655_00656 gene open 57913-58620 talA
1411 MDLK01000027.1 GCA001715655_00657 gene open 58942-59853 aes
1412 MDLK01000027.1 GCA001715655_00658 gene open 59915-60463 pncA
1413 MDLK01000027.1 GCA001715655_00659 gene open 60518-61942 aRO8
1414 MDLK01000027.1 GCA001715655_00660 gene open 62068-62955 pdxS
1415 MDLK01000027.1 GCA001715655_00661 gene open 62957-63526 pdxT
1416 MDLK01000027.1 GCA001715655_00662 gene open 63896-64546 hP0602
1417 MDLK01000027.1 GCA001715655_00663 gene open 64606-65514 alkA
1418 MDLK01000027.1 GCA001715655_00664 gene open 65727-65885
1419 MDLK01000027.1 GCA001715655_00665 gene open 66460-67164 lytT
1420 MDLK01000027.1 GCA001715655_00666 gene open 67161-68474 citA
1421 MDLK01000027.1 GCA001715655_00667 gene open 68536-69273 agrC
1422 MDLK01000027.1 GCA001715655_00668 gene open 69242-69958 rbbA
1423 MDLK01000027.1 GCA001715655_00669 gene open 69967-70722 tagG
1424 MDLK01000027.1 GCA001715655_00670 gene open 70703-71644 rbbA
1425 MDLK01000027.1 GCA001715655_00671 gene open 72309-73298 dAP2
1426 MDLK01000027.1 GCA001715655_00672 gene open 73409-74131 soxR
1427 MDLK01000027.1 GCA001715655_00673 gene open 74881-75087
1428 MDLK01000027.1 GCA001715655_00674 gene open 75205-77001 lolE
1429 MDLK01000027.1 GCA001715655_00675 gene open 77001-78944 lolD
1430 MDLK01000027.1 GCA001715655_00676 gene open 79021-80199 kdpD
1431 MDLK01000027.1 GCA001715655_00677 gene open 80192-80881 ompR
1432 MDLK01000027.1 GCA001715655_00678 gene open 81076-82932 mutL
1433 MDLK01000027.1 GCA001715655_00679 gene open 83063-85711 mutS
1434 MDLK01000027.1 GCA001715655_00680 gene open 85727-86095 ymcA
1435 MDLK01000027.1 GCA001715655_00681 gene open 86106-86906 ymdB
1436 MDLK01000027.1 GCA001715655_00682 gene open 87084-87806 ppiB
1437 MDLK01000027.1 GCA001715655_00683 gene open 88419-88691
1438 MDLK01000027.1 GCA001715655_00684 gene open 88982-89257
1439 MDLK01000027.1 GCA001715655_00686 gene open 90130-91461 glnA
1440 MDLK01000027.1 GCA001715655_00687 gene open 91493-91852 soxR
1441 MDLK01000027.1 GCA001715655_00688 gene open 92056-92988 miaA
1442 MDLK01000027.1 GCA001715655_00689 gene open 92981-93712 ugpQ
1443 MDLK01000027.1 GCA001715655_00690 gene open 93730-96159 parC
1444 MDLK01000027.1 GCA001715655_00691 gene open 96146-98125 parE
1445 MDLK01000027.1 GCA001715655_00692 gene open 98643-99254 plsY
1446 MDLK01000027.1 GCA001715655_00693 gene open 99380-100579 galM
1447 MDLK01000027.1 GCA001715655_00694 gene open 100580-101002 fadM
1448 MDLK01000027.1 GCA001715655_00695 gene open 101130-101912 codY
1449 MDLK01000027.1 GCA001715655_00696 gene open 102139-103044 xerC
1450 MDLK01000027.1 GCA001715655_00697 gene open 103191-105269 topA
1451 MDLK01000027.1 GCA001715655_00698 gene open 105605-106387 dprA
1452 MDLK01000027.1 GCA001715655_00699 gene open 106465-107238 rnhB
1453 MDLK01000027.1 GCA001715655_00700 gene open 107222-108118 ylqF
1454 MDLK01000027.1 GCA001715655_00701 gene open 108130-108660 lepB
1455 MDLK01000027.1 GCA001715655_00702 gene open 108939-109445 lepB
1456 MDLK01000027.1 GCA001715655_00703 gene open 109683-110177 cysC
1457 MDLK01000027.1 GCA001715655_00704 gene open 110513-111382 lysR
1458 MDLK01000027.1 GCA001715655_00705 gene open 111940-112227 lysR
1459 MDLK01000027.1 GCA001715655_00706 gene open 112252-112608
1460 MDLK01000027.1 GCA001715655_00707 gene open 113043-113852 cof
1461 MDLK01000027.1 GCA001715655_00708 gene open 114049-115035 nagC
1462 MDLK01000027.1 GCA001715655_00709 gene open 115142-116107 ldhA
1463 MDLK01000027.1 GCA001715655_00710 gene open 116296-117327 kdpD
1464 MDLK01000027.1 GCA001715655_00711 gene open 117324-118013 ompR
1465 MDLK01000027.1 GCA001715655_00712 gene open 118092-118538 doxX
1466 MDLK01000027.1 GCA001715655_00713 gene open 118539-119282
1467 MDLK01000027.1 GCA001715655_00714 gene open 119486-119944
1468 MDLK01000027.1 GCA001715655_00715 gene open 119978-120346 yccF
1469 MDLK01000027.1 GCA001715655_00716 gene open 120590-122665
1470 MDLK01000027.1 GCA001715655_00717 gene open 122681-123913 rtcB
1471 MDLK01000027.1 GCA001715655_00718 gene open 124056-125297
1472 MDLK01000027.1 GCA001715655_00719 gene open 125290-126267
1473 MDLK01000027.1 GCA001715655_00720 gene open 126777-127121 rplS
1474 MDLK01000027.1 GCA001715655_00721 gene open 127253-128002 trmD
1475 MDLK01000027.1 GCA001715655_00722 gene open 128002-128520 rimM
1476 MDLK01000027.1 GCA001715655_00723 gene open 128527-128919 ylqD
1477 MDLK01000027.1 GCA001715655_00724 gene open 129015-129287 rpsP
1478 MDLK01000027.1 GCA001715655_00725 gene open 129385-130749 ffh
1479 MDLK01000027.1 GCA001715655_00726 gene open 130761-131099 ylxM
1480 MDLK01000027.1 GCA001715655_00727 gene open 131280-131687 qdoI
1481 MDLK01000027.1 GCA001715655_00728 gene open 131721-132701 pdxI
1482 MDLK01000027.1 GCA001715655_00729 gene open 133033-133485 yurZ
1483 MDLK01000027.1 GCA001715655_00730 gene open 133597-134496 lysR
1484 MDLK01000027.1 GCA001715655_00731 gene open 134557-135228 yeiL
1485 MDLK01000027.1 GCA001715655_00732 gene open 135341-135979 yczE
1486 MDLK01000027.1 GCA001715655_00733 gene open 136083-136697
1487 MDLK01000027.1 GCA001715655_00734 gene open 136866-137198
1488 MDLK01000027.1 GCA001715655_00735 gene open 137198-137380
1489 MDLK01000027.1 GCA001715655_00736 gene open 137498-138076
1490 MDLK01000027.1 GCA001715655_00737 gene open 138114-138746
1491 MDLK01000027.1 GCA001715655_00738 gene open 138785-139444
1492 MDLK01000027.1 GCA001715655_00739 gene open 139445-140188
1493 MDLK01000027.1 GCA001715655_00740 gene open 140283-140666
1494 MDLK01000027.1 GCA001715655_00741 gene open 141119-141349
1495 MDLK01000028.1 GCA001715655_00802 gene open 72632-72808 rli28
1496 MDLK01000028.1 GCA001715655_00803 gene open 73163-73342 rli28
1497 MDLK01000028.1 GCA001715655_00802 ncRNA open 72632-72808 Listeria sRNA rli28
1498 MDLK01000028.1 GCA001715655_00803 ncRNA open 73163-73342 Listeria sRNA rli28
1499 MDLK01000028.1 regulatory_region open 39166-39267 Purine riboswitch aptamer
1500 MDLK01000028.1 regulatory_region open 76063-76165 TPP riboswitch aptamer (THI element)