HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium vincentii (GCA_001854465.1)

Select a Genome:
BAKTA Annotations for GCA_001854465.1
Genome Selected: Fusobacterium vincentii
ContigsBases CDSrRNA tmRNAtRNA
60 2143397 1945 8 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4024 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4024 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 MLQO01000007.1 GCA001854465_00754 CDS open 11397-12020 _na     207_aa upp uracil phosphoribosyltransferase
1502 MLQO01000007.1 GCA001854465_00755 CDS open 12249-13037 _na     262_aa estA Lipase
1503 MLQO01000007.1 GCA001854465_00756 CDS open 13255-14265 _na     336_aa ldhA 4-phosphoerythronate dehydrogenase
1504 MLQO01000007.1 GCA001854465_00757 CDS open 14644-15921 _na     425_aa gdhA Glutamate dehydrogenase
1505 MLQO01000007.1 GCA001854465_00758 CDS open 16035-16901 _na     288_aa lgt prolipoprotein diacylglyceryl transferase
1506 MLQO01000007.1 GCA001854465_00759 CDS open 16926-17708 _na     260_aa undP DUF368 domain-containing protein
1507 MLQO01000007.1 GCA001854465_00760 CDS open 17713-18792 _na     359_aa alr Alanine racemase
1508 MLQO01000007.1 GCA001854465_00761 CDS open 18930-19082 _na     50_aa DUF3096 domain-containing protein
1509 MLQO01000007.1 GCA001854465_00762 CDS open 19486-20205 _na     239_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
1510 MLQO01000007.1 GCA001854465_00763 CDS open 20255-21463 _na     402_aa paaJ Acetyl-CoA C-acetyltransferase
1511 MLQO01000007.1 GCA001854465_00764 CDS open 21627-25646 _na     1339_aa Autotransporter domain-containing protein
1512 MLQO01000007.1 GCA001854465_00765 CDS open 25665-27899 _na     744_aa Hemin receptor
1513 MLQO01000007.1 GCA001854465_00766 CDS open 28173-29030 _na     285_aa Glycoside-hydrolase family GH114 TIM-barrel domain-containing protein
1514 MLQO01000007.1 GCA001854465_00767 CDS open 29056-29853 _na     265_aa N-acetylmuramoyl-L-alanine amidase
1515 MLQO01000007.1 GCA001854465_00768 CDS open 30019-32370 _na     783_aa ldcC arginase
1516 MLQO01000007.1 GCA001854465_00769 CDS open 32496-33080 _na     194_aa gmhA D-sedoheptulose 7-phosphate isomerase
1517 MLQO01000007.1 GCA001854465_00770 CDS open 33097-33984 _na     295_aa lysR HTH lysR-type domain-containing protein
1518 MLQO01000007.1 GCA001854465_00771 CDS open 34081-35460 _na     459_aa potE Amino acid permease
1519 MLQO01000007.1 GCA001854465_00772 CDS open 35480-36208 _na     242_aa Anthranilate synthase component II
1520 MLQO01000007.1 GCA001854465_00773 CDS open 36232-37941 _na     569_aa argS arginine--tRNA ligase
1521 MLQO01000007.1 GCA001854465_00774 CDS open 38238-39083 _na     281_aa yjjU Serine protease
1522 MLQO01000007.1 GCA001854465_00775 CDS open 39282-40286 _na     334_aa ldhA 4-phosphoerythronate dehydrogenase
1523 MLQO01000007.1 GCA001854465_00776 CDS open 40337-41548 _na     403_aa norV Flavodoxin-like domain-containing protein
1524 MLQO01000007.1 GCA001854465_00777 CDS open 41712-42140 _na     142_aa fldA flavodoxin
1525 MLQO01000007.1 GCA001854465_00778 CDS open 42388-42828 _na     146_aa Lipoprotein
1526 MLQO01000007.1 GCA001854465_00779 CDS open 43012-46080 _na     1022_aa acrB SSD domain-containing protein
1527 MLQO01000007.1 GCA001854465_00780 CDS open 46077-47150 _na     357_aa Efflux transporter%2C RND family%2C MFP subunit
1528 MLQO01000007.1 GCA001854465_00781 CDS open 47160-48569 _na     469_aa tolC TolC family protein
1529 MLQO01000007.1 GCA001854465_00782 CDS open 48700-49689 _na     329_aa ywqK MORN repeat protein
1530 MLQO01000007.1 GCA001854465_00783 CDS open 49698-50315 _na     205_aa DUF2179 domain-containing protein
1531 MLQO01000007.1 GCA001854465_00784 CDS open 50308-50976 _na     222_aa queH Epoxyqueuosine reductase QueH
1532 MLQO01000007.1 GCA001854465_00785 CDS open 50985-53750 _na     921_aa sbcC Exonuclease SBCC
1533 MLQO01000007.1 GCA001854465_00786 CDS open 53740-54906 _na     388_aa sbcD Calcineurin-like phosphoesterase domain-containing protein
1534 MLQO01000007.1 GCA001854465_00787 CDS open 54903-57662 _na     919_aa cas4 DNA 3'-5' helicase
1535 MLQO01000007.1 GCA001854465_00788 CDS open 57664-59922 _na     752_aa mrcB peptidoglycan glycosyltransferase
1536 MLQO01000007.1 GCA001854465_00789 CDS open 59926-61002 _na     358_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
1537 MLQO01000007.1 GCA001854465_00790 CDS open 60995-62122 _na     375_aa alaX Alanyl-transfer RNA synthetases family profile domain-containing protein
1538 MLQO01000007.1 GCA001854465_00791 CDS open 62503-62703 _na     66_aa cspC Cold shock protein
1539 MLQO01000007.1 GCA001854465_00792 CDS open 62759-63814 _na     351_aa abrB Membrane protein AbrB duplication
1540 MLQO01000007.1 GCA001854465_00793 CDS open 63835-64875 _na     346_aa UPF0324 membrane protein
1541 MLQO01000007.1 GCA001854465_00794 CDS open 65035-65571 _na     178_aa VanZ-like domain-containing protein
1542 MLQO01000007.1 GCA001854465_00795 CDS open 65635-66213 _na     192_aa ppnN Cytokinin riboside 5'-monophosphate phosphoribohydrolase
1543 MLQO01000007.1 GCA001854465_00796 CDS open 66238-67383 _na     381_aa dnaN DNA polymerase III subunit beta
1544 MLQO01000007.1 GCA001854465_00797 CDS open 67401-67985 _na     194_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1545 MLQO01000007.1 GCA001854465_00798 CDS open 68128-68352 _na     74_aa secG preprotein translocase subunit SecG
1546 MLQO01000007.1 GCA001854465_00799 CDS open 68529-68981 _na     150_aa precorrin-2 dehydrogenase
1547 MLQO01000007.1 GCA001854465_00800 CDS open 68971-70275 _na     434_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1548 MLQO01000007.1 GCA001854465_00801 CDS open 70627-71721 _na     364_aa NodB-like y domain-containing protein
1549 MLQO01000007.1 GCA001854465_00802 CDS open 71739-72518 _na     259_aa Glycosyltransferase 2-like domain-containing protein
1550 MLQO01000007.1 GCA001854465_00803 CDS open 72508-73527 _na     339_aa rfaF Lipopolysaccharide heptosyltransferase
1551 MLQO01000007.1 GCA001854465_00804 CDS open 73524-74552 _na     342_aa rfaF ADP-heptose--LPS heptosyltransferase
1552 MLQO01000007.1 GCA001854465_00805 CDS open 74545-75141 _na     198_aa rIO2 Lipopolysaccharide biosynthesis protein
1553 MLQO01000007.1 GCA001854465_00806 CDS open 75143-76153 _na     336_aa Glycosyltransferase family 9 protein
1554 MLQO01000007.1 GCA001854465_00807 CDS open 76158-77291 _na     377_aa recA recombinase RecA
1555 MLQO01000007.1 GCA001854465_00808 CDS open 77263-77832 _na     189_aa recX Regulatory protein RecX
1556 MLQO01000007.1 GCA001854465_00809 CDS open 77829-78854 _na     341_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1557 MLQO01000007.1 GCA001854465_00742 gene open 1-273 tnpA
1558 MLQO01000007.1 GCA001854465_00743 gene open 425-928 fldA
1559 MLQO01000007.1 GCA001854465_00744 gene open 1106-1675 acrR
1560 MLQO01000007.1 GCA001854465_00745 gene open 1739-4753 acrB
1561 MLQO01000007.1 GCA001854465_00746 gene open 4908-6215 miaB
1562 MLQO01000007.1 GCA001854465_00747 gene open 6238-7479 rho
1563 MLQO01000007.1 GCA001854465_00748 gene open 7530-8627 nlpD
1564 MLQO01000007.1 GCA001854465_00749 gene open 8673-9737 ispG
1565 MLQO01000007.1 GCA001854465_00750 gene open 9793-10242 rpoE
1566 MLQO01000007.1 GCA001854465_00751 gene open 10244-10552
1567 MLQO01000007.1 GCA001854465_00752 gene open 10564-10968
1568 MLQO01000007.1 GCA001854465_00753 gene open 11093-11338 rpmE
1569 MLQO01000007.1 GCA001854465_00754 gene open 11397-12020 upp
1570 MLQO01000007.1 GCA001854465_00755 gene open 12249-13037 estA
1571 MLQO01000007.1 GCA001854465_00756 gene open 13255-14265 ldhA
1572 MLQO01000007.1 GCA001854465_00757 gene open 14644-15921 gdhA
1573 MLQO01000007.1 GCA001854465_00758 gene open 16035-16901 lgt
1574 MLQO01000007.1 GCA001854465_00759 gene open 16926-17708 undP
1575 MLQO01000007.1 GCA001854465_00760 gene open 17713-18792 alr
1576 MLQO01000007.1 GCA001854465_00761 gene open 18930-19082
1577 MLQO01000007.1 GCA001854465_00762 gene open 19486-20205 fabG
1578 MLQO01000007.1 GCA001854465_00763 gene open 20255-21463 paaJ
1579 MLQO01000007.1 GCA001854465_00764 gene open 21627-25646
1580 MLQO01000007.1 GCA001854465_00765 gene open 25665-27899
1581 MLQO01000007.1 GCA001854465_00766 gene open 28173-29030
1582 MLQO01000007.1 GCA001854465_00767 gene open 29056-29853
1583 MLQO01000007.1 GCA001854465_00768 gene open 30019-32370 ldcC
1584 MLQO01000007.1 GCA001854465_00769 gene open 32496-33080 gmhA
1585 MLQO01000007.1 GCA001854465_00770 gene open 33097-33984 lysR
1586 MLQO01000007.1 GCA001854465_00771 gene open 34081-35460 potE
1587 MLQO01000007.1 GCA001854465_00772 gene open 35480-36208
1588 MLQO01000007.1 GCA001854465_00773 gene open 36232-37941 argS
1589 MLQO01000007.1 GCA001854465_00774 gene open 38238-39083 yjjU
1590 MLQO01000007.1 GCA001854465_00775 gene open 39282-40286 ldhA
1591 MLQO01000007.1 GCA001854465_00776 gene open 40337-41548 norV
1592 MLQO01000007.1 GCA001854465_00777 gene open 41712-42140 fldA
1593 MLQO01000007.1 GCA001854465_00778 gene open 42388-42828
1594 MLQO01000007.1 GCA001854465_00779 gene open 43012-46080 acrB
1595 MLQO01000007.1 GCA001854465_00780 gene open 46077-47150
1596 MLQO01000007.1 GCA001854465_00781 gene open 47160-48569 tolC
1597 MLQO01000007.1 GCA001854465_00782 gene open 48700-49689 ywqK
1598 MLQO01000007.1 GCA001854465_00783 gene open 49698-50315
1599 MLQO01000007.1 GCA001854465_00784 gene open 50308-50976 queH
1600 MLQO01000007.1 GCA001854465_00785 gene open 50985-53750 sbcC
1601 MLQO01000007.1 GCA001854465_00786 gene open 53740-54906 sbcD
1602 MLQO01000007.1 GCA001854465_00787 gene open 54903-57662 cas4
1603 MLQO01000007.1 GCA001854465_00788 gene open 57664-59922 mrcB
1604 MLQO01000007.1 GCA001854465_00789 gene open 59926-61002 rlmN
1605 MLQO01000007.1 GCA001854465_00790 gene open 60995-62122 alaX
1606 MLQO01000007.1 GCA001854465_00791 gene open 62503-62703 cspC
1607 MLQO01000007.1 GCA001854465_00792 gene open 62759-63814 abrB
1608 MLQO01000007.1 GCA001854465_00793 gene open 63835-64875
1609 MLQO01000007.1 GCA001854465_00794 gene open 65035-65571
1610 MLQO01000007.1 GCA001854465_00795 gene open 65635-66213 ppnN
1611 MLQO01000007.1 GCA001854465_00796 gene open 66238-67383 dnaN
1612 MLQO01000007.1 GCA001854465_00797 gene open 67401-67985 plsY
1613 MLQO01000007.1 GCA001854465_00798 gene open 68128-68352 secG
1614 MLQO01000007.1 GCA001854465_00799 gene open 68529-68981
1615 MLQO01000007.1 GCA001854465_00800 gene open 68971-70275 hemL
1616 MLQO01000007.1 GCA001854465_00801 gene open 70627-71721
1617 MLQO01000007.1 GCA001854465_00802 gene open 71739-72518
1618 MLQO01000007.1 GCA001854465_00803 gene open 72508-73527 rfaF
1619 MLQO01000007.1 GCA001854465_00804 gene open 73524-74552 rfaF
1620 MLQO01000007.1 GCA001854465_00805 gene open 74545-75141 rIO2
1621 MLQO01000007.1 GCA001854465_00806 gene open 75143-76153
1622 MLQO01000007.1 GCA001854465_00807 gene open 76158-77291 recA
1623 MLQO01000007.1 GCA001854465_00808 gene open 77263-77832 recX
1624 MLQO01000007.1 GCA001854465_00809 gene open 77829-78854 tsaD
1625 MLQO01000008.1 GCA001854465_00810 gene open 6-122 rrf
1626 MLQO01000008.1 GCA001854465_00870 gene open 63316-63367 6A
1627 MLQO01000008.1 GCA001854465_00870 ncRNA open 63316-63367 6A RNA
1628 MLQO01000008.1 regulatory_region open 21098-21271 Cobalamin riboswitch aptamer
1629 MLQO01000008.1 GCA001854465_00810 rRNA open 6-122 rrf 5S ribosomal RNA
1630 MLQO01000008.1 GCA001854465_00811 CDS open 247-960 _na     237_aa Hydrolase
1631 MLQO01000008.1 GCA001854465_00812 CDS open 963-3662 _na     899_aa hepA SWF/SNF family helicase
1632 MLQO01000008.1 GCA001854465_00813 CDS open 3672-5456 _na     594_aa AAA-ATPase-like domain-containing protein
1633 MLQO01000008.1 GCA001854465_00814 CDS open 5465-5833 _na     122_aa Nuclear transport factor 2 family protein
1634 MLQO01000008.1 GCA001854465_00815 CDS open 5861-9259 _na     1132_aa dnaE DNA polymerase III subunit alpha
1635 MLQO01000008.1 GCA001854465_00816 CDS open 9478-10401 _na     307_aa Site-specific DNA-methyltransferase (adenine-specific)
1636 MLQO01000008.1 GCA001854465_00817 CDS open 10414-11271 _na     285_aa Type-2 restriction enzyme
1637 MLQO01000008.1 GCA001854465_00818 CDS open 11284-12102 _na     272_aa Restriction endonuclease type IV Mrr domain-containing protein
1638 MLQO01000008.1 GCA001854465_00819 CDS open 12110-12853 _na     247_aa Methyltransferase
1639 MLQO01000008.1 GCA001854465_00820 CDS open 12952-14391 _na     479_aa SWIM-type domain-containing protein
1640 MLQO01000008.1 GCA001854465_00821 CDS open 14405-16318 _na     637_aa HEAT repeat domain-containing protein
1641 MLQO01000008.1 GCA001854465_00822 CDS open 16323-17423 _na     366_aa mMP0363 ATPase dynein-related AAA domain-containing protein
1642 MLQO01000008.1 GCA001854465_00823 CDS open 17438-19714 _na     758_aa DUF5682 domain-containing protein
1643 MLQO01000008.1 GCA001854465_00824 CDS open 19723-20913 _na     396_aa VWA domain-containing protein
1644 MLQO01000008.1 GCA001854465_00825 CDS open 21402-25100 _na     1232_aa Autotransporter domain-containing protein
1645 MLQO01000008.1 GCA001854465_00826 CDS open 25159-26709 _na     516_aa citF citrate lyase subunit alpha
1646 MLQO01000008.1 GCA001854465_00827 CDS open 26712-27602 _na     296_aa citE citrate (pro-3S)-lyase subunit beta
1647 MLQO01000008.1 GCA001854465_00828 CDS open 27611-27895 _na     94_aa citD citrate lyase acyl carrier protein
1648 MLQO01000008.1 GCA001854465_00829 CDS open 28072-28917 _na     281_aa triphosphoribosyl-dephospho-CoA synthase
1649 MLQO01000008.1 GCA001854465_00830 CDS open 28910-30256 _na     448_aa oadA1 oxaloacetate decarboxylase subunit alpha
1650 MLQO01000008.1 GCA001854465_00831 CDS open 30343-31719 _na     458_aa Citrate-sodium symporter
1651 MLQO01000008.1 GCA001854465_00832 CDS open 31890-32687 _na     265_aa Transcriptional regulator
1652 MLQO01000008.1 GCA001854465_00833 CDS open 32700-33188 _na     162_aa ybaK Cys-tRNA(Pro) deacylase
1653 MLQO01000008.1 GCA001854465_00834 CDS open 33220-34164 _na     314_aa rluA Pseudouridine synthase
1654 MLQO01000008.1 GCA001854465_00835 CDS open 34394-35026 _na     210_aa ribonuclease HII
1655 MLQO01000008.1 GCA001854465_00836 CDS open 35023-35391 _na     122_aa yraN YraN family protein
1656 MLQO01000008.1 GCA001854465_00837 CDS open 35438-35602 _na     54_aa DUF2082 domain-containing protein
1657 MLQO01000008.1 GCA001854465_00838 CDS open 35577-36224 _na     215_aa comFC ComF family protein
1658 MLQO01000008.1 GCA001854465_00839 CDS open 36238-36843 _na     201_aa Chemotaxis protein
1659 MLQO01000008.1 GCA001854465_00840 CDS open 36865-37620 _na     251_aa tpiA triose-phosphate isomerase
1660 MLQO01000008.1 GCA001854465_00841 CDS open 37643-38737 _na     364_aa ychF redox-regulated ATPase YchF
1661 MLQO01000008.1 GCA001854465_00842 CDS open 38821-39000 _na     59_aa rpmF 50S ribosomal protein L32
1662 MLQO01000008.1 GCA001854465_00843 CDS open 39079-39813 _na     244_aa ABC transporter domain-containing protein
1663 MLQO01000008.1 GCA001854465_00844 CDS open 39813-40514 _na     233_aa dppD Dipeptide transport ATP-binding protein dppD
1664 MLQO01000008.1 GCA001854465_00845 CDS open 40514-41281 _na     255_aa dppC ABC transmembrane type-1 domain-containing protein
1665 MLQO01000008.1 GCA001854465_00846 CDS open 41281-42198 _na     305_aa dppB ABC transmembrane type-1 domain-containing protein
1666 MLQO01000008.1 GCA001854465_00847 CDS open 42209-43696 _na     495_aa ddpA Solute-binding protein family 5 domain-containing protein
1667 MLQO01000008.1 GCA001854465_00848 CDS open 43948-44706 _na     252_aa sseB Enhanced serine sensitivity protein SseB
1668 MLQO01000008.1 GCA001854465_00849 CDS open 44937-46223 _na     428_aa Membrane iron-sulfur containing protein FtrD-like domain-containing protein
1669 MLQO01000008.1 GCA001854465_00850 CDS open 46220-47506 _na     428_aa lolE Efflux ABC transporter%2C permease protein
1670 MLQO01000008.1 GCA001854465_00851 CDS open 47516-48718 _na     400_aa lolE ABC transporter permease
1671 MLQO01000008.1 GCA001854465_00852 CDS open 48722-49414 _na     230_aa lolD ABC transporter domain-containing protein
1672 MLQO01000008.1 GCA001854465_00853 CDS open 49638-50060 _na     140_aa tpp15 FMN-binding domain-containing protein
1673 MLQO01000008.1 GCA001854465_00854 CDS open 50122-50559 _na     145_aa DUF4418 domain-containing protein
1674 MLQO01000008.1 GCA001854465_00855 CDS open 50563-51768 _na     401_aa lolE ABC transporter permease
1675 MLQO01000008.1 GCA001854465_00856 CDS open 51777-52448 _na     223_aa lolD ABC transporter domain-containing protein
1676 MLQO01000008.1 GCA001854465_00857 CDS open 52517-53221 _na     234_aa ABM domain-containing protein
1677 MLQO01000008.1 GCA001854465_00858 CDS open 53275-53442 _na     55_aa SMI1/KNR4 family protein
1678 MLQO01000008.1 GCA001854465_00859 CDS open 53462-54289 _na     275_aa AB hydrolase-1 domain-containing protein
1679 MLQO01000008.1 GCA001854465_00860 CDS open 54368-55192 _na     274_aa YARHG domain-containing protein
1680 MLQO01000008.1 GCA001854465_00861 CDS open 55324-56622 _na     432_aa ATPase
1681 MLQO01000008.1 GCA001854465_00862 CDS open 56681-57439 _na     252_aa tatD Hydrolase%2C TatD family
1682 MLQO01000008.1 GCA001854465_00863 CDS open 57436-57804 _na     122_aa Holo-[acyl-carrier-protein] synthase
1683 MLQO01000008.1 GCA001854465_00865 CDS open 57929-58924 _na     331_aa prfB peptide chain release factor 2
1684 MLQO01000008.1 GCA001854465_00866 CDS open 59045-60331 _na     428_aa hypothetical protein
1685 MLQO01000008.1 GCA001854465_00867 CDS open 60443-61039 _na     198_aa DUF304 domain-containing protein
1686 MLQO01000008.1 GCA001854465_00868 CDS open 61057-61656 _na     199_aa DUF304 domain-containing protein
1687 MLQO01000008.1 GCA001854465_00869 CDS open 61733-63265 _na     510_aa gltX glutamate--tRNA ligase
1688 MLQO01000008.1 GCA001854465_00871 CDS open 63418-64395 _na     325_aa trpS tryptophan--tRNA ligase
1689 MLQO01000008.1 GCA001854465_00872 CDS open 64902-65423 _na     173_aa Stress response protein NST1
1690 MLQO01000008.1 GCA001854465_00873 CDS open 65435-76264 _na     3609_aa Autotransporter-associated N-terminal domain-containing protein
1691 MLQO01000008.1 GCA001854465_00874 CDS open 76340-77404 _na     354_aa alr alanine racemase
1692 MLQO01000008.1 GCA001854465_00875 CDS open 77483-78007 _na     174_aa Lipoprotein
1693 MLQO01000008.1 GCA001854465_00811 gene open 247-960
1694 MLQO01000008.1 GCA001854465_00812 gene open 963-3662 hepA
1695 MLQO01000008.1 GCA001854465_00813 gene open 3672-5456
1696 MLQO01000008.1 GCA001854465_00814 gene open 5465-5833
1697 MLQO01000008.1 GCA001854465_00815 gene open 5861-9259 dnaE
1698 MLQO01000008.1 GCA001854465_00816 gene open 9478-10401
1699 MLQO01000008.1 GCA001854465_00817 gene open 10414-11271
1700 MLQO01000008.1 GCA001854465_00818 gene open 11284-12102
1701 MLQO01000008.1 GCA001854465_00819 gene open 12110-12853
1702 MLQO01000008.1 GCA001854465_00820 gene open 12952-14391
1703 MLQO01000008.1 GCA001854465_00821 gene open 14405-16318
1704 MLQO01000008.1 GCA001854465_00822 gene open 16323-17423 mMP0363
1705 MLQO01000008.1 GCA001854465_00823 gene open 17438-19714
1706 MLQO01000008.1 GCA001854465_00824 gene open 19723-20913
1707 MLQO01000008.1 GCA001854465_00825 gene open 21402-25100
1708 MLQO01000008.1 GCA001854465_00826 gene open 25159-26709 citF
1709 MLQO01000008.1 GCA001854465_00827 gene open 26712-27602 citE
1710 MLQO01000008.1 GCA001854465_00828 gene open 27611-27895 citD
1711 MLQO01000008.1 GCA001854465_00829 gene open 28072-28917
1712 MLQO01000008.1 GCA001854465_00830 gene open 28910-30256 oadA1
1713 MLQO01000008.1 GCA001854465_00831 gene open 30343-31719
1714 MLQO01000008.1 GCA001854465_00832 gene open 31890-32687
1715 MLQO01000008.1 GCA001854465_00833 gene open 32700-33188 ybaK
1716 MLQO01000008.1 GCA001854465_00834 gene open 33220-34164 rluA
1717 MLQO01000008.1 GCA001854465_00835 gene open 34394-35026
1718 MLQO01000008.1 GCA001854465_00836 gene open 35023-35391 yraN
1719 MLQO01000008.1 GCA001854465_00837 gene open 35438-35602
1720 MLQO01000008.1 GCA001854465_00838 gene open 35577-36224 comFC
1721 MLQO01000008.1 GCA001854465_00839 gene open 36238-36843
1722 MLQO01000008.1 GCA001854465_00840 gene open 36865-37620 tpiA
1723 MLQO01000008.1 GCA001854465_00841 gene open 37643-38737 ychF
1724 MLQO01000008.1 GCA001854465_00842 gene open 38821-39000 rpmF
1725 MLQO01000008.1 GCA001854465_00843 gene open 39079-39813
1726 MLQO01000008.1 GCA001854465_00844 gene open 39813-40514 dppD
1727 MLQO01000008.1 GCA001854465_00845 gene open 40514-41281 dppC
1728 MLQO01000008.1 GCA001854465_00846 gene open 41281-42198 dppB
1729 MLQO01000008.1 GCA001854465_00847 gene open 42209-43696 ddpA
1730 MLQO01000008.1 GCA001854465_00848 gene open 43948-44706 sseB
1731 MLQO01000008.1 GCA001854465_00849 gene open 44937-46223
1732 MLQO01000008.1 GCA001854465_00850 gene open 46220-47506 lolE
1733 MLQO01000008.1 GCA001854465_00851 gene open 47516-48718 lolE
1734 MLQO01000008.1 GCA001854465_00852 gene open 48722-49414 lolD
1735 MLQO01000008.1 GCA001854465_00853 gene open 49638-50060 tpp15
1736 MLQO01000008.1 GCA001854465_00854 gene open 50122-50559
1737 MLQO01000008.1 GCA001854465_00855 gene open 50563-51768 lolE
1738 MLQO01000008.1 GCA001854465_00856 gene open 51777-52448 lolD
1739 MLQO01000008.1 GCA001854465_00857 gene open 52517-53221
1740 MLQO01000008.1 GCA001854465_00858 gene open 53275-53442
1741 MLQO01000008.1 GCA001854465_00859 gene open 53462-54289
1742 MLQO01000008.1 GCA001854465_00860 gene open 54368-55192
1743 MLQO01000008.1 GCA001854465_00861 gene open 55324-56622
1744 MLQO01000008.1 GCA001854465_00862 gene open 56681-57439 tatD
1745 MLQO01000008.1 GCA001854465_00863 gene open 57436-57804
1746 MLQO01000008.1 GCA001854465_00865 gene open 57929-58924 prfB
1747 MLQO01000008.1 GCA001854465_00866 gene open 59045-60331
1748 MLQO01000008.1 GCA001854465_00867 gene open 60443-61039
1749 MLQO01000008.1 GCA001854465_00868 gene open 61057-61656
1750 MLQO01000008.1 GCA001854465_00869 gene open 61733-63265 gltX
1751 MLQO01000008.1 GCA001854465_00871 gene open 63418-64395 trpS
1752 MLQO01000008.1 GCA001854465_00872 gene open 64902-65423
1753 MLQO01000008.1 GCA001854465_00873 gene open 65435-76264
1754 MLQO01000008.1 GCA001854465_00874 gene open 76340-77404 alr
1755 MLQO01000008.1 GCA001854465_00875 gene open 77483-78007
1756 MLQO01000009.1 GCA001854465_00937 gene open 77271-77387 rrf
1757 MLQO01000009.1 regulatory_region open 167-272 TPP riboswitch aptamer (THI element)
1758 MLQO01000009.1 regulatory_region open 5457-5630 Cobalamin riboswitch aptamer
1759 MLQO01000009.1 GCA001854465_00937 rRNA open 77271-77387 rrf 5S ribosomal RNA
1760 MLQO01000009.1 GCA001854465_00876 CDS open 384-1160 _na     258_aa fepC ABC transporter domain-containing protein
1761 MLQO01000009.1 GCA001854465_00877 CDS open 1157-2182 _na     341_aa fepD Iron ABC transporter
1762 MLQO01000009.1 GCA001854465_00878 CDS open 2185-3054 _na     289_aa fepB Fe/B12 periplasmic-binding domain-containing protein
1763 MLQO01000009.1 GCA001854465_00879 CDS open 3411-5384 _na     657_aa fepA Hemin receptor
1764 MLQO01000009.1 GCA001854465_00880 CDS open 5979-6365 _na     128_aa manC Cupin type-2 domain-containing protein
1765 MLQO01000009.1 GCA001854465_00881 CDS open 6524-6901 _na     125_aa ridA Reactive intermediate/imine deaminase
1766 MLQO01000009.1 GCA001854465_00882 CDS open 6995-9823 _na     942_aa DNA helicase
1767 MLQO01000009.1 GCA001854465_00883 CDS open 9957-10187 _na     76_aa Histidine kinase
1768 MLQO01000009.1 GCA001854465_00884 CDS open 10203-10982 _na     259_aa Restriction endonuclease
1769 MLQO01000009.1 GCA001854465_00885 CDS open 11687-11809 _na     40_aa hypothetical protein
1770 MLQO01000009.1 GCA001854465_00886 CDS open 11778-13364 _na     528_aa srmB RNA helicase
1771 MLQO01000009.1 GCA001854465_00887 CDS open 13589-14521 _na     310_aa mltG Endolytic murein transglycosylase
1772 MLQO01000009.1 GCA001854465_00888 CDS open 14746-16086 _na     446_aa tilS tRNA(Ile)-lysidine synthase
1773 MLQO01000009.1 GCA001854465_00889 CDS open 16083-18206 _na     707_aa ftsH ATP-dependent zinc metalloprotease FtsH
1774 MLQO01000009.1 GCA001854465_00890 CDS open 18320-18577 _na     85_aa rpsO 30S ribosomal protein S15
1775 MLQO01000009.1 GCA001854465_00891 CDS open 18829-19938 _na     369_aa Transporter
1776 MLQO01000009.1 GCA001854465_00892 CDS open 19990-20793 _na     267_aa DUF4198 domain-containing protein
1777 MLQO01000009.1 GCA001854465_00893 CDS open 20888-28642 _na     2584_aa Autotransporter domain-containing protein
1778 MLQO01000009.1 GCA001854465_00894 CDS open 28660-29247 _na     195_aa OmpA-like domain-containing protein
1779 MLQO01000009.1 GCA001854465_00895 CDS open 29806-30372 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
1780 MLQO01000009.1 GCA001854465_00896 CDS open 30751-32388 _na     545_aa ahpF Thioredoxin reductase
1781 MLQO01000009.1 GCA001854465_00897 CDS open 32516-33940 _na     474_aa creD cell envelope integrity protein CreD
1782 MLQO01000009.1 GCA001854465_00898 CDS open 34054-35226 _na     390_aa YARHG domain-containing protein
1783 MLQO01000009.1 GCA001854465_00899 CDS open 35256-35912 _na     218_aa gntR HTH gntR-type domain-containing protein
1784 MLQO01000009.1 GCA001854465_00900 CDS open 36193-37575 _na     460_aa tpl tyrosine phenol-lyase
1785 MLQO01000009.1 GCA001854465_00901 CDS open 37706-39022 _na     438_aa yocR Sodium-dependent transporter
1786 MLQO01000009.1 GCA001854465_00902 CDS open 39203-39844 _na     213_aa J domain-containing protein
1787 MLQO01000009.1 GCA001854465_00903 CDS open 39855-41198 _na     447_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
1788 MLQO01000009.1 GCA001854465_00904 CDS open 41200-42150 _na     316_aa prs ribose-phosphate diphosphokinase
1789 MLQO01000009.1 GCA001854465_00905 CDS open 42150-42803 _na     217_aa tsaC L-threonylcarbamoyladenylate synthase
1790 MLQO01000009.1 GCA001854465_00906 CDS open 42800-43243 _na     147_aa DUF327 domain-containing protein
1791 MLQO01000009.1 GCA001854465_00907 CDS open 43648-44361 _na     237_aa raSEA Elp3/MiaA/NifB-like radical SAM core domain-containing protein
1792 MLQO01000009.1 GCA001854465_00908 CDS open 44358-45065 _na     235_aa yhhQ queuosine precursor transporter
1793 MLQO01000009.1 GCA001854465_00909 CDS open 45189-45473 _na     94_aa aF2118 HTH cro/C1-type domain-containing protein
1794 MLQO01000009.1 GCA001854465_00910 CDS open 45460-46602 _na     380_aa hipA Toxin HipA
1795 MLQO01000009.1 GCA001854465_00911 CDS open 46626-47186 _na     186_aa GDYXXLXY protein
1796 MLQO01000009.1 GCA001854465_00912 CDS open 47179-48984 _na     601_aa Permease
1797 MLQO01000009.1 GCA001854465_00913 CDS open 49301-49849 _na     182_aa bioY Biotin transporter
1798 MLQO01000009.1 GCA001854465_00914 CDS open 49864-50658 _na     264_aa ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1
1799 MLQO01000009.1 GCA001854465_00915 CDS open 50642-51457 _na     271_aa ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2
1800 MLQO01000009.1 GCA001854465_00916 CDS open 51587-52390 _na     267_aa cbiQ Cobalamin biosynthesis protein CbiQ
1801 MLQO01000009.1 GCA001854465_00917 CDS open 52335-52886 _na     183_aa btuE Glutathione peroxidase
1802 MLQO01000009.1 GCA001854465_00918 CDS open 52900-53622 _na     240_aa opuBA ABC transporter domain-containing protein
1803 MLQO01000009.1 GCA001854465_00919 CDS open 53622-55163 _na     513_aa osmF ABC transporter%2C substrate-binding protein%2C QAT family
1804 MLQO01000009.1 GCA001854465_00920 CDS open 55123-55605 _na     160_aa marR Transcriptional regulator%2C MarR family
1805 MLQO01000009.1 GCA001854465_00921 CDS open 56177-57280 _na     367_aa Restriction endonuclease
1806 MLQO01000009.1 GCA001854465_00922 CDS open 57340-59385 _na     681_aa site-specific DNA-methyltransferase (adenine-specific)
1807 MLQO01000009.1 GCA001854465_00923 CDS open 59411-62074 _na     887_aa valS valine--tRNA ligase
1808 MLQO01000009.1 GCA001854465_00924 CDS open 62104-62973 _na     289_aa Type IV secretion protein Rhs
1809 MLQO01000009.1 GCA001854465_00925 CDS open 62991-63965 _na     324_aa Type IV secretion protein Rhs
1810 MLQO01000009.1 GCA001854465_00926 CDS open 63998-64582 _na     194_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1811 MLQO01000009.1 GCA001854465_00927 CDS open 64598-66904 _na     768_aa lon endopeptidase La
1812 MLQO01000009.1 GCA001854465_00928 CDS open 66914-68185 _na     423_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
1813 MLQO01000009.1 GCA001854465_00929 CDS open 68197-68778 _na     193_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
1814 MLQO01000009.1 GCA001854465_00930 CDS open 69289-70584 _na     431_aa tig trigger factor
1815 MLQO01000009.1 GCA001854465_00931 CDS open 70600-72273 _na     557_aa recJ single-stranded-DNA-specific exonuclease RecJ
1816 MLQO01000009.1 GCA001854465_00932 CDS open 72273-72635 _na     120_aa rbfA 30S ribosome-binding factor RbfA
1817 MLQO01000009.1 GCA001854465_00933 CDS open 72650-74893 _na     747_aa infB translation initiation factor IF-2
1818 MLQO01000009.1 GCA001854465_00934 CDS open 74890-75420 _na     176_aa ylxR DUF448 domain-containing protein
1819 MLQO01000009.1 GCA001854465_00935 CDS open 75413-76486 _na     357_aa rpsA Transcription termination/antitermination protein NusA
1820 MLQO01000009.1 GCA001854465_00936 CDS open 76514-76984 _na     156_aa rimP Ribosome maturation factor RimP
1821 MLQO01000009.1 GCA001854465_00876 gene open 384-1160 fepC
1822 MLQO01000009.1 GCA001854465_00877 gene open 1157-2182 fepD
1823 MLQO01000009.1 GCA001854465_00878 gene open 2185-3054 fepB
1824 MLQO01000009.1 GCA001854465_00879 gene open 3411-5384 fepA
1825 MLQO01000009.1 GCA001854465_00880 gene open 5979-6365 manC
1826 MLQO01000009.1 GCA001854465_00881 gene open 6524-6901 ridA
1827 MLQO01000009.1 GCA001854465_00882 gene open 6995-9823
1828 MLQO01000009.1 GCA001854465_00883 gene open 9957-10187
1829 MLQO01000009.1 GCA001854465_00884 gene open 10203-10982
1830 MLQO01000009.1 GCA001854465_00885 gene open 11687-11809
1831 MLQO01000009.1 GCA001854465_00886 gene open 11778-13364 srmB
1832 MLQO01000009.1 GCA001854465_00887 gene open 13589-14521 mltG
1833 MLQO01000009.1 GCA001854465_00888 gene open 14746-16086 tilS
1834 MLQO01000009.1 GCA001854465_00889 gene open 16083-18206 ftsH
1835 MLQO01000009.1 GCA001854465_00890 gene open 18320-18577 rpsO
1836 MLQO01000009.1 GCA001854465_00891 gene open 18829-19938
1837 MLQO01000009.1 GCA001854465_00892 gene open 19990-20793
1838 MLQO01000009.1 GCA001854465_00893 gene open 20888-28642
1839 MLQO01000009.1 GCA001854465_00894 gene open 28660-29247
1840 MLQO01000009.1 GCA001854465_00895 gene open 29806-30372 ahpC
1841 MLQO01000009.1 GCA001854465_00896 gene open 30751-32388 ahpF
1842 MLQO01000009.1 GCA001854465_00897 gene open 32516-33940 creD
1843 MLQO01000009.1 GCA001854465_00898 gene open 34054-35226
1844 MLQO01000009.1 GCA001854465_00899 gene open 35256-35912 gntR
1845 MLQO01000009.1 GCA001854465_00900 gene open 36193-37575 tpl
1846 MLQO01000009.1 GCA001854465_00901 gene open 37706-39022 yocR
1847 MLQO01000009.1 GCA001854465_00902 gene open 39203-39844
1848 MLQO01000009.1 GCA001854465_00903 gene open 39855-41198 glmU
1849 MLQO01000009.1 GCA001854465_00904 gene open 41200-42150 prs
1850 MLQO01000009.1 GCA001854465_00905 gene open 42150-42803 tsaC
1851 MLQO01000009.1 GCA001854465_00906 gene open 42800-43243
1852 MLQO01000009.1 GCA001854465_00907 gene open 43648-44361 raSEA
1853 MLQO01000009.1 GCA001854465_00908 gene open 44358-45065 yhhQ
1854 MLQO01000009.1 GCA001854465_00909 gene open 45189-45473 aF2118
1855 MLQO01000009.1 GCA001854465_00910 gene open 45460-46602 hipA
1856 MLQO01000009.1 GCA001854465_00911 gene open 46626-47186
1857 MLQO01000009.1 GCA001854465_00912 gene open 47179-48984
1858 MLQO01000009.1 GCA001854465_00913 gene open 49301-49849 bioY
1859 MLQO01000009.1 GCA001854465_00914 gene open 49864-50658 ecfA1
1860 MLQO01000009.1 GCA001854465_00915 gene open 50642-51457 ecfA2
1861 MLQO01000009.1 GCA001854465_00916 gene open 51587-52390 cbiQ
1862 MLQO01000009.1 GCA001854465_00917 gene open 52335-52886 btuE
1863 MLQO01000009.1 GCA001854465_00918 gene open 52900-53622 opuBA
1864 MLQO01000009.1 GCA001854465_00919 gene open 53622-55163 osmF
1865 MLQO01000009.1 GCA001854465_00920 gene open 55123-55605 marR
1866 MLQO01000009.1 GCA001854465_00921 gene open 56177-57280
1867 MLQO01000009.1 GCA001854465_00922 gene open 57340-59385
1868 MLQO01000009.1 GCA001854465_00923 gene open 59411-62074 valS
1869 MLQO01000009.1 GCA001854465_00924 gene open 62104-62973
1870 MLQO01000009.1 GCA001854465_00925 gene open 62991-63965
1871 MLQO01000009.1 GCA001854465_00926 gene open 63998-64582 yihA
1872 MLQO01000009.1 GCA001854465_00927 gene open 64598-66904 lon
1873 MLQO01000009.1 GCA001854465_00928 gene open 66914-68185 clpX
1874 MLQO01000009.1 GCA001854465_00929 gene open 68197-68778 clpP
1875 MLQO01000009.1 GCA001854465_00930 gene open 69289-70584 tig
1876 MLQO01000009.1 GCA001854465_00931 gene open 70600-72273 recJ
1877 MLQO01000009.1 GCA001854465_00932 gene open 72273-72635 rbfA
1878 MLQO01000009.1 GCA001854465_00933 gene open 72650-74893 infB
1879 MLQO01000009.1 GCA001854465_00934 gene open 74890-75420 ylxR
1880 MLQO01000009.1 GCA001854465_00935 gene open 75413-76486 rpsA
1881 MLQO01000009.1 GCA001854465_00936 gene open 76514-76984 rimP
1882 MLQO01000010.1 regulatory_region open 66330-66428 Purine riboswitch aptamer
1883 MLQO01000010.1 repeat_region open 49932-50149 CRISPR array with 3 repeats of length 40%2C consensus sequence AATAAAGCCAGTGGAGAGAATAGTTCTGCTTTTGGATATA and spacer length 44
1884 MLQO01000010.1 GCA001854465_00938 CDS open 74-1513 _na     479_aa cls cardiolipin synthase
1885 MLQO01000010.1 GCA001854465_00939 CDS open 1671-2468 _na     265_aa SIR2-like domain-containing protein
1886 MLQO01000010.1 GCA001854465_00940 CDS open 2735-3421 _na     228_aa fliM Flagellar motor switch protein FliM
1887 MLQO01000010.1 GCA001854465_00941 CDS open 3434-4213 _na     259_aa yjbM GTP pyrophosphokinase
1888 MLQO01000010.1 GCA001854465_00942 CDS open 4273-4932 _na     219_aa hypothetical protein
1889 MLQO01000010.1 GCA001854465_00943 CDS open 5021-5665 _na     214_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1890 MLQO01000010.1 GCA001854465_00944 CDS open 5646-6107 _na     153_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1891 MLQO01000010.1 GCA001854465_00945 CDS open 6121-6585 _na     154_aa rfaE D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase
1892 MLQO01000010.1 GCA001854465_00946 CDS open 6572-7192 _na     206_aa CoA pyrophosphatase
1893 MLQO01000010.1 GCA001854465_00947 CDS open 7377-7862 _na     161_aa YcxB-like protein domain-containing protein
1894 MLQO01000010.1 GCA001854465_00948 CDS open 7872-9137 _na     421_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1895 MLQO01000010.1 GCA001854465_00949 CDS open 9121-10194 _na     357_aa aroC chorismate synthase
1896 MLQO01000010.1 GCA001854465_00950 CDS open 10187-11551 _na     454_aa norM Multidrug export protein MepA
1897 MLQO01000010.1 GCA001854465_00951 CDS open 11680-12366 _na     228_aa Crp/Fnr family transcriptional regulator
1898 MLQO01000010.1 GCA001854465_00952 CDS open 12555-13622 _na     355_aa asrA anaerobic sulfite reductase subunit AsrA
1899 MLQO01000010.1 GCA001854465_00953 CDS open 13629-14432 _na     267_aa asrB anaerobic sulfite reductase subunit AsrB
1900 MLQO01000010.1 GCA001854465_00954 CDS open 14448-15422 _na     324_aa asrC sulfite reductase subunit C
1901 MLQO01000010.1 GCA001854465_00955 CDS open 15642-16286 _na     214_aa Inositolphosphotransferase Aur1/Ipt1 domain-containing protein
1902 MLQO01000010.1 GCA001854465_00956 CDS open 16340-16990 _na     216_aa Zinc metalloprotease
1903 MLQO01000010.1 GCA001854465_00957 CDS open 17123-17935 _na     270_aa DUF4198 domain-containing protein
1904 MLQO01000010.1 GCA001854465_00958 CDS open 17995-19113 _na     372_aa fieF Cation efflux protein cytoplasmic domain-containing protein
1905 MLQO01000010.1 GCA001854465_00959 CDS open 19100-23527 _na     1475_aa Disulfide isomerase
1906 MLQO01000010.1 GCA001854465_00960 CDS open 23595-24341 _na     248_aa cobK precorrin-6A reductase
1907 MLQO01000010.1 GCA001854465_00961 CDS open 24366-25115 _na     249_aa cobJ Precorrin-3B C(17)-methyltransferase
1908 MLQO01000010.1 GCA001854465_00962 CDS open 25108-26118 _na     336_aa cbiG cobalt-precorrin 5A hydrolase
1909 MLQO01000010.1 GCA001854465_00963 CDS open 26131-26862 _na     243_aa DUF4130 domain-containing protein
1910 MLQO01000010.1 GCA001854465_00964 CDS open 26953-28203 _na     416_aa Radical SAM core domain-containing protein
1911 MLQO01000010.1 GCA001854465_00965 CDS open 28428-28955 _na     175_aa DUF4375 domain-containing protein
1912 MLQO01000010.1 GCA001854465_00966 CDS open 29298-29930 _na     210_aa DJ-1/PfpI domain-containing protein
1913 MLQO01000010.1 GCA001854465_00967 CDS open 29978-30547 _na     189_aa DUF6685 domain-containing protein
1914 MLQO01000010.1 GCA001854465_00968 CDS open 30859-31617 _na     252_aa cobM precorrin-4 C(11)-methyltransferase
1915 MLQO01000010.1 GCA001854465_00969 CDS open 31596-32318 _na     240_aa cobI precorrin-2 C(20)-methyltransferase
1916 MLQO01000010.1 GCA001854465_00970 CDS open 32344-32901 _na     185_aa psbP PsbP C-terminal domain-containing protein
1917 MLQO01000010.1 GCA001854465_00971 CDS open 32982-33446 _na     154_aa DUF3805 domain-containing protein
1918 MLQO01000010.1 GCA001854465_00972 CDS open 33486-34304 _na     272_aa GIY-YIG nuclease family protein
1919 MLQO01000010.1 GCA001854465_00973 CDS open 34343-34846 _na     167_aa Lipoprotein
1920 MLQO01000010.1 GCA001854465_00974 CDS open 34855-36093 _na     412_aa ATPase
1921 MLQO01000010.1 GCA001854465_00975 CDS open 36283-36852 _na     189_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
1922 MLQO01000010.1 GCA001854465_00976 CDS open 36874-37839 _na     321_aa ldhA 3-phosphoglycerate dehydrogenase
1923 MLQO01000010.1 GCA001854465_00977 CDS open 37826-38524 _na     232_aa cbiE Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit
1924 MLQO01000010.1 GCA001854465_00978 CDS open 38469-39596 _na     375_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
1925 MLQO01000010.1 GCA001854465_00979 CDS open 39613-40356 _na     247_aa PF14137 domain protein
1926 MLQO01000010.1 GCA001854465_00980 CDS open 40353-41129 _na     258_aa PF14137 domain protein
1927 MLQO01000010.1 GCA001854465_00981 CDS open 41154-41804 _na     216_aa cobH Cobalamin biosynthesis precorrin-8X methylmutase CobH/CbiC domain-containing protein
1928 MLQO01000010.1 GCA001854465_00982 CDS open 41828-42796 _na     322_aa Fido domain-containing protein
1929 MLQO01000010.1 GCA001854465_00983 CDS open 42796-44130 _na     444_aa cbiA cobyrinate a%2Cc-diamide synthase
1930 MLQO01000010.1 GCA001854465_00984 CDS open 44146-45225 _na     359_aa hisC threonine-phosphate decarboxylase
1931 MLQO01000010.1 GCA001854465_00985 CDS open 45222-46196 _na     324_aa cbiB adenosylcobinamide-phosphate synthase CbiB
1932 MLQO01000010.1 GCA001854465_00986 CDS open 46216-47133 _na     305_aa PH domain-containing protein
1933 MLQO01000010.1 GCA001854465_00987 CDS open 47160-48650 _na     496_aa cobQ cobyric acid synthase
1934 MLQO01000010.1 GCA001854465_00988 CDS open 52036-53331 _na     431_aa Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
1935 MLQO01000010.1 GCA001854465_00989 CDS open 53474-53881 _na     135_aa hypothetical protein
1936 MLQO01000010.1 GCA001854465_00990 CDS open 53895-54149 _na     84_aa hypothetical protein
1937 MLQO01000010.1 GCA001854465_00991 CDS open 54214-55494 _na     426_aa purD Phosphoribosylamine--glycine ligase
1938 MLQO01000010.1 GCA001854465_00992 CDS open 55510-57024 _na     504_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1939 MLQO01000010.1 GCA001854465_00993 CDS open 57063-57872 _na     269_aa yktD O-methyltransferase
1940 MLQO01000010.1 GCA001854465_00994 CDS open 57933-58490 _na     185_aa purN Phosphoribosylglycinamide formyltransferase
1941 MLQO01000010.1 GCA001854465_00995 CDS open 58478-59497 _na     339_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
1942 MLQO01000010.1 GCA001854465_00996 CDS open 59509-60858 _na     449_aa purF amidophosphoribosyltransferase
1943 MLQO01000010.1 GCA001854465_00997 CDS open 60892-61605 _na     237_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
1944 MLQO01000010.1 GCA001854465_00998 CDS open 61884-62357 _na     157_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
1945 MLQO01000010.1 GCA001854465_00999 CDS open 62379-66116 _na     1245_aa purL2 phosphoribosylformylglycinamidine synthase
1946 MLQO01000010.1 GCA001854465_01000 CDS open 66558-67349 _na     263_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1947 MLQO01000010.1 GCA001854465_01001 CDS open 67352-68428 _na     358_aa rfaF Heptosyltransferase
1948 MLQO01000010.1 GCA001854465_01002 CDS open 68432-69883 _na     483_aa trkG TrkH family potassium uptake protein
1949 MLQO01000010.1 GCA001854465_00938 gene open 74-1513 cls
1950 MLQO01000010.1 GCA001854465_00939 gene open 1671-2468
1951 MLQO01000010.1 GCA001854465_00940 gene open 2735-3421 fliM
1952 MLQO01000010.1 GCA001854465_00941 gene open 3434-4213 yjbM
1953 MLQO01000010.1 GCA001854465_00942 gene open 4273-4932
1954 MLQO01000010.1 GCA001854465_00943 gene open 5021-5665 tsaB
1955 MLQO01000010.1 GCA001854465_00944 gene open 5646-6107 tsaE
1956 MLQO01000010.1 GCA001854465_00945 gene open 6121-6585 rfaE
1957 MLQO01000010.1 GCA001854465_00946 gene open 6572-7192
1958 MLQO01000010.1 GCA001854465_00947 gene open 7377-7862
1959 MLQO01000010.1 GCA001854465_00948 gene open 7872-9137 aroA
1960 MLQO01000010.1 GCA001854465_00949 gene open 9121-10194 aroC
1961 MLQO01000010.1 GCA001854465_00950 gene open 10187-11551 norM
1962 MLQO01000010.1 GCA001854465_00951 gene open 11680-12366
1963 MLQO01000010.1 GCA001854465_00952 gene open 12555-13622 asrA
1964 MLQO01000010.1 GCA001854465_00953 gene open 13629-14432 asrB
1965 MLQO01000010.1 GCA001854465_00954 gene open 14448-15422 asrC
1966 MLQO01000010.1 GCA001854465_00955 gene open 15642-16286
1967 MLQO01000010.1 GCA001854465_00956 gene open 16340-16990
1968 MLQO01000010.1 GCA001854465_00957 gene open 17123-17935
1969 MLQO01000010.1 GCA001854465_00958 gene open 17995-19113 fieF
1970 MLQO01000010.1 GCA001854465_00959 gene open 19100-23527
1971 MLQO01000010.1 GCA001854465_00960 gene open 23595-24341 cobK
1972 MLQO01000010.1 GCA001854465_00961 gene open 24366-25115 cobJ
1973 MLQO01000010.1 GCA001854465_00962 gene open 25108-26118 cbiG
1974 MLQO01000010.1 GCA001854465_00963 gene open 26131-26862
1975 MLQO01000010.1 GCA001854465_00964 gene open 26953-28203
1976 MLQO01000010.1 GCA001854465_00965 gene open 28428-28955
1977 MLQO01000010.1 GCA001854465_00966 gene open 29298-29930
1978 MLQO01000010.1 GCA001854465_00967 gene open 29978-30547
1979 MLQO01000010.1 GCA001854465_00968 gene open 30859-31617 cobM
1980 MLQO01000010.1 GCA001854465_00969 gene open 31596-32318 cobI
1981 MLQO01000010.1 GCA001854465_00970 gene open 32344-32901 psbP
1982 MLQO01000010.1 GCA001854465_00971 gene open 32982-33446
1983 MLQO01000010.1 GCA001854465_00972 gene open 33486-34304
1984 MLQO01000010.1 GCA001854465_00973 gene open 34343-34846
1985 MLQO01000010.1 GCA001854465_00974 gene open 34855-36093
1986 MLQO01000010.1 GCA001854465_00975 gene open 36283-36852 cbiT
1987 MLQO01000010.1 GCA001854465_00976 gene open 36874-37839 ldhA
1988 MLQO01000010.1 GCA001854465_00977 gene open 37826-38524 cbiE
1989 MLQO01000010.1 GCA001854465_00978 gene open 38469-39596 cbiD
1990 MLQO01000010.1 GCA001854465_00979 gene open 39613-40356
1991 MLQO01000010.1 GCA001854465_00980 gene open 40353-41129
1992 MLQO01000010.1 GCA001854465_00981 gene open 41154-41804 cobH
1993 MLQO01000010.1 GCA001854465_00982 gene open 41828-42796
1994 MLQO01000010.1 GCA001854465_00983 gene open 42796-44130 cbiA
1995 MLQO01000010.1 GCA001854465_00984 gene open 44146-45225 hisC
1996 MLQO01000010.1 GCA001854465_00985 gene open 45222-46196 cbiB
1997 MLQO01000010.1 GCA001854465_00986 gene open 46216-47133
1998 MLQO01000010.1 GCA001854465_00987 gene open 47160-48650 cobQ
1999 MLQO01000010.1 GCA001854465_00988 gene open 52036-53331
2000 MLQO01000010.1 GCA001854465_00989 gene open 53474-53881