HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Cutibacterium avidum (GCA_001866625.1)

Select a Genome:
BAKTA Annotations for GCA_001866625.1
Genome Selected: Cutibacterium avidum
ContigsBases CDSrRNA tmRNAtRNA
9 2522071 2295 6 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4718 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4718 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 LLJI01000001.1 rep_origin open 608011-608575
2 LLJI01000001.1 rep_origin open 610085-610448
3 LLJI01000001.1 GCA001866625_00365 gene open 353876-353972 Bacteria_small_SRP
4 LLJI01000001.1 GCA001866625_00365 ncRNA open 353876-353972 Bacterial small signal recognition particle RNA
5 LLJI01000001.1 regulatory_region open 174669-174727 msiK RNA
6 LLJI01000001.1 regulatory_region open 217057-217221 Cobalamin riboswitch aptamer
7 LLJI01000001.1 regulatory_region open 434541-434644 TPP riboswitch aptamer (THI element)
8 LLJI01000001.1 regulatory_region open 487822-487916 TPP riboswitch aptamer (THI element)
9 LLJI01000001.1 repeat_region open 831124-831954 CRISPR array with 14 repeats of length 28%2C consensus sequence GGCTCACCCCCGCGTAGGCGGGGAAGAC and spacer length 33
10 LLJI01000001.1 GCA001866625_00001 CDS open 821-1594 _na     257_aa Lipoprotein
11 LLJI01000001.1 GCA001866625_00002 CDS open 1614-2369 _na     251_aa yjhB Nudix hydrolase domain-containing protein
12 LLJI01000001.1 GCA001866625_00003 CDS open 2421-3257 _na     278_aa Bax inhibitor-1/YccA family protein
13 LLJI01000001.1 GCA001866625_00005 CDS open 3484-4416 _na     310_aa Exopolyphosphatase
14 LLJI01000001.1 GCA001866625_00006 CDS open 4429-4953 _na     174_aa Septum formation initiator family protein
15 LLJI01000001.1 GCA001866625_00007 CDS open 4961-5401 _na     146_aa Septum formation initiator
16 LLJI01000001.1 GCA001866625_00008 CDS open 5694-5831 _na     45_aa Enolase
17 LLJI01000001.1 GCA001866625_00009 CDS open 5995-8481 _na     828_aa Surface-anchored protein
18 LLJI01000001.1 GCA001866625_00010 CDS open 8616-9896 _na     426_aa eno phosphopyruvate hydratase
19 LLJI01000001.1 GCA001866625_00011 CDS open 9967-10515 _na     182_aa Lipoprotein
20 LLJI01000001.1 GCA001866625_00012 CDS open 10596-10730 _na     44_aa hypothetical protein
21 LLJI01000001.1 GCA001866625_00013 CDS open 10765-11397 _na     210_aa mazG MazG family protein
22 LLJI01000001.1 GCA001866625_00014 CDS open 11403-11933 _na     176_aa Lipoprotein
23 LLJI01000001.1 GCA001866625_00015 CDS open 11998-12585 _na     195_aa hypothetical protein
24 LLJI01000001.1 GCA001866625_00016 CDS open 12616-13884 _na     422_aa ABC transporter permease
25 LLJI01000001.1 GCA001866625_00017 CDS open 13881-14630 _na     249_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
26 LLJI01000001.1 GCA001866625_00018 CDS open 14839-18501 _na     1220_aa mfd transcription-repair coupling factor
27 LLJI01000001.1 GCA001866625_00019 CDS open 18528-19667 _na     379_aa prsW PrsW family intramembrane metalloprotease
28 LLJI01000001.1 GCA001866625_00020 CDS open 19671-20273 _na     200_aa pth aminoacyl-tRNA hydrolase
29 LLJI01000001.1 GCA001866625_00021 CDS open 20270-20887 _na     205_aa 50S ribosomal protein L25/general stress protein Ctc
30 LLJI01000001.1 GCA001866625_00022 CDS open 21072-22040 _na     322_aa prsA ribose-phosphate diphosphokinase
31 LLJI01000001.1 GCA001866625_00023 CDS open 22037-23335 _na     432_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
32 LLJI01000001.1 GCA001866625_00025 CDS open 23590-24270 _na     226_aa TetR/AcrR family transcriptional regulator
33 LLJI01000001.1 GCA001866625_00026 CDS open 24252-24773 _na     173_aa pecS Transcriptional regulator PecS
34 LLJI01000001.1 GCA001866625_00027 CDS open 24770-25765 _na     331_aa 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
35 LLJI01000001.1 GCA001866625_00028 CDS open 25762-26658 _na     298_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
36 LLJI01000001.1 GCA001866625_00029 CDS open 26655-27563 _na     302_aa tatD TatD family hydrolase
37 LLJI01000001.1 GCA001866625_00030 CDS open 27560-28471 _na     303_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
38 LLJI01000001.1 GCA001866625_00031 CDS open 28499-30061 _na     520_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
39 LLJI01000001.1 GCA001866625_00032 CDS open 30146-31630 _na     494_aa uraA NCS2 family nucleotide:cation symporter-2
40 LLJI01000001.1 GCA001866625_00033 CDS open 31663-32751 _na     362_aa corA MIT family metal ion transporter CorA
41 LLJI01000001.1 GCA001866625_00034 CDS open 33251-33748 _na     165_aa Helix-turn-helix domain-containing protein
42 LLJI01000001.1 GCA001866625_00035 CDS open 33733-34365 _na     210_aa Tc1-like transposase DDE domain-containing protein
43 LLJI01000001.1 GCA001866625_00036 CDS open 34683-37625 _na     980_aa type I site-specific deoxyribonuclease
44 LLJI01000001.1 GCA001866625_00037 CDS open 37622-38692 _na     356_aa ImmA/IrrE family metallo-endopeptidase
45 LLJI01000001.1 GCA001866625_00038 CDS open 38704-38997 _na     97_aa Plasmid maintenance system killer protein
46 LLJI01000001.1 GCA001866625_00039 CDS open 39049-40380 _na     443_aa restriction endonuclease subunit S
47 LLJI01000001.1 GCA001866625_00040 CDS open 40380-41750 _na     456_aa class I SAM-dependent DNA methyltransferase
48 LLJI01000001.1 GCA001866625_00041 CDS open 42522-43739 _na     405_aa yhdJ Methyltransferase
49 LLJI01000001.1 GCA001866625_00042 CDS open 43720-44892 _na     390_aa mcrC McrC family protein
50 LLJI01000001.1 GCA001866625_00043 CDS open 44892-46424 _na     510_aa mMP0363 ATPase family associated with various cellular activities (AAA)
51 LLJI01000001.1 GCA001866625_00044 CDS open 46548-46760 _na     70_aa yozG Helix-turn-helix transcriptional regulator
52 LLJI01000001.1 GCA001866625_00045 CDS open 46757-48406 _na     549_aa yydB DUF2326 domain-containing protein
53 LLJI01000001.1 GCA001866625_00046 CDS open 48400-48618 _na     72_aa ABC-three component system middle component 7
54 LLJI01000001.1 GCA001866625_00047 CDS open 48605-49774 _na     389_aa ABC-three component systems C-terminal domain-containing protein
55 LLJI01000001.1 GCA001866625_00048 CDS open 50249-50890 _na     213_aa rpoE Sigma-70 family RNA polymerase sigma factor
56 LLJI01000001.1 GCA001866625_00049 CDS open 50954-51196 _na     80_aa Hypothetical phage protein
57 LLJI01000001.1 GCA001866625_00050 CDS open 51193-51621 _na     142_aa rRNA biogenesis protein rrp5
58 LLJI01000001.1 GCA001866625_00051 CDS open 51614-52747 _na     377_aa DUF2800 domain-containing protein
59 LLJI01000001.1 GCA001866625_00052 CDS open 52773-53327 _na     184_aa DUF2815 domain-containing protein
60 LLJI01000001.1 GCA001866625_00053 CDS open 53345-53554 _na     69_aa DUF1049 domain-containing protein
61 LLJI01000001.1 GCA001866625_00054 CDS open 53642-55603 _na     653_aa polA DNA-directed DNA polymerase
62 LLJI01000001.1 GCA001866625_00055 CDS open 55588-56409 _na     273_aa TIGR02391 family protein
63 LLJI01000001.1 GCA001866625_00056 CDS open 56573-57340 _na     255_aa kilAC Bro-N domain-containing protein
64 LLJI01000001.1 GCA001866625_00057 CDS open 57337-57780 _na     147_aa DUF4406 domain-containing protein
65 LLJI01000001.1 GCA001866625_00058 CDS open 57777-60041 _na     754_aa Hypothetical phage protein
66 LLJI01000001.1 GCA001866625_00059 CDS open 60175-60453 _na     92_aa VRR-NUC domain-containing protein
67 LLJI01000001.1 GCA001866625_00060 CDS open 60434-61795 _na     453_aa hepA Helicase ATP-binding domain-containing protein
68 LLJI01000001.1 GCA001866625_00061 CDS open 61792-62256 _na     154_aa rinA Phage transcriptional regulator%2C RinA family
69 LLJI01000001.1 GCA001866625_00062 CDS open 62413-62790 _na     125_aa mcrA Putative HNH nuclease YajD
70 LLJI01000001.1 GCA001866625_00063 CDS open 63039-63614 _na     191_aa Terminase
71 LLJI01000001.1 GCA001866625_00064 CDS open 63703-64893 _na     396_aa metK methionine adenosyltransferase
72 LLJI01000001.1 GCA001866625_00065 CDS open 64865-66115 _na     416_aa spo0J DNA adenine methyltransferase YhdJ
73 LLJI01000001.1 GCA001866625_00066 CDS open 66262-66447 _na     61_aa Cell division protein
74 LLJI01000001.1 GCA001866625_00067 CDS open 66444-67094 _na     216_aa Phage-associated protein
75 LLJI01000001.1 GCA001866625_00068 CDS open 67309-67596 _na     95_aa Nucleotide modification associated domain-containing protein
76 LLJI01000001.1 GCA001866625_00069 CDS open 67630-67920 _na     96_aa Pseudouridine synthase
77 LLJI01000001.1 GCA001866625_00070 CDS open 68437-69039 _na     200_aa cadD Cadmium resistance transporter
78 LLJI01000001.1 GCA001866625_00071 CDS open 69036-69425 _na     129_aa arsR HTH-type transcriptional regulator CmtR
79 LLJI01000001.1 GCA001866625_00072 CDS open 69621-70229 _na     202_aa DUF4263 domain-containing protein
80 LLJI01000001.1 GCA001866625_00073 CDS open 70681-72279 _na     532_aa ymfN Phage terminase%2C large subunit
81 LLJI01000001.1 GCA001866625_00074 CDS open 72309-73616 _na     435_aa beeE phage portal protein
82 LLJI01000001.1 GCA001866625_00075 CDS open 73613-74446 _na     277_aa clpP ATP-dependent Clp protease proteolytic subunit
83 LLJI01000001.1 GCA001866625_00076 CDS open 74468-75688 _na     406_aa gp36 phage major capsid protein
84 LLJI01000001.1 GCA001866625_00077 CDS open 75721-76035 _na     104_aa head-tail connector protein
85 LLJI01000001.1 GCA001866625_00078 CDS open 76039-76401 _na     120_aa Phage head-tail adaptor
86 LLJI01000001.1 GCA001866625_00079 CDS open 76370-76807 _na     145_aa HK97-gp10 family putative phage morphogenesis protein
87 LLJI01000001.1 GCA001866625_00080 CDS open 76804-77148 _na     114_aa Integron-associated effector binding protein domain-containing protein
88 LLJI01000001.1 GCA001866625_00081 CDS open 77167-77763 _na     198_aa Major tail protein
89 LLJI01000001.1 GCA001866625_00082 CDS open 77776-78186 _na     136_aa zapA Cell division protein ZapA
90 LLJI01000001.1 GCA001866625_00083 CDS open 78407-81094 _na     895_aa Phage tail protein
91 LLJI01000001.1 GCA001866625_00084 CDS open 81094-81780 _na     228_aa yomH Phage-related protein
92 LLJI01000001.1 GCA001866625_00085 CDS open 81862-84783 _na     973_aa Phage minor structural protein
93 LLJI01000001.1 GCA001866625_00086 CDS open 84805-85245 _na     146_aa DUF1617 domain-containing protein
94 LLJI01000001.1 GCA001866625_00087 CDS open 85242-85451 _na     69_aa hypothetical protein
95 LLJI01000001.1 GCA001866625_00088 CDS open 85537-86004 _na     155_aa Holin
96 LLJI01000001.1 GCA001866625_00089 CDS open 86004-86846 _na     280_aa ampD N-acetylmuramoyl-L-alanine amidase
97 LLJI01000001.1 GCA001866625_00090 CDS open 87329-87739 _na     136_aa RNA polymerase subunit sigma-70
98 LLJI01000001.1 GCA001866625_00091 CDS open 87736-87951 _na     71_aa Dihydroorotase
99 LLJI01000001.1 GCA001866625_00092 CDS open 87917-89407 _na     496_aa spoIVCA Recombinase family protein
100 LLJI01000001.1 GCA001866625_00093 CDS open 89408-90994 _na     528_aa spoIVCA Resolvase/invertase-type recombinase catalytic domain-containing protein
101 LLJI01000001.1 GCA001866625_00094 CDS open 91101-91517 _na     138_aa GCN5 family acetyltransferase
102 LLJI01000001.1 GCA001866625_00095 CDS open 91543-92247 _na     234_aa type I restriction-modification system subunit M N-terminal domain-containing protein
103 LLJI01000001.1 GCA001866625_00096 CDS open 92477-93076 _na     199_aa TetR/AcrR family transcriptional regulator
104 LLJI01000001.1 GCA001866625_00098 CDS open 96331-97137 _na     268_aa hypothetical protein
105 LLJI01000001.1 GCA001866625_00099 CDS open 97210-97917 _na     235_aa [ribosomal protein uS5]-alanine N-acetyltransferase
106 LLJI01000001.1 GCA001866625_00100 CDS open 97922-99229 _na     435_aa glp gephyrin-like molybdotransferase Glp
107 LLJI01000001.1 GCA001866625_00101 CDS open 99304-99942 _na     212_aa 5-formyltetrahydrofolate cyclo-ligase
108 LLJI01000001.1 GCA001866625_00102 CDS open 100026-100322 _na     98_aa Type I antifreeze protein
109 LLJI01000001.1 GCA001866625_00103 CDS open 100411-101082 _na     223_aa SAF domain protein
110 LLJI01000001.1 GCA001866625_00104 CDS open 101197-101565 _na     122_aa mscL large conductance mechanosensitive channel protein MscL
111 LLJI01000001.1 GCA001866625_00105 CDS open 101572-101943 _na     123_aa Mycothiol-dependent maleylpyruvate isomerase metal-binding domain-containing protein
112 LLJI01000001.1 GCA001866625_00106 CDS open 101940-103334 _na     464_aa qRI1 UTP--glucose-1-phosphate uridylyltransferase
113 LLJI01000001.1 GCA001866625_00107 CDS open 103370-105961 _na     863_aa GlcNAc-PI de-N-acetylase
114 LLJI01000001.1 GCA001866625_00109 CDS open 106203-107819 _na     538_aa araJ Transporter%2C major facilitator family protein
115 LLJI01000001.1 GCA001866625_00110 CDS open 107995-108360 _na     121_aa trxA thioredoxin
116 LLJI01000001.1 GCA001866625_00111 CDS open 108520-109599 _na     359_aa hypothetical protein
117 LLJI01000001.1 GCA001866625_00112 CDS open 109620-110318 _na     232_aa mntR Iron-dependent repressor IdeR
118 LLJI01000001.1 GCA001866625_00113 CDS open 110469-111599 _na     376_aa nagA N-acetylglucosamine-6-phosphate deacetylase
119 LLJI01000001.1 GCA001866625_00114 CDS open 111696-112814 _na     372_aa serC phosphoserine transaminase
120 LLJI01000001.1 GCA001866625_00115 CDS open 112811-113794 _na     327_aa Serine/threonine protein kinase
121 LLJI01000001.1 GCA001866625_00116 CDS open 113954-114664 _na     236_aa hypothetical protein
122 LLJI01000001.1 GCA001866625_00117 CDS open 114639-116159 _na     506_aa nCS2 Xanthine/uracil permease
123 LLJI01000001.1 GCA001866625_00118 CDS open 116209-116445 _na     78_aa DUF2530 domain-containing protein
124 LLJI01000001.1 GCA001866625_00119 CDS open 116468-117268 _na     266_aa PF11228 family protein
125 LLJI01000001.1 GCA001866625_00120 CDS open 117268-117651 _na     127_aa cspC Cold-shock domain family protein
126 LLJI01000001.1 GCA001866625_00121 CDS open 117793-118578 _na     261_aa nagB glucosamine-6-phosphate deaminase
127 LLJI01000001.1 GCA001866625_00122 CDS open 119155-119505 _na     116_aa hypothetical protein
128 LLJI01000001.1 GCA001866625_00123 CDS open 119502-121631 _na     709_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
129 LLJI01000001.1 GCA001866625_00124 CDS open 121694-123352 _na     552_aa DNA repair helicase XPB
130 LLJI01000001.1 GCA001866625_00125 CDS open 123396-124406 _na     336_aa Beta-lactamase
131 LLJI01000001.1 GCA001866625_00126 CDS open 124434-125120 _na     228_aa Copper homeostasis cutC-like protein
132 LLJI01000001.1 GCA001866625_00127 CDS open 125124-126005 _na     293_aa CAAX amino protease
133 LLJI01000001.1 GCA001866625_00128 CDS open 126107-127738 _na     543_aa groL chaperonin GroEL
134 LLJI01000001.1 GCA001866625_00129 CDS open 128075-128359 _na     94_aa DUF3263 domain-containing protein
135 LLJI01000001.1 GCA001866625_00130 CDS open 128408-129589 _na     393_aa manA mannose-6-phosphate isomerase%2C class I
136 LLJI01000001.1 GCA001866625_00131 CDS open 129634-130098 _na     154_aa S-ribosylhomocysteine lyase
137 LLJI01000001.1 GCA001866625_00133 CDS open 131130-131894 _na     254_aa Metal binding protein
138 LLJI01000001.1 GCA001866625_00134 CDS open 131891-132730 _na     279_aa Adenosylcobinamide-GDP ribazoletransferase
139 LLJI01000001.1 GCA001866625_00135 CDS open 132727-134394 _na     555_aa cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
140 LLJI01000001.1 GCA001866625_00136 CDS open 134623-135375 _na     250_aa cobalt-precorrin-6A reductase
141 LLJI01000001.1 GCA001866625_00137 CDS open 135369-136145 _na     258_aa uroporphyrinogen-III C-methyltransferase
142 LLJI01000001.1 GCA001866625_00138 CDS open 136145-138583 _na     812_aa cobyrinate a%2Cc-diamide synthase
143 LLJI01000001.1 GCA001866625_00139 CDS open 138577-139191 _na     204_aa cobO cob(I)yrinic acid a%2Cc-diamide adenosyltransferase
144 LLJI01000001.1 GCA001866625_00140 CDS open 139392-139988 _na     198_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
145 LLJI01000001.1 GCA001866625_00141 CDS open 140029-140718 _na     229_aa kdpD Sensor protein KdpD transmembrane domain-containing protein
146 LLJI01000001.1 GCA001866625_00142 CDS open 140786-141619 _na     277_aa ABC transporter ATP-binding protein
147 LLJI01000001.1 GCA001866625_00143 CDS open 141616-142461 _na     281_aa cbiQ cobalt ECF transporter T component CbiQ
148 LLJI01000001.1 GCA001866625_00144 CDS open 142458-142892 _na     144_aa energy-coupling factor ABC transporter substrate-binding protein
149 LLJI01000001.1 GCA001866625_00145 CDS open 142885-143568 _na     227_aa cbiM energy-coupling factor ABC transporter permease
150 LLJI01000001.1 GCA001866625_00146 CDS open 143861-144514 _na     217_aa cobH precorrin-8X methylmutase
151 LLJI01000001.1 GCA001866625_00147 CDS open 144543-145415 _na     290_aa hypothetical protein
152 LLJI01000001.1 GCA001866625_00148 CDS open 145442-146713 _na     423_aa sirB precorrin-2 dehydrogenase
153 LLJI01000001.1 GCA001866625_00149 CDS open 146710-149286 _na     858_aa CbiE/G/H fusion protein%2C precorrin-3B C17-methyltransferase
154 LLJI01000001.1 GCA001866625_00150 CDS open 149283-150254 _na     323_aa cobM precorrin-4 C(11)-methyltransferase
155 LLJI01000001.1 GCA001866625_00151 CDS open 150251-151027 _na     258_aa cobI precorrin-2 C(20)-methyltransferase
156 LLJI01000001.1 GCA001866625_00152 CDS open 151210-152670 _na     486_aa cobyric acid synthase
157 LLJI01000001.1 GCA001866625_00153 CDS open 152670-153698 _na     342_aa cbiB adenosylcobinamide-phosphate synthase CbiB
158 LLJI01000001.1 GCA001866625_00154 CDS open 154023-154634 _na     203_aa DNA-binding response regulator
159 LLJI01000001.1 GCA001866625_00155 CDS open 154631-155737 _na     368_aa Histidine kinase
160 LLJI01000001.1 GCA001866625_00156 CDS open 155765-156517 _na     250_aa Putative membrane protein
161 LLJI01000001.1 GCA001866625_00157 CDS open 156514-157455 _na     313_aa ABC superfamily ATP binding cassette transporter ABC protein
162 LLJI01000001.1 GCA001866625_00158 CDS open 157530-158117 _na     195_aa Phosphoglycerate mutase
163 LLJI01000001.1 GCA001866625_00159 CDS open 158137-159153 _na     338_aa Alcohol dehydrogenase
164 LLJI01000001.1 GCA001866625_00160 CDS open 159248-159778 _na     176_aa O-acetyl-ADP-ribose deacetylase
165 LLJI01000001.1 GCA001866625_00161 CDS open 159788-160159 _na     123_aa DUF488 domain-containing protein
166 LLJI01000001.1 GCA001866625_00162 CDS open 160175-160966 _na     263_aa VTT domain-containing protein
167 LLJI01000001.1 GCA001866625_00163 CDS open 161134-161958 _na     274_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C ABC protein
168 LLJI01000001.1 GCA001866625_00164 CDS open 161955-162608 _na     217_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C permease protein
169 LLJI01000001.1 GCA001866625_00165 CDS open 162605-163300 _na     231_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C permease protein
170 LLJI01000001.1 GCA001866625_00166 CDS open 163323-164237 _na     304_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C substrate-binding protein
171 LLJI01000001.1 GCA001866625_00167 CDS open 164261-165463 _na     400_aa glycine C-acetyltransferase
172 LLJI01000001.1 GCA001866625_00168 CDS open 165487-166524 _na     345_aa tdh L-threonine 3-dehydrogenase
173 LLJI01000001.1 GCA001866625_00169 CDS open 166631-167524 _na     297_aa Sugar ABC superfamily ATP binding cassette transporter%2C membrane protein
174 LLJI01000001.1 GCA001866625_00170 CDS open 167517-168476 _na     319_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
175 LLJI01000001.1 GCA001866625_00171 CDS open 168476-169771 _na     431_aa Sugar ABC superfamily ATP binding cassette transporter%2C binding protein
176 LLJI01000001.1 GCA001866625_00172 CDS open 169797-172100 _na     767_aa Oxidoreductase
177 LLJI01000001.1 GCA001866625_00173 CDS open 172357-173787 _na     476_aa sdaA L-serine ammonia-lyase
178 LLJI01000001.1 GCA001866625_00174 CDS open 173984-174202 _na     72_aa hypothetical protein
179 LLJI01000001.1 GCA001866625_00175 CDS open 174199-174351 _na     50_aa hypothetical protein
180 LLJI01000001.1 GCA001866625_00176 CDS open 174336-174461 _na     41_aa hypothetical protein
181 LLJI01000001.1 GCA001866625_00177 CDS open 174732-175832 _na     366_aa malK Sugar ABC superfamily ATP binding cassette transporter%2C ABC protein
182 LLJI01000001.1 GCA001866625_00178 CDS open 175927-176283 _na     118_aa Asp23/Gls24 family envelope stress response protein
183 LLJI01000001.1 GCA001866625_00179 CDS open 176276-176800 _na     174_aa Asp23/Gls24 family envelope stress response protein
184 LLJI01000001.1 GCA001866625_00180 CDS open 176791-177366 _na     191_aa RNA polymerase sigma factor
185 LLJI01000001.1 GCA001866625_00181 CDS open 177427-178143 _na     238_aa amaP alkaline shock response membrane anchor protein AmaP
186 LLJI01000001.1 GCA001866625_00182 CDS open 178140-178694 _na     184_aa DUF6286 domain-containing protein
187 LLJI01000001.1 GCA001866625_00183 CDS open 178696-179109 _na     137_aa yloU Asp23/Gls24 family envelope stress response protein
188 LLJI01000001.1 GCA001866625_00184 CDS open 179109-179294 _na     61_aa DUF2273 domain-containing protein
189 LLJI01000001.1 GCA001866625_00185 CDS open 179306-179821 _na     171_aa Alkaline shock protein 23
190 LLJI01000001.1 GCA001866625_00186 CDS open 179970-181139 _na     389_aa Cystathionine beta-lyase
191 LLJI01000001.1 GCA001866625_00187 CDS open 181216-182613 _na     465_aa DUF4032 domain-containing protein
192 LLJI01000001.1 GCA001866625_00188 CDS open 182624-182872 _na     82_aa hypothetical protein
193 LLJI01000001.1 GCA001866625_00189 CDS open 182920-184350 _na     476_aa cysS cysteine--tRNA ligase
194 LLJI01000001.1 GCA001866625_00190 CDS open 184364-185326 _na     320_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
195 LLJI01000001.1 GCA001866625_00191 CDS open 185422-185736 _na     104_aa hypothetical protein
196 LLJI01000001.1 GCA001866625_00192 CDS open 186071-187171 _na     366_aa pfkB PfkB family carbohydrate kinase
197 LLJI01000001.1 GCA001866625_00193 CDS open 187298-188773 _na     491_aa glyA glycine hydroxymethyltransferase
198 LLJI01000001.1 GCA001866625_00194 CDS open 188924-189049 _na     41_aa hypothetical protein
199 LLJI01000001.1 GCA001866625_00195 CDS open 189312-190751 _na     479_aa L-asparagine permease
200 LLJI01000001.1 GCA001866625_00196 CDS open 190755-191747 _na     330_aa ansA L-asparaginase I
201 LLJI01000001.1 GCA001866625_00197 CDS open 191951-192256 _na     101_aa PTS family galactitol (Gat) porter component IIB
202 LLJI01000001.1 GCA001866625_00198 CDS open 192249-192713 _na     154_aa PTS family fructose/mannitol porter component IIA
203 LLJI01000001.1 GCA001866625_00199 CDS open 192747-193496 _na     249_aa gpmA phosphoglyceromutase
204 LLJI01000001.1 GCA001866625_00200 CDS open 193587-194651 _na     354_aa Polysaccharide deacetylase
205 LLJI01000001.1 GCA001866625_00201 CDS open 194810-195478 _na     222_aa phoU phosphate signaling complex protein PhoU
206 LLJI01000001.1 GCA001866625_00202 CDS open 195639-196820 _na     393_aa senX3 Sensor-like histidine kinase SenX3
207 LLJI01000001.1 GCA001866625_00203 CDS open 196817-197497 _na     226_aa ompR Sensory transduction protein RegX3
208 LLJI01000001.1 GCA001866625_00204 CDS open 197570-198070 _na     166_aa Lipoprotein
209 LLJI01000001.1 GCA001866625_00205 CDS open 198617-199102 _na     161_aa cdnL RNA polymerase-binding transcription factor CarD
210 LLJI01000001.1 GCA001866625_00206 CDS open 199188-199484 _na     98_aa PTS galactitol transporter subunit IIB
211 LLJI01000001.1 GCA001866625_00207 CDS open 199683-200078 _na     131_aa Protein-N(Pi)-phosphohistidine--sugar phosphotransferase
212 LLJI01000001.1 GCA001866625_00208 CDS open 200056-200538 _na     160_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
213 LLJI01000001.1 GCA001866625_00209 CDS open 200538-201341 _na     267_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
214 LLJI01000001.1 GCA001866625_00210 CDS open 201438-201704 _na     88_aa ptsH HPr family phosphocarrier protein
215 LLJI01000001.1 GCA001866625_00211 CDS open 201710-203383 _na     557_aa ptsA Phosphoenolpyruvate-protein phosphotransferase
216 LLJI01000001.1 GCA001866625_00212 CDS open 203494-204261 _na     255_aa ydfG Short-chain dehydrogenase/reductase family oxidoreductase
217 LLJI01000001.1 GCA001866625_00213 CDS open 204294-205679 _na     461_aa wcaJ Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase
218 LLJI01000001.1 GCA001866625_00214 CDS open 205720-206664 _na     314_aa ygfZ Folate-binding protein YgfZ
219 LLJI01000001.1 GCA001866625_00215 CDS open 206666-207166 _na     166_aa Ferric nitrobindin-like protein
220 LLJI01000001.1 GCA001866625_00216 CDS open 207360-207797 _na     145_aa dtd D-aminoacyl-tRNA deacylase
221 LLJI01000001.1 GCA001866625_00217 CDS open 207807-208691 _na     294_aa F5/8 type C domain-containing protein
222 LLJI01000001.1 GCA001866625_00218 CDS open 208802-209446 _na     214_aa ompR Transcriptional regulatory protein%2C C-terminal domain protein
223 LLJI01000001.1 GCA001866625_00219 CDS open 209589-211694 _na     701_aa ppk RNA degradosome polyphosphate kinase
224 LLJI01000001.1 GCA001866625_00220 CDS open 211701-212642 _na     313_aa Nudix hydrolase domain-containing protein
225 LLJI01000001.1 GCA001866625_00221 CDS open 212820-213971 _na     383_aa pstS phosphate ABC transporter substrate-binding protein PstS
226 LLJI01000001.1 GCA001866625_00222 CDS open 214079-215083 _na     334_aa pstC phosphate ABC transporter permease subunit PstC
227 LLJI01000001.1 GCA001866625_00223 CDS open 215080-216012 _na     310_aa pstA phosphate ABC transporter permease PstA
228 LLJI01000001.1 GCA001866625_00224 CDS open 216031-216807 _na     258_aa pstB phosphate ABC transporter ATP-binding protein PstB
229 LLJI01000001.1 GCA001866625_00225 CDS open 217260-217556 _na     98_aa hypothetical protein
230 LLJI01000001.1 GCA001866625_00226 CDS open 217572-218285 _na     237_aa Iron ABC transporter permease
231 LLJI01000001.1 GCA001866625_00227 CDS open 218282-219040 _na     252_aa Ferrichrome ABC superfamily ATP binding cassette transporter%2C ABC protein
232 LLJI01000001.1 GCA001866625_00228 CDS open 219024-219281 _na     85_aa hypothetical protein
233 LLJI01000001.1 GCA001866625_00229 CDS open 219420-220070 _na     216_aa ABC transporter substrate-binding protein
234 LLJI01000001.1 GCA001866625_00230 CDS open 220067-220837 _na     256_aa Methyltransferase domain-containing protein
235 LLJI01000001.1 GCA001866625_00231 CDS open 220884-221027 _na     47_aa hypothetical protein
236 LLJI01000001.1 GCA001866625_00232 CDS open 221165-222565 _na     466_aa mycothione reductase
237 LLJI01000001.1 GCA001866625_00233 CDS open 222841-223587 _na     248_aa DUF5134 domain-containing protein
238 LLJI01000001.1 GCA001866625_00234 CDS open 223779-225656 _na     625_aa ilvD dihydroxy-acid dehydratase
239 LLJI01000001.1 GCA001866625_00235 CDS open 225668-227191 _na     507_aa ilvA threonine ammonia-lyase%2C biosynthetic
240 LLJI01000001.1 GCA001866625_00236 CDS open 227215-228009 _na     264_aa Short-chain dehydrogenase/reductase SDR
241 LLJI01000001.1 GCA001866625_00237 CDS open 228013-229461 _na     482_aa Sigma factor
242 LLJI01000001.1 GCA001866625_00238 CDS open 229463-230356 _na     297_aa ccsB c-type cytochrome biogenesis protein CcsB
243 LLJI01000001.1 GCA001866625_00239 CDS open 230353-231954 _na     533_aa Cytochrome c biogenesis membrane protein
244 LLJI01000001.1 GCA001866625_00240 CDS open 231954-232715 _na     253_aa Cytochrome c biogenesis membrane protein
245 LLJI01000001.1 GCA001866625_00241 CDS open 232712-233281 _na     189_aa Thioredoxin family thiol:disulfide interchange protein
246 LLJI01000001.1 GCA001866625_00242 CDS open 233278-233946 _na     222_aa phoE Phosphoglycerate mutase
247 LLJI01000001.1 GCA001866625_00243 CDS open 234024-235739 _na     571_aa hemD uroporphyrinogen-III C-methyltransferase
248 LLJI01000001.1 GCA001866625_00244 CDS open 235863-236207 _na     114_aa Glutaredoxin family protein
249 LLJI01000001.1 GCA001866625_00245 CDS open 236226-236327 _na     33_aa 30S ribosomal protein bS22
250 LLJI01000001.1 GCA001866625_00246 CDS open 236463-237254 _na     263_aa proC pyrroline-5-carboxylate reductase
251 LLJI01000001.1 GCA001866625_00247 CDS open 237251-238282 _na     343_aa aspartate-semialdehyde dehydrogenase
252 LLJI01000001.1 GCA001866625_00248 CDS open 238327-239160 _na     277_aa Abortive infection protein
253 LLJI01000001.1 GCA001866625_00249 CDS open 239163-240122 _na     319_aa Proline dehydrogenase
254 LLJI01000001.1 GCA001866625_00250 CDS open 240119-240973 _na     284_aa Xylose isomerase domain protein
255 LLJI01000001.1 GCA001866625_00251 CDS open 241165-241803 _na     212_aa Glyoxalase-like domain-containing protein
256 LLJI01000001.1 GCA001866625_00252 CDS open 241867-243513 _na     548_aa Malate oxidoreductase
257 LLJI01000001.1 GCA001866625_00253 CDS open 243589-244989 _na     466_aa radA DNA repair protein RadA
258 LLJI01000001.1 GCA001866625_00254 CDS open 245039-246142 _na     367_aa disA DNA integrity scanning diadenylate cyclase DisA
259 LLJI01000001.1 GCA001866625_00255 CDS open 246218-246934 _na     238_aa DUF11 domain-containing protein
260 LLJI01000001.1 GCA001866625_00256 CDS open 246934-249039 _na     701_aa hemQ hydrogen peroxide-dependent heme synthase
261 LLJI01000001.1 GCA001866625_00257 CDS open 249036-250385 _na     449_aa Glutamyl-tRNA reductase
262 LLJI01000001.1 GCA001866625_00258 CDS open 250497-251561 _na     354_aa hemE uroporphyrinogen decarboxylase
263 LLJI01000001.1 GCA001866625_00259 CDS open 251585-253015 _na     476_aa hemY Putative protoporphyrinogen oxidase%2C HemY
264 LLJI01000001.1 GCA001866625_00260 CDS open 253051-254064 _na     337_aa hemC hydroxymethylbilane synthase
265 LLJI01000001.1 GCA001866625_00261 CDS open 254061-254786 _na     241_aa Uroporphyrinogen-III synthase
266 LLJI01000001.1 GCA001866625_00262 CDS open 254817-255863 _na     348_aa hemB porphobilinogen synthase
267 LLJI01000001.1 GCA001866625_00263 CDS open 255911-257218 _na     435_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
268 LLJI01000001.1 GCA001866625_00264 CDS open 257232-258107 _na     291_aa Adenine DNA glycosylase
269 LLJI01000001.1 GCA001866625_00265 CDS open 258104-258640 _na     178_aa (d)CMP kinase
270 LLJI01000001.1 GCA001866625_00266 CDS open 258789-259505 _na     238_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
271 LLJI01000001.1 GCA001866625_00267 CDS open 259507-261045 _na     512_aa ptsG2 PTS system sugar-specific EII component
272 LLJI01000001.1 GCA001866625_00268 CDS open 261057-261530 _na     157_aa PTS family glucose porter%2C IIA component
273 LLJI01000001.1 GCA001866625_00269 CDS open 261535-262128 _na     197_aa PRD domain-containing protein
274 LLJI01000001.1 GCA001866625_00270 CDS open 262171-263073 _na     300_aa Membrane spanning protein
275 LLJI01000001.1 GCA001866625_00271 CDS open 263070-263969 _na     299_aa TIGR01777 family protein
276 LLJI01000001.1 GCA001866625_00272 CDS open 264037-265524 _na     495_aa Drug transporter
277 LLJI01000001.1 GCA001866625_00273 CDS open 265596-266468 _na     290_aa Allophanate hydrolase subunit 2
278 LLJI01000001.1 GCA001866625_00274 CDS open 266465-267085 _na     206_aa Allophanate hydrolase subunit 1
279 LLJI01000001.1 GCA001866625_00275 CDS open 267082-267852 _na     256_aa 5-oxoprolinase subunit A
280 LLJI01000001.1 GCA001866625_00276 CDS open 267981-268745 _na     254_aa DUF969 domain-containing protein
281 LLJI01000001.1 GCA001866625_00277 CDS open 268742-269728 _na     328_aa DUF979 domain-containing protein
282 LLJI01000001.1 GCA001866625_00278 CDS open 269725-270753 _na     342_aa DUF2891 domain-containing protein
283 LLJI01000001.1 GCA001866625_00279 CDS open 270818-273349 _na     843_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
284 LLJI01000001.1 GCA001866625_00280 CDS open 273610-273927 _na     105_aa Lsr2 family protein
285 LLJI01000001.1 GCA001866625_00281 CDS open 274130-275245 _na     371_aa NADH dehydrogenase (Quinone)
286 LLJI01000001.1 GCA001866625_00282 CDS open 275339-276034 _na     231_aa minE Cell division topological specificity factor MinE
287 LLJI01000001.1 GCA001866625_00283 CDS open 276101-276640 _na     179_aa Secreted protein
288 LLJI01000001.1 GCA001866625_00284 CDS open 276637-277239 _na     200_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
289 LLJI01000001.1 GCA001866625_00285 CDS open 277226-277633 _na     135_aa folB dihydroneopterin aldolase
290 LLJI01000001.1 GCA001866625_00286 CDS open 277733-278578 _na     281_aa folP dihydropteroate synthase
291 LLJI01000001.1 GCA001866625_00287 CDS open 278618-278899 _na     93_aa hypothetical protein
292 LLJI01000001.1 GCA001866625_00288 CDS open 279067-279615 _na     182_aa Tat pathway signal sequence
293 LLJI01000001.1 GCA001866625_00289 CDS open 279626-280231 _na     201_aa A24 family peptidase
294 LLJI01000001.1 GCA001866625_00290 CDS open 280268-280897 _na     209_aa hypothetical protein
295 LLJI01000001.1 GCA001866625_00291 CDS open 280900-281994 _na     364_aa ompA OmpA family protein
296 LLJI01000001.1 GCA001866625_00292 CDS open 282096-282719 _na     207_aa folE GTP cyclohydrolase I FolE
297 LLJI01000001.1 GCA001866625_00293 CDS open 282791-283531 _na     246_aa DUF6498 domain-containing protein
298 LLJI01000001.1 GCA001866625_00294 CDS open 283624-285864 _na     746_aa ftsH ATP-dependent zinc metalloprotease FtsH
299 LLJI01000001.1 GCA001866625_00295 CDS open 286003-286557 _na     184_aa hpt hypoxanthine phosphoribosyltransferase
300 LLJI01000001.1 GCA001866625_00296 CDS open 286567-287520 _na     317_aa tRNA(Ile)-lysidine synthase
301 LLJI01000001.1 GCA001866625_00297 CDS open 287520-288950 _na     476_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
302 LLJI01000001.1 GCA001866625_00298 CDS open 289021-289581 _na     186_aa ppa Inorganic pyrophosphatase
303 LLJI01000001.1 GCA001866625_00299 CDS open 289722-290735 _na     337_aa SAM-dependent methyltransferase
304 LLJI01000001.1 GCA001866625_00300 CDS open 290744-291733 _na     329_aa Cephalosporin-C deacetylase
305 LLJI01000001.1 GCA001866625_00301 CDS open 291781-292266 _na     161_aa Phosphoglycerate mutase family protein
306 LLJI01000001.1 GCA001866625_00302 CDS open 292287-293312 _na     341_aa Zinc-ribbon domain-containing protein
307 LLJI01000001.1 GCA001866625_00303 CDS open 293470-294081 _na     203_aa ammonium transporter
308 LLJI01000001.1 GCA001866625_00304 CDS open 294078-294341 _na     87_aa hypothetical protein
309 LLJI01000001.1 GCA001866625_00305 CDS open 294338-294676 _na     112_aa P-II family nitrogen regulator
310 LLJI01000001.1 GCA001866625_00306 CDS open 294878-296224 _na     448_aa Flavin-containing amine oxidase
311 LLJI01000001.1 GCA001866625_00307 CDS open 296730-297146 _na     138_aa YdhG-like domain-containing protein
312 LLJI01000001.1 GCA001866625_00308 CDS open 297254-297625 _na     123_aa Antitoxin
313 LLJI01000001.1 GCA001866625_00309 CDS open 297688-298317 _na     209_aa hypothetical protein
314 LLJI01000001.1 GCA001866625_00310 CDS open 298455-299726 _na     423_aa family 20 glycosylhydrolase
315 LLJI01000001.1 GCA001866625_00311 CDS open 299678-299836 _na     52_aa hypothetical protein
316 LLJI01000001.1 GCA001866625_00312 CDS open 300040-300144 _na     34_aa hypothetical protein
317 LLJI01000001.1 GCA001866625_00313 CDS open 300173-302533 _na     786_aa ABC3 transporter permease C-terminal domain-containing protein
318 LLJI01000001.1 GCA001866625_00314 CDS open 302539-303204 _na     221_aa ATP-binding cassette domain-containing protein
319 LLJI01000001.1 GCA001866625_00315 CDS open 303823-304257 _na     144_aa hypothetical protein
320 LLJI01000001.1 GCA001866625_00316 CDS open 304254-304574 _na     106_aa ribbon-helix-helix domain-containing protein
321 LLJI01000001.1 GCA001866625_00318 CDS open 304950-306632 _na     560_aa DUF885 domain-containing protein
322 LLJI01000001.1 GCA001866625_00319 CDS open 306695-307027 _na     110_aa Secreted protein
323 LLJI01000001.1 GCA001866625_00320 CDS open 307162-308859 _na     565_aa Peptidase
324 LLJI01000001.1 GCA001866625_00321 CDS open 308856-309614 _na     252_aa PSP1 C-terminal domain-containing protein
325 LLJI01000001.1 GCA001866625_00322 CDS open 309623-310429 _na     268_aa doxX DoxX family protein
326 LLJI01000001.1 GCA001866625_00323 CDS open 310534-311790 _na     418_aa dnaX DNA polymerase III subunit delta'
327 LLJI01000001.1 GCA001866625_00324 CDS open 311824-312471 _na     215_aa tmk dTMP kinase
328 LLJI01000001.1 GCA001866625_00325 CDS open 312464-313951 _na     495_aa Transcriptional regulator
329 LLJI01000001.1 GCA001866625_00326 CDS open 313953-316739 _na     928_aa topA type I DNA topoisomerase
330 LLJI01000001.1 GCA001866625_00327 CDS open 316978-317268 _na     96_aa DUF2249 domain-containing protein
331 LLJI01000001.1 GCA001866625_00328 CDS open 317370-318887 _na     505_aa Methyltransferase
332 LLJI01000001.1 GCA001866625_00329 CDS open 318899-321184 _na     761_aa ATP-dependent helicase
333 LLJI01000001.1 GCA001866625_00330 CDS open 321323-321445 _na     40_aa hypothetical protein
334 LLJI01000001.1 GCA001866625_00331 CDS open 321498-321833 _na     111_aa tadE Pilus assembly protein TadE
335 LLJI01000001.1 GCA001866625_00332 CDS open 321899-322309 _na     136_aa TadE-like protein
336 LLJI01000001.1 GCA001866625_00333 CDS open 322306-322593 _na     95_aa DUF4244 domain-containing protein
337 LLJI01000001.1 GCA001866625_00334 CDS open 322661-322813 _na     50_aa Variable large protein
338 LLJI01000001.1 GCA001866625_00335 CDS open 322810-323559 _na     249_aa Type II secretion system protein F domain protein
339 LLJI01000001.1 GCA001866625_00336 CDS open 323556-324326 _na     256_aa gspF Type II secretion system protein GspF domain-containing protein
340 LLJI01000001.1 GCA001866625_00337 CDS open 324323-325489 _na     388_aa cpaF Helicase/secretion neighborhood ATPase
341 LLJI01000001.1 GCA001866625_00338 CDS open 325486-326544 _na     352_aa ssd septum site-determining protein Ssd
342 LLJI01000001.1 GCA001866625_00339 CDS open 326672-327430 _na     252_aa Methyltransferase
343 LLJI01000001.1 GCA001866625_00340 CDS open 327598-328866 _na     422_aa nhaA Na+/H+ antiporter NhaA
344 LLJI01000001.1 GCA001866625_00341 CDS open 328962-329498 _na     178_aa Integral membrane protein
345 LLJI01000001.1 GCA001866625_00342 CDS open 329587-329985 _na     132_aa NUDIX hydrolase
346 LLJI01000001.1 GCA001866625_00343 CDS open 329934-330242 _na     102_aa hypothetical protein
347 LLJI01000001.1 GCA001866625_00344 CDS open 330239-330826 _na     195_aa Redoxin superfamily protein
348 LLJI01000001.1 GCA001866625_00345 CDS open 330823-331536 _na     237_aa nth endonuclease III
349 LLJI01000001.1 GCA001866625_00346 CDS open 331674-332375 _na     233_aa Crp/Fnr family transcriptional regulator
350 LLJI01000001.1 GCA001866625_00347 CDS open 332477-332932 _na     151_aa ridA Endoribonuclease L-PSP
351 LLJI01000001.1 GCA001866625_00348 CDS open 332929-333102 _na     57_aa DUF4177 domain-containing protein
352 LLJI01000001.1 GCA001866625_00349 CDS open 333099-333440 _na     113_aa whiB Transcriptional regulator WhiB
353 LLJI01000001.1 GCA001866625_00350 CDS open 333511-334533 _na     340_aa Trans-1%2C2-dihydrobenzene-1%2C2-diol dehydrogenase
354 LLJI01000001.1 GCA001866625_00351 CDS open 334613-337924 _na     1103_aa ileS isoleucine--tRNA ligase
355 LLJI01000001.1 GCA001866625_00352 CDS open 338369-338968 _na     199_aa Integral membrane protein
356 LLJI01000001.1 GCA001866625_00353 CDS open 338962-340167 _na     401_aa ABC transporter permease
357 LLJI01000001.1 GCA001866625_00354 CDS open 340332-340550 _na     72_aa hypothetical protein
358 LLJI01000001.1 GCA001866625_00355 CDS open 341670-342512 _na     280_aa Hydrolase
359 LLJI01000001.1 GCA001866625_00356 CDS open 342522-343322 _na     266_aa Hydrolase
360 LLJI01000001.1 GCA001866625_00357 CDS open 343442-345262 _na     606_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
361 LLJI01000001.1 GCA001866625_00358 CDS open 345285-347963 _na     892_aa Efflux ABC superfamily ATP binding cassette transporter%2C permease protein
362 LLJI01000001.1 GCA001866625_00359 CDS open 347963-348745 _na     260_aa lolD Macrolide export ABC superfamily ATP binding cassette transporter%2C ABC protein
363 LLJI01000001.1 GCA001866625_00360 CDS open 348751-349317 _na     188_aa padR PadR family transcriptional regulator
364 LLJI01000001.1 GCA001866625_00361 CDS open 349423-350028 _na     201_aa recR recombination mediator RecR
365 LLJI01000001.1 GCA001866625_00362 CDS open 350059-350382 _na     107_aa YbaB/EbfC family nucleoid-associated protein
366 LLJI01000001.1 GCA001866625_00363 CDS open 350498-353365 _na     955_aa DNA polymerase III subunit gamma and tau
367 LLJI01000001.1 GCA001866625_00364 CDS open 353460-353816 _na     118_aa Fumarate reductase subunit D
368 LLJI01000001.1 GCA001866625_00366 CDS open 354176-354541 _na     121_aa hslR Heat shock protein HslR
369 LLJI01000001.1 GCA001866625_00368 CDS open 354914-355876 _na     320_aa Phosphotransferase
370 LLJI01000001.1 GCA001866625_00369 CDS open 355949-358486 _na     845_aa treY malto-oligosyltrehalose synthase
371 LLJI01000001.1 GCA001866625_00370 CDS open 358483-360234 _na     583_aa treZ malto-oligosyltrehalose trehalohydrolase
372 LLJI01000001.1 GCA001866625_00371 CDS open 360444-361190 _na     248_aa twin-arginine translocation signal domain-containing protein
373 LLJI01000001.1 GCA001866625_00372 CDS open 361672-363162 _na     496_aa Bacterial sugar transferase
374 LLJI01000001.1 GCA001866625_00373 CDS open 363162-363659 _na     165_aa VanZ-like domain-containing protein
375 LLJI01000001.1 GCA001866625_00374 CDS open 363656-363778 _na     40_aa Cell division inhibitor
376 LLJI01000001.1 GCA001866625_00375 CDS open 363775-364458 _na     227_aa N-acylneuraminate cytidylyltransferase
377 LLJI01000001.1 GCA001866625_00376 CDS open 364500-366764 _na     754_aa N-acylneuraminate-9-phosphate synthase
378 LLJI01000001.1 GCA001866625_00377 CDS open 366764-367807 _na     347_aa Glycosyltransferase
379 LLJI01000001.1 GCA001866625_00378 CDS open 367804-369975 _na     723_aa glycosyltransferase
380 LLJI01000001.1 GCA001866625_00379 CDS open 370246-371124 _na     292_aa exoV ExoV domain protein
381 LLJI01000001.1 GCA001866625_00380 CDS open 371436-372368 _na     310_aa Glucosyltransferase
382 LLJI01000001.1 GCA001866625_00381 CDS open 372372-374264 _na     630_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
383 LLJI01000001.1 GCA001866625_00382 CDS open 374354-375244 _na     296_aa glycosyltransferase family A protein
384 LLJI01000001.1 GCA001866625_00383 CDS open 375283-376650 _na     455_aa Group 1 glycosyl transferase
385 LLJI01000001.1 GCA001866625_00384 CDS open 376730-377779 _na     349_aa Prephenate dehydrogenase
386 LLJI01000001.1 GCA001866625_00385 CDS open 377776-378777 _na     333_aa Spore protein YkvP/CgeB glycosyl transferase-like domain-containing protein
387 LLJI01000001.1 GCA001866625_00386 CDS open 378866-380110 _na     414_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
388 LLJI01000001.1 GCA001866625_00387 CDS open 380107-381684 _na     525_aa Capsular exopolysaccharide family protein
389 LLJI01000001.1 GCA001866625_00388 CDS open 381896-383197 _na     433_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
390 LLJI01000001.1 GCA001866625_00389 CDS open 383295-384203 _na     302_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
391 LLJI01000001.1 GCA001866625_00390 CDS open 385071-385748 _na     225_aa PE-PGRS family protein
392 LLJI01000001.1 GCA001866625_00391 CDS open 386049-387047 _na     332_aa rfbB dTDP-glucose 4%2C6-dehydratase
393 LLJI01000001.1 GCA001866625_00392 CDS open 387047-388435 _na     462_aa dTDP-4-dehydrorhamnose reductase
394 LLJI01000001.1 GCA001866625_00393 CDS open 388435-389151 _na     238_aa Serine kinase
395 LLJI01000001.1 GCA001866625_00394 CDS open 389145-389402 _na     85_aa Nitrate ABC superfamily ATP binding cassette transporter%2C ABC protein
396 LLJI01000001.1 GCA001866625_00395 CDS open 389431-390366 _na     311_aa 2-nitropropane dioxygenase
397 LLJI01000001.1 GCA001866625_00396 CDS open 390363-390632 _na     89_aa Pyrrolo-quinoline quinone
398 LLJI01000001.1 GCA001866625_00397 CDS open 390638-391216 _na     192_aa Protein-tyrosine phosphatase
399 LLJI01000001.1 GCA001866625_00398 CDS open 391213-392283 _na     356_aa Glycosyltransferase
400 LLJI01000001.1 GCA001866625_00399 CDS open 392454-393143 _na     229_aa fHA FHA domain-containing protein
401 LLJI01000001.1 GCA001866625_00400 CDS open 393146-393634 _na     162_aa FHA domain-containing protein
402 LLJI01000001.1 GCA001866625_00401 CDS open 393638-395092 _na     484_aa Serine/threonine protein phosphatase 1
403 LLJI01000001.1 GCA001866625_00402 CDS open 395092-396498 _na     468_aa ftsW Cell division protein FtsW
404 LLJI01000001.1 GCA001866625_00403 CDS open 396495-397922 _na     475_aa Penicillin binding protein
405 LLJI01000001.1 GCA001866625_00404 CDS open 397980-399860 _na     626_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
406 LLJI01000001.1 GCA001866625_00405 CDS open 399862-400491 _na     209_aa Anthranilate synthase component II
407 LLJI01000001.1 GCA001866625_00406 CDS open 400558-401436 _na     292_aa DUF881 domain-containing protein
408 LLJI01000001.1 GCA001866625_00407 CDS open 401560-401841 _na     93_aa crgA Cell division protein CrgA
409 LLJI01000001.1 GCA001866625_00408 CDS open 401934-403466 _na     510_aa lysS lysine--tRNA ligase
410 LLJI01000001.1 GCA001866625_00409 CDS open 403559-404848 _na     429_aa Sugar ABC transporter substrate-binding protein
411 LLJI01000001.1 GCA001866625_00410 CDS open 405026-406762 _na     578_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
412 LLJI01000001.1 GCA001866625_00411 CDS open 406759-408819 _na     686_aa Multidrug resistance ABC superfamily ATP binding cassette transporter%2C membrane protein
413 LLJI01000001.1 GCA001866625_00412 CDS open 408922-409485 _na     187_aa DUF218 domain-containing protein
414 LLJI01000001.1 GCA001866625_00413 CDS open 409618-411138 _na     506_aa Cytochrome d ubiquinol oxidase subunit I
415 LLJI01000001.1 GCA001866625_00414 CDS open 411152-412225 _na     357_aa cydB cytochrome d ubiquinol oxidase subunit II
416 LLJI01000001.1 GCA001866625_00415 CDS open 412301-413875 _na     524_aa cydD thiol reductant ABC exporter subunit CydD
417 LLJI01000001.1 GCA001866625_00416 CDS open 413872-415476 _na     534_aa cydC thiol reductant ABC exporter subunit CydC
418 LLJI01000001.1 GCA001866625_00417 CDS open 415673-416821 _na     382_aa hypothetical protein
419 LLJI01000001.1 GCA001866625_00418 CDS open 416841-417038 _na     65_aa DUF2530 domain-containing protein
420 LLJI01000001.1 GCA001866625_00419 CDS open 417283-417963 _na     226_aa Lactate utilization protein C
421 LLJI01000001.1 GCA001866625_00420 CDS open 417960-419495 _na     511_aa lutB LutB/LldF family L-lactate oxidation iron-sulfur protein
422 LLJI01000001.1 GCA001866625_00421 CDS open 419499-420293 _na     264_aa glpC (S)-2-hydroxy-acid oxidase
423 LLJI01000001.1 GCA001866625_00422 CDS open 420348-422036 _na     562_aa lldP L-lactate permease
424 LLJI01000001.1 GCA001866625_00423 CDS open 422321-423109 _na     262_aa Regulator protein
425 LLJI01000001.1 GCA001866625_00424 CDS open 423140-423487 _na     115_aa Thiamine-binding protein
426 LLJI01000001.1 GCA001866625_00425 CDS open 423737-425533 _na     598_aa porD Pyridine nucleotide-disulfide oxidoreductase
427 LLJI01000001.1 GCA001866625_00426 CDS open 425549-429163 _na     1204_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
428 LLJI01000001.1 GCA001866625_00427 CDS open 429188-430195 _na     335_aa pyrD Dihydroorotate oxidase
429 LLJI01000001.1 GCA001866625_00428 CDS open 430549-431724 _na     391_aa rfaB Glycosyltransferase%2C group 1 family protein
430 LLJI01000001.1 GCA001866625_00429 CDS open 431783-433885 _na     700_aa ABC superfamily ATP binding cassette transporter
431 LLJI01000001.1 GCA001866625_00430 CDS open 433882-434505 _na     207_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
432 LLJI01000001.1 GCA001866625_00431 CDS open 434942-437437 _na     831_aa hrpB ATP-dependent helicase HrpB
433 LLJI01000001.1 GCA001866625_00432 CDS open 437434-438081 _na     215_aa MutT/Nudix family protein
434 LLJI01000001.1 GCA001866625_00433 CDS open 438208-439590 _na     460_aa ndh NADH:ubiquinone reductase (non-electrogenic)
435 LLJI01000001.1 GCA001866625_00434 CDS open 439590-439883 _na     97_aa hypothetical protein
436 LLJI01000001.1 GCA001866625_00435 CDS open 440196-441056 _na     286_aa DUF559 domain-containing protein
437 LLJI01000001.1 GCA001866625_00436 CDS open 441464-442585 _na     373_aa Glycosyltransferase
438 LLJI01000001.1 GCA001866625_00437 CDS open 442585-443652 _na     355_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
439 LLJI01000001.1 GCA001866625_00438 CDS open 443714-444958 _na     414_aa O-antigen ligase-related domain-containing protein
440 LLJI01000001.1 GCA001866625_00439 CDS open 444955-446088 _na     377_aa Glycosyltransferase
441 LLJI01000001.1 GCA001866625_00440 CDS open 446091-447389 _na     432_aa wecC Nucleotide sugar dehydrogenase
442 LLJI01000001.1 GCA001866625_00441 CDS open 447552-448313 _na     253_aa glpR DeoR family transcriptional regulator
443 LLJI01000001.1 GCA001866625_00442 CDS open 448659-449609 _na     316_aa Fructose-1-phosphate kinase
444 LLJI01000001.1 GCA001866625_00443 CDS open 449623-451629 _na     668_aa ptsN PTS fructose-specific enzyme IIABC
445 LLJI01000001.1 GCA001866625_00444 CDS open 451672-451929 _na     85_aa PTS family porter component HPr
446 LLJI01000001.1 GCA001866625_00445 CDS open 452007-452807 _na     266_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
447 LLJI01000001.1 GCA001866625_00446 CDS open 452831-453991 _na     386_aa FAD-dependent oxidoreductase
448 LLJI01000001.1 GCA001866625_00447 CDS open 454306-455907 _na     533_aa Proton-dependent oligopeptide transporter
449 LLJI01000001.1 GCA001866625_00448 CDS open 456144-457511 _na     455_aa Membrane protein
450 LLJI01000001.1 GCA001866625_00449 CDS open 457619-458611 _na     330_aa mviM Inositol 2-dehydrogenase
451 LLJI01000001.1 GCA001866625_00450 CDS open 458611-459723 _na     370_aa wecE Pleiotropic regulatory protein DegT
452 LLJI01000001.1 GCA001866625_00451 CDS open 459815-460432 _na     205_aa glmU Acetylglucosamine-1-phosphate uridylyltransferase
453 LLJI01000001.1 GCA001866625_00452 CDS open 460555-461892 _na     445_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
454 LLJI01000001.1 GCA001866625_00453 CDS open 461889-463262 _na     457_aa Glycosyltransferase
455 LLJI01000001.1 GCA001866625_00454 CDS open 463344-464597 _na     417_aa Protein tyrosine kinase
456 LLJI01000001.1 GCA001866625_00455 CDS open 464733-466121 _na     462_aa hypothetical protein
457 LLJI01000001.1 GCA001866625_00456 CDS open 466079-467266 _na     395_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
458 LLJI01000001.1 GCA001866625_00457 CDS open 467263-468804 _na     513_aa DUF2029 domain-containing protein
459 LLJI01000001.1 GCA001866625_00458 CDS open 468814-471138 _na     774_aa peptidoglycan glycosyltransferase
460 LLJI01000001.1 GCA001866625_00459 CDS open 471131-471694 _na     187_aa DUF5318 domain-containing protein
461 LLJI01000001.1 GCA001866625_00460 CDS open 471766-473028 _na     420_aa Zinc protease
462 LLJI01000001.1 GCA001866625_00461 CDS open 473028-474386 _na     452_aa M16 family peptidase
463 LLJI01000001.1 GCA001866625_00463 CDS open 474796-475278 _na     160_aa hypothetical protein
464 LLJI01000001.1 GCA001866625_00464 CDS open 475390-476079 _na     229_aa kdpE KDP operon response regulator KdpE
465 LLJI01000001.1 GCA001866625_00465 CDS open 476076-478607 _na     843_aa kdpD histidine kinase
466 LLJI01000001.1 GCA001866625_00466 CDS open 478650-479255 _na     201_aa kdpC potassium-transporting ATPase subunit KdpC
467 LLJI01000001.1 GCA001866625_00467 CDS open 479268-481382 _na     704_aa kdpB potassium-transporting ATPase subunit KdpB
468 LLJI01000001.1 GCA001866625_00468 CDS open 481385-483058 _na     557_aa kdpA potassium-transporting ATPase subunit KdpA
469 LLJI01000001.1 GCA001866625_00469 CDS open 483058-483147 _na     29_aa Potassium-transporting ATPase subunit F
470 LLJI01000001.1 GCA001866625_00470 CDS open 483429-484082 _na     217_aa thiamine phosphate synthase
471 LLJI01000001.1 GCA001866625_00471 CDS open 484079-484849 _na     256_aa thiM hydroxyethylthiazole kinase
472 LLJI01000001.1 GCA001866625_00472 CDS open 484846-486201 _na     451_aa Major facilitator transporter
473 LLJI01000001.1 GCA001866625_00473 CDS open 486259-488019 _na     586_aa bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
474 LLJI01000001.1 GCA001866625_00474 CDS open 488570-489877 _na     435_aa Oleate hydratase
475 LLJI01000001.1 GCA001866625_00475 CDS open 489939-490718 _na     259_aa PurM-like N-terminal domain-containing protein
476 LLJI01000001.1 GCA001866625_00476 CDS open 491070-492356 _na     428_aa Iron (Fe) ABC superfamily ATP binding cassette transporter%2C binding protein
477 LLJI01000001.1 GCA001866625_00477 CDS open 492353-493426 _na     357_aa Iron (Fe) ABC superfamily ATP binding cassette transporter%2C membrane protein
478 LLJI01000001.1 GCA001866625_00478 CDS open 493423-494424 _na     333_aa Iron compound ABC superfamily ATP binding cassette transporter
479 LLJI01000001.1 GCA001866625_00479 CDS open 494421-495521 _na     366_aa Radical SAM superfamily protein
480 LLJI01000001.1 GCA001866625_00480 CDS open 495518-499426 _na     1302_aa cobN cobaltochelatase subunit CobN
481 LLJI01000001.1 GCA001866625_00481 CDS open 499426-501390 _na     654_aa Magnesium chelatase
482 LLJI01000001.1 GCA001866625_00482 CDS open 501392-502384 _na     330_aa Mg-protoporphyrin IX chelatase
483 LLJI01000001.1 GCA001866625_00483 CDS open 502381-504153 _na     590_aa ABC superfamily ATP binding cassette transporter
484 LLJI01000001.1 GCA001866625_00484 CDS open 504150-505895 _na     581_aa ABC superfamily ATP binding cassette transporter
485 LLJI01000001.1 GCA001866625_00485 CDS open 506042-507493 _na     483_aa katA Catalase KatA
486 LLJI01000001.1 GCA001866625_00486 CDS open 507562-507912 _na     116_aa N-acetyltransferase domain-containing protein
487 LLJI01000001.1 GCA001866625_00487 CDS open 508006-509301 _na     431_aa dcuA C4-dicarboxylate transporter DcuA
488 LLJI01000001.1 GCA001866625_00488 CDS open 509311-510783 _na     490_aa aspA aspartate ammonia-lyase
489 LLJI01000001.1 GCA001866625_00489 CDS open 511244-512341 _na     365_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
490 LLJI01000001.1 GCA001866625_00490 CDS open 512334-515123 _na     929_aa Multicopper oxidase family protein
491 LLJI01000001.1 GCA001866625_00491 CDS open 515120-515710 _na     196_aa Regulatory protein
492 LLJI01000001.1 GCA001866625_00492 CDS open 515761-516888 _na     375_aa pfkA ATP-dependent 6-phosphofructokinase
493 LLJI01000001.1 GCA001866625_00493 CDS open 517060-517683 _na     207_aa Sigma-70 family RNA polymerase sigma factor
494 LLJI01000001.1 GCA001866625_00494 CDS open 517680-518072 _na     130_aa hypothetical protein
495 LLJI01000001.1 GCA001866625_00495 CDS open 518193-520559 _na     788_aa glgP Alpha-1%2C4 glucan phosphorylase
496 LLJI01000001.1 GCA001866625_00496 CDS open 520616-521908 _na     430_aa Chloride channel protein
497 LLJI01000001.1 GCA001866625_00497 CDS open 521953-523410 _na     485_aa adhE Succinate-semialdehyde dehydrogenase
498 LLJI01000001.1 GCA001866625_00498 CDS open 523577-523996 _na     139_aa hypothetical protein
499 LLJI01000001.1 GCA001866625_00499 CDS open 524234-524986 _na     250_aa ABC superfamily ATP binding cassette transporter%2C binding protein
500 LLJI01000001.1 GCA001866625_00500 CDS open 524989-526434 _na     481_aa FtsX-like permease family protein