HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_001937415.1)

Select a Genome:
BAKTA Annotations for GCA_001937415.1
Genome Selected: Actinomyces oris clade-144
ContigsBases CDSrRNA tmRNAtRNA
90 3,243,259 2677 5 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5500 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 5500 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 MSKN01000031.1 GCA001937415_01493 gene open 28262-28555
3002 MSKN01000031.1 GCA001937415_01494 gene open 28558-28911 sseB
3003 MSKN01000031.1 GCA001937415_01495 gene open 28980-30914
3004 MSKN01000031.1 GCA001937415_01496 gene open 30929-32215 purA
3005 MSKN01000031.1 GCA001937415_01497 gene open 32340-33374
3006 MSKN01000031.1 GCA001937415_01498 gene open 33461-34126
3007 MSKN01000031.1 GCA001937415_01499 gene open 34286-35191 ugpE
3008 MSKN01000031.1 GCA001937415_01500 gene open 35188-36033 ugpA
3009 MSKN01000031.1 GCA001937415_01501 gene open 36223-37566 ugpB
3010 MSKN01000031.1 GCA001937415_01502 gene open 37977-39026 fbaA
3011 MSKN01000031.1 GCA001937415_01503 gene open 39214-39969 spoU
3012 MSKN01000031.1 GCA001937415_01504 gene open 39966-40535
3013 MSKN01000032.1 GCA001937415_01505 CDS open 383-997 _na     204_aa DUF4352 domain-containing protein
3014 MSKN01000032.1 GCA001937415_01506 CDS open 1006-1677 _na     223_aa OmpA-like domain-containing protein
3015 MSKN01000032.1 GCA001937415_01507 CDS open 1696-2214 _na     172_aa Tat pathway signal protein
3016 MSKN01000032.1 GCA001937415_01508 CDS open 2211-2819 _na     202_aa Tat pathway signal sequence domain protein
3017 MSKN01000032.1 GCA001937415_01509 CDS open 2816-3445 _na     209_aa lpqN Lipoprotein LpqN
3018 MSKN01000032.1 GCA001937415_01510 CDS open 3489-4565 _na     358_aa MBG domain-containing protein
3019 MSKN01000032.1 GCA001937415_01511 CDS open 4855-5871 _na     338_aa Serine hydrolase
3020 MSKN01000032.1 GCA001937415_01512 CDS open 5880-6551 _na     223_aa Serine/arginine repetitive matrix protein 1
3021 MSKN01000032.1 GCA001937415_01513 CDS open 6591-8132 _na     513_aa DUF4402 domain-containing protein
3022 MSKN01000032.1 GCA001937415_01514 CDS open 8252-8860 _na     202_aa Lipoprotein
3023 MSKN01000032.1 GCA001937415_01515 CDS open 8909-9589 _na     226_aa Putative Flp pilus-assembly TadG-like N-terminal domain-containing protein
3024 MSKN01000032.1 GCA001937415_01505 gene open 383-997
3025 MSKN01000032.1 GCA001937415_01506 gene open 1006-1677
3026 MSKN01000032.1 GCA001937415_01507 gene open 1696-2214
3027 MSKN01000032.1 GCA001937415_01508 gene open 2211-2819
3028 MSKN01000032.1 GCA001937415_01509 gene open 2816-3445 lpqN
3029 MSKN01000032.1 GCA001937415_01510 gene open 3489-4565
3030 MSKN01000032.1 GCA001937415_01511 gene open 4855-5871
3031 MSKN01000032.1 GCA001937415_01512 gene open 5880-6551
3032 MSKN01000032.1 GCA001937415_01513 gene open 6591-8132
3033 MSKN01000032.1 GCA001937415_01514 gene open 8252-8860
3034 MSKN01000032.1 GCA001937415_01515 gene open 8909-9589
3035 MSKN01000033.1 regulatory_region open 143596-143680 SAM riboswitch aptamer (S box leader)
3036 MSKN01000033.1 repeat_region open 50-1063 CRISPR array with 17 repeats of length 28%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 33
3037 MSKN01000033.1 GCA001937415_01516 CDS open 1209-1307 _na     32_aa hypothetical protein
3038 MSKN01000033.1 GCA001937415_01517 CDS open 1541-2482 _na     313_aa ATP-grasp fold amidoligase family protein
3039 MSKN01000033.1 GCA001937415_01518 CDS open 2794-4074 _na     426_aa yveK Polysaccharide biosynthesis tyrosine autokinase
3040 MSKN01000033.1 GCA001937415_01519 CDS open 4884-6809 _na     641_aa flaA1 Polysaccharide biosynthesis protein
3041 MSKN01000033.1 GCA001937415_01520 CDS open 6809-8020 _na     403_aa Capsular biosynthesis protein
3042 MSKN01000033.1 GCA001937415_01521 CDS open 8017-8703 _na     228_aa Sugar transferase
3043 MSKN01000033.1 GCA001937415_01522 CDS open 8735-9517 _na     260_aa wcaA Glycosyltransferase 2-like domain-containing protein
3044 MSKN01000033.1 GCA001937415_01523 CDS open 9583-10734 _na     383_aa Capsular biosynthesis protein
3045 MSKN01000033.1 GCA001937415_01524 CDS open 10744-11850 _na     368_aa Polysaccharide polymerase
3046 MSKN01000033.1 GCA001937415_01525 CDS open 11850-12278 _na     142_aa Serine acetyltransferase
3047 MSKN01000033.1 GCA001937415_01526 CDS open 12275-12382 _na     35_aa hypothetical protein
3048 MSKN01000033.1 GCA001937415_01527 CDS open 12366-13793 _na     475_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3049 MSKN01000033.1 GCA001937415_01528 CDS open 13814-15136 _na     440_aa UDP-glucose 6-dehydrogenase
3050 MSKN01000033.1 GCA001937415_01529 CDS open 15501-17309 _na     602_aa tetrahydrofolate synthase
3051 MSKN01000033.1 GCA001937415_01530 CDS open 17628-18308 _na     226_aa dhaL dihydroxyacetone kinase subunit DhaL
3052 MSKN01000033.1 GCA001937415_01531 CDS open 18394-18834 _na     146_aa ndk nucleoside-diphosphate kinase
3053 MSKN01000033.1 GCA001937415_01532 CDS open 19023-20267 _na     414_aa natB ABC-2 family transporter protein
3054 MSKN01000033.1 GCA001937415_01533 CDS open 20267-21214 _na     315_aa ATP-binding cassette domain-containing protein
3055 MSKN01000033.1 GCA001937415_01534 CDS open 21247-25185 _na     1312_aa Chromosome partition protein Smc
3056 MSKN01000033.1 GCA001937415_01535 CDS open 25347-25721 _na     124_aa Cell division protein DivIVA
3057 MSKN01000033.1 GCA001937415_01536 CDS open 26083-27243 _na     386_aa ftsY signal recognition particle-docking protein FtsY
3058 MSKN01000033.1 GCA001937415_01537 CDS open 27375-27986 _na     203_aa citB Two component system response regulator
3059 MSKN01000033.1 GCA001937415_01538 CDS open 28065-29222 _na     385_aa Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein
3060 MSKN01000033.1 GCA001937415_01539 CDS open 29251-30138 _na     295_aa ABC-2 type transporter transmembrane domain-containing protein
3061 MSKN01000033.1 GCA001937415_01540 CDS open 30135-31127 _na     330_aa ABC transporter domain-containing protein
3062 MSKN01000033.1 GCA001937415_01541 CDS open 31491-33176 _na     561_aa ffh signal recognition particle protein
3063 MSKN01000033.1 GCA001937415_01542 CDS open 33191-33802 _na     203_aa citB Response regulatory domain-containing protein
3064 MSKN01000033.1 GCA001937415_01543 CDS open 33799-35037 _na     412_aa Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein
3065 MSKN01000033.1 GCA001937415_01544 CDS open 35046-35924 _na     292_aa ABC transporter
3066 MSKN01000033.1 GCA001937415_01545 CDS open 35975-36994 _na     339_aa rbbA Multidrug ABC transporter ATP-binding protein
3067 MSKN01000033.1 GCA001937415_01546 CDS open 37108-38265 _na     385_aa Serine/arginine repetitive matrix protein 1
3068 MSKN01000033.1 GCA001937415_01547 CDS open 38840-39457 _na     205_aa hypothetical protein
3069 MSKN01000033.1 GCA001937415_01548 CDS open 39459-39695 _na     78_aa ylqC RNA-binding protein
3070 MSKN01000033.1 GCA001937415_01549 CDS open 40006-40554 _na     182_aa rimM ribosome maturation factor RimM
3071 MSKN01000033.1 GCA001937415_01550 CDS open 40551-41972 _na     473_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
3072 MSKN01000033.1 GCA001937415_01551 CDS open 41969-42883 _na     304_aa lepB signal peptidase I
3073 MSKN01000033.1 GCA001937415_01552 CDS open 43127-43474 _na     115_aa rplS 50S ribosomal protein L19
3074 MSKN01000033.1 GCA001937415_01553 CDS open 43586-44806 _na     406_aa lepB signal peptidase I
3075 MSKN01000033.1 GCA001937415_01554 CDS open 44803-45525 _na     240_aa ribonuclease HII
3076 MSKN01000033.1 GCA001937415_01555 CDS open 45537-45938 _na     133_aa Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII
3077 MSKN01000033.1 GCA001937415_01556 CDS open 46102-46662 _na     186_aa yraN YraN family protein
3078 MSKN01000033.1 GCA001937415_01557 CDS open 46653-48224 _na     523_aa yifB Mg chelatase
3079 MSKN01000033.1 GCA001937415_01558 CDS open 48221-49600 _na     459_aa dprA DNA-processing protein DprA
3080 MSKN01000033.1 GCA001937415_01559 CDS open 49785-50708 _na     307_aa xerC Tyrosine recombinase XerC
3081 MSKN01000033.1 GCA001937415_01560 CDS open 50736-51389 _na     217_aa Peptidase M23 domain-containing protein
3082 MSKN01000033.1 GCA001937415_01561 CDS open 52046-52894 _na     282_aa rpsB 30S ribosomal protein S2
3083 MSKN01000033.1 GCA001937415_01562 CDS open 53003-53842 _na     279_aa tsf translation elongation factor Ts
3084 MSKN01000033.1 GCA001937415_01563 CDS open 54090-54842 _na     250_aa pyrH UMP kinase
3085 MSKN01000033.1 GCA001937415_01564 CDS open 55006-55563 _na     185_aa frr ribosome recycling factor
3086 MSKN01000033.1 GCA001937415_01565 CDS open 55628-56566 _na     312_aa cdsA Phosphatidate cytidylyltransferase
3087 MSKN01000033.1 GCA001937415_01566 CDS open 56639-57901 _na     420_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
3088 MSKN01000033.1 GCA001937415_01567 CDS open 57898-58443 _na     181_aa Cell division protein DivIVA
3089 MSKN01000033.1 GCA001937415_01568 CDS open 58485-59777 _na     430_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
3090 MSKN01000033.1 GCA001937415_01569 CDS open 59774-61108 _na     444_aa Peptidase%2C M50 family
3091 MSKN01000033.1 GCA001937415_01570 CDS open 61244-62392 _na     382_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
3092 MSKN01000033.1 GCA001937415_01571 CDS open 62442-63431 _na     329_aa N-acetyltransferase domain-containing protein
3093 MSKN01000033.1 GCA001937415_01572 CDS open 63565-65400 _na     611_aa proS proline--tRNA ligase
3094 MSKN01000033.1 GCA001937415_01573 CDS open 65855-67231 _na     458_aa Major facilitator superfamily (MFS) profile domain-containing protein
3095 MSKN01000033.1 GCA001937415_01574 CDS open 67313-68170 _na     285_aa HTH lysR-type domain-containing protein
3096 MSKN01000033.1 GCA001937415_01575 CDS open 68652-68885 _na     77_aa hypothetical protein
3097 MSKN01000033.1 GCA001937415_01576 CDS open 69663-70409 _na     248_aa Transposase IS110-like N-terminal domain-containing protein
3098 MSKN01000033.1 GCA001937415_01577 CDS open 70887-71075 _na     62_aa hypothetical protein
3099 MSKN01000033.1 GCA001937415_01578 CDS open 71142-72191 _na     349_aa Tat pathway signal protein
3100 MSKN01000033.1 GCA001937415_01579 CDS open 72316-72834 _na     172_aa rimP Ribosome maturation factor RimP
3101 MSKN01000033.1 GCA001937415_01580 CDS open 73041-74069 _na     342_aa nusA Transcription termination/antitermination protein NusA
3102 MSKN01000033.1 GCA001937415_01581 CDS open 74188-74520 _na     110_aa ylxR YlxR domain-containing protein
3103 MSKN01000033.1 GCA001937415_01582 CDS open 74612-77560 _na     982_aa infB translation initiation factor IF-2
3104 MSKN01000033.1 GCA001937415_01583 CDS open 77677-79248 _na     523_aa ydhU Oxidoreductase molybdopterin-binding domain-containing protein
3105 MSKN01000033.1 GCA001937415_01584 CDS open 79613-81955 _na     780_aa norB Nitric oxide reductase subunit B cytochrome c-like domain-containing protein
3106 MSKN01000033.1 GCA001937415_01585 CDS open 81955-82881 _na     308_aa Transposase
3107 MSKN01000033.1 GCA001937415_01586 CDS open 82932-83732 _na     266_aa hflC Band 7 domain-containing protein
3108 MSKN01000033.1 GCA001937415_01587 CDS open 83707-84699 _na     330_aa rarD EamA family transporter RarD
3109 MSKN01000033.1 GCA001937415_01588 CDS open 84897-85394 _na     165_aa rbfA 30S ribosome-binding factor RbfA
3110 MSKN01000033.1 GCA001937415_01589 CDS open 85391-86506 _na     371_aa truB tRNA pseudouridine(55) synthase TruB
3111 MSKN01000033.1 GCA001937415_01590 CDS open 86578-86880 _na     100_aa DUF4266 domain-containing protein
3112 MSKN01000033.1 GCA001937415_01591 CDS open 86891-87700 _na     269_aa ABC transporter ATP-binding protein
3113 MSKN01000033.1 GCA001937415_01592 CDS open 87712-90042 _na     776_aa ABC transporter permease
3114 MSKN01000033.1 GCA001937415_01593 CDS open 90331-91356 _na     341_aa ribF bifunctional riboflavin kinase/FAD synthetase
3115 MSKN01000033.1 GCA001937415_01594 CDS open 91576-91845 _na     89_aa rpsO 30S ribosomal protein S15
3116 MSKN01000033.1 GCA001937415_01595 CDS open 92390-94735 _na     781_aa pnp polyribonucleotide nucleotidyltransferase
3117 MSKN01000033.1 GCA001937415_01596 CDS open 94921-96327 _na     468_aa pqqL Peptidase M16 N-terminal domain-containing protein
3118 MSKN01000033.1 GCA001937415_01597 CDS open 96423-97319 _na     298_aa Short chain dehydrogenase
3119 MSKN01000033.1 GCA001937415_01598 CDS open 97451-98071 _na     206_aa HTH tetR-type domain-containing protein
3120 MSKN01000033.1 GCA001937415_01599 CDS open 98114-98866 _na     250_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
3121 MSKN01000033.1 GCA001937415_01600 CDS open 98920-99663 _na     247_aa GNAT family N-acetyltransferase
3122 MSKN01000033.1 GCA001937415_01601 CDS open 99977-100873 _na     298_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
3123 MSKN01000033.1 GCA001937415_01602 CDS open 100896-101342 _na     148_aa Pyrimidine dimer DNA glycosylase
3124 MSKN01000033.1 GCA001937415_01603 CDS open 101382-103163 _na     593_aa menE AMP-dependent synthetase/ligase domain-containing protein
3125 MSKN01000033.1 GCA001937415_01604 CDS open 103239-105155 _na     638_aa AMP-dependent synthetase/ligase domain-containing protein
3126 MSKN01000033.1 GCA001937415_01605 CDS open 105315-107924 _na     869_aa UvrD-like helicase ATP-binding domain-containing protein
3127 MSKN01000033.1 GCA001937415_01606 CDS open 108414-109352 _na     312_aa PAC2 family protein
3128 MSKN01000033.1 GCA001937415_01607 CDS open 109426-110253 _na     275_aa PABS domain-containing protein
3129 MSKN01000033.1 GCA001937415_01608 CDS open 110341-111666 _na     441_aa dinB DNA polymerase IV
3130 MSKN01000033.1 GCA001937415_01609 CDS open 111735-112148 _na     137_aa DUF3040 domain-containing protein
3131 MSKN01000033.1 GCA001937415_01610 CDS open 112775-113206 _na     143_aa mraZ division/cell wall cluster transcriptional repressor MraZ
3132 MSKN01000033.1 GCA001937415_01611 CDS open 113460-114587 _na     375_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
3133 MSKN01000033.1 GCA001937415_01612 CDS open 114696-115160 _na     154_aa ftsL Cell division protein FtsL
3134 MSKN01000033.1 GCA001937415_01613 CDS open 115167-116966 _na     599_aa ftsI Peptidoglycan synthase FtsI
3135 MSKN01000033.1 GCA001937415_01614 CDS open 117073-118659 _na     528_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
3136 MSKN01000033.1 GCA001937415_01615 CDS open 118644-120095 _na     483_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
3137 MSKN01000033.1 GCA001937415_01616 CDS open 120092-121192 _na     366_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
3138 MSKN01000033.1 GCA001937415_01617 CDS open 121295-122854 _na     519_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
3139 MSKN01000033.1 GCA001937415_01618 CDS open 122851-124380 _na     509_aa ftsW putative peptidoglycan glycosyltransferase FtsW
3140 MSKN01000033.1 GCA001937415_01619 CDS open 124364-125623 _na     419_aa murG UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
3141 MSKN01000033.1 GCA001937415_01620 CDS open 125620-127194 _na     524_aa murC UDP-N-acetylmuramate--L-alanine ligase
3142 MSKN01000033.1 GCA001937415_01621 CDS open 127191-128426 _na     411_aa FtsQ-type POTRA domain-containing protein
3143 MSKN01000033.1 GCA001937415_01622 CDS open 128693-130063 _na     456_aa ftsZ cell division protein FtsZ
3144 MSKN01000033.1 GCA001937415_01623 CDS open 130093-130908 _na     271_aa Laccase domain-containing protein
3145 MSKN01000033.1 GCA001937415_01624 CDS open 131061-131525 _na     154_aa sepF Cell division protein SepF
3146 MSKN01000033.1 GCA001937415_01625 CDS open 131538-131834 _na     98_aa yggT YggT family protein
3147 MSKN01000033.1 GCA001937415_01626 CDS open 132000-132608 _na     202_aa divIVA Cell wall synthesis protein Wag31
3148 MSKN01000033.1 GCA001937415_01627 CDS open 132853-133647 _na     264_aa lspA signal peptidase II
3149 MSKN01000033.1 GCA001937415_01628 CDS open 133644-134564 _na     306_aa rluA Pseudouridine synthase
3150 MSKN01000033.1 GCA001937415_01629 CDS open 134640-135608 _na     322_aa 2-dehydropantoate 2-reductase
3151 MSKN01000033.1 GCA001937415_01630 CDS open 135785-139378 _na     1197_aa dnaE DNA polymerase III subunit alpha
3152 MSKN01000033.1 GCA001937415_01631 CDS open 139941-140300 _na     119_aa hypothetical protein
3153 MSKN01000033.1 GCA001937415_01632 CDS open 140217-140483 _na     88_aa RNA-binding S4 domain-containing protein
3154 MSKN01000033.1 GCA001937415_01633 CDS open 140670-143087 _na     805_aa LPXTG cell wall anchor domain-containing protein
3155 MSKN01000033.1 GCA001937415_01634 CDS open 143130-143531 _na     133_aa Methylated-DNA-[protein]-cysteine S-methyltransferase DNA binding domain-containing protein
3156 MSKN01000033.1 GCA001937415_01635 CDS open 143685-144896 _na     403_aa Methylenetetrahydrofolate reductase
3157 MSKN01000033.1 GCA001937415_01636 CDS open 144893-147286 _na     797_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
3158 MSKN01000033.1 GCA001937415_01637 CDS open 147367-148734 _na     455_aa Histidinol dehydrogenase
3159 MSKN01000033.1 GCA001937415_01638 CDS open 149040-149336 _na     98_aa RDD family
3160 MSKN01000033.1 GCA001937415_01639 CDS open 149336-150907 _na     523_aa Glycosyltransferase 2-like domain-containing protein
3161 MSKN01000033.1 GCA001937415_01640 CDS open 150904-151623 _na     239_aa Calcium-binding protein
3162 MSKN01000033.1 GCA001937415_01641 CDS open 151708-152910 _na     400_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
3163 MSKN01000033.1 GCA001937415_01642 CDS open 152907-154862 _na     651_aa ydaL Tat pathway signal protein
3164 MSKN01000033.1 GCA001937415_01643 CDS open 154957-156450 _na     497_aa Tat pathway signal sequence
3165 MSKN01000033.1 GCA001937415_01644 CDS open 156516-158807 _na     763_aa recQ ATP-dependent DNA helicase RecQ
3166 MSKN01000033.1 GCA001937415_01645 CDS open 159149-160108 _na     319_aa HTH marR-type domain-containing protein
3167 MSKN01000033.1 GCA001937415_01646 CDS open 160151-162076 _na     641_aa Cation/H+ exchanger transmembrane domain-containing protein
3168 MSKN01000033.1 GCA001937415_01647 CDS open 162467-163609 _na     380_aa hisC histidinol-phosphate transaminase
3169 MSKN01000033.1 GCA001937415_01648 CDS open 163721-164320 _na     199_aa hisB imidazoleglycerol-phosphate dehydratase HisB
3170 MSKN01000033.1 GCA001937415_01649 CDS open 164320-165234 _na     304_aa hypothetical protein
3171 MSKN01000033.1 GCA001937415_01650 CDS open 165281-166864 _na     527_aa non-specific serine/threonine protein kinase
3172 MSKN01000033.1 GCA001937415_01651 CDS open 167254-167922 _na     222_aa hisH imidazole glycerol phosphate synthase subunit HisH
3173 MSKN01000033.1 GCA001937415_01652 CDS open 167965-168717 _na     250_aa priA bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA
3174 MSKN01000033.1 GCA001937415_01653 CDS open 168918-169706 _na     262_aa sseB SseB family protein
3175 MSKN01000033.1 GCA001937415_01654 CDS open 169729-170046 _na     105_aa Conserved domain protein
3176 MSKN01000033.1 GCA001937415_01655 CDS open 170230-170901 _na     223_aa ABC transporter ATP-binding protein
3177 MSKN01000033.1 GCA001937415_01656 CDS open 170898-172508 _na     536_aa ABC-2 type transport system permease protein
3178 MSKN01000033.1 GCA001937415_01657 CDS open 172872-173471 _na     199_aa infC translation initiation factor IF-3
3179 MSKN01000033.1 GCA001937415_01658 CDS open 173595-173789 _na     64_aa rpmI 50S ribosomal protein L35
3180 MSKN01000033.1 GCA001937415_01659 CDS open 173817-174197 _na     126_aa rplT 50S ribosomal protein L20
3181 MSKN01000033.1 GCA001937415_01660 CDS open 174321-175253 _na     310_aa trmH RNA methyltransferase%2C TrmH family
3182 MSKN01000033.1 GCA001937415_01661 CDS open 175255-176535 _na     426_aa Glycosyl transferase family 28
3183 MSKN01000033.1 GCA001937415_01662 CDS open 176746-177396 _na     216_aa TetR/AcrR family transcriptional regulator
3184 MSKN01000033.1 GCA001937415_01663 CDS open 177662-178447 _na     261_aa glnQ ABC transporter domain-containing protein
3185 MSKN01000033.1 GCA001937415_01664 CDS open 178537-179517 _na     326_aa hisJ Tat pathway signal protein
3186 MSKN01000033.1 GCA001937415_01665 CDS open 179643-180299 _na     218_aa hisM ABC transmembrane type-1 domain-containing protein
3187 MSKN01000033.1 GCA001937415_01666 CDS open 180296-181171 _na     291_aa ABC transporter%2C permease protein
3188 MSKN01000033.1 GCA001937415_01667 CDS open 181197-181289 _na     30_aa hypothetical protein
3189 MSKN01000033.1 GCA001937415_01668 CDS open 181549-182025 _na     158_aa marR MarR family transcriptional regulator
3190 MSKN01000033.1 GCA001937415_01669 CDS open 182084-182434 _na     116_aa DUF4267 domain-containing protein
3191 MSKN01000033.1 GCA001937415_01670 CDS open 182477-184147 _na     556_aa ABC transporter permease
3192 MSKN01000033.1 GCA001937415_01671 CDS open 184147-185163 _na     338_aa ABC transporter
3193 MSKN01000033.1 GCA001937415_01672 CDS open 185160-186023 _na     287_aa soxR HTH merR-type domain-containing protein
3194 MSKN01000033.1 GCA001937415_01673 CDS open 186225-187310 _na     361_aa pheS phenylalanine--tRNA ligase subunit alpha
3195 MSKN01000033.1 GCA001937415_01674 CDS open 187312-189969 _na     885_aa pheT phenylalanine--tRNA ligase subunit beta
3196 MSKN01000033.1 GCA001937415_01675 CDS open 190006-190614 _na     202_aa Flavodoxin-like domain-containing protein
3197 MSKN01000033.1 GCA001937415_01676 CDS open 190716-191822 _na     368_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
3198 MSKN01000033.1 GCA001937415_01677 CDS open 191819-193015 _na     398_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
3199 MSKN01000033.1 GCA001937415_01678 CDS open 193012-193938 _na     308_aa argB Acetylglutamate kinase
3200 MSKN01000033.1 GCA001937415_01679 CDS open 193935-195209 _na     424_aa acetylornithine transaminase
3201 MSKN01000033.1 GCA001937415_01680 CDS open 195206-195793 _na     195_aa Arginine repressor
3202 MSKN01000033.1 GCA001937415_01681 CDS open 195875-197098 _na     407_aa argG argininosuccinate synthase
3203 MSKN01000033.1 GCA001937415_01682 CDS open 197140-198012 _na     290_aa focA Formate/nitrite transporter
3204 MSKN01000033.1 GCA001937415_01683 CDS open 198197-199765 _na     522_aa argH argininosuccinate lyase
3205 MSKN01000033.1 GCA001937415_01684 CDS open 199798-200460 _na     220_aa DNA-3-methyladenine glycosylase
3206 MSKN01000033.1 GCA001937415_01685 CDS open 200595-201020 _na     141_aa Polyketide cyclase
3207 MSKN01000033.1 GCA001937415_01686 CDS open 201062-201577 _na     171_aa Transcriptional regulator
3208 MSKN01000033.1 GCA001937415_01687 CDS open 201519-201770 _na     83_aa hypothetical protein
3209 MSKN01000033.1 GCA001937415_01688 CDS open 201801-203075 _na     424_aa tyrS tyrosine--tRNA ligase
3210 MSKN01000033.1 GCA001937415_01516 gene open 1209-1307
3211 MSKN01000033.1 GCA001937415_01517 gene open 1541-2482
3212 MSKN01000033.1 GCA001937415_01518 gene open 2794-4074 yveK
3213 MSKN01000033.1 GCA001937415_01519 gene open 4884-6809 flaA1
3214 MSKN01000033.1 GCA001937415_01520 gene open 6809-8020
3215 MSKN01000033.1 GCA001937415_01521 gene open 8017-8703
3216 MSKN01000033.1 GCA001937415_01522 gene open 8735-9517 wcaA
3217 MSKN01000033.1 GCA001937415_01523 gene open 9583-10734
3218 MSKN01000033.1 GCA001937415_01524 gene open 10744-11850
3219 MSKN01000033.1 GCA001937415_01525 gene open 11850-12278
3220 MSKN01000033.1 GCA001937415_01526 gene open 12275-12382
3221 MSKN01000033.1 GCA001937415_01527 gene open 12366-13793
3222 MSKN01000033.1 GCA001937415_01528 gene open 13814-15136
3223 MSKN01000033.1 GCA001937415_01529 gene open 15501-17309
3224 MSKN01000033.1 GCA001937415_01530 gene open 17628-18308 dhaL
3225 MSKN01000033.1 GCA001937415_01531 gene open 18394-18834 ndk
3226 MSKN01000033.1 GCA001937415_01532 gene open 19023-20267 natB
3227 MSKN01000033.1 GCA001937415_01533 gene open 20267-21214
3228 MSKN01000033.1 GCA001937415_01534 gene open 21247-25185
3229 MSKN01000033.1 GCA001937415_01535 gene open 25347-25721
3230 MSKN01000033.1 GCA001937415_01536 gene open 26083-27243 ftsY
3231 MSKN01000033.1 GCA001937415_01537 gene open 27375-27986 citB
3232 MSKN01000033.1 GCA001937415_01538 gene open 28065-29222
3233 MSKN01000033.1 GCA001937415_01539 gene open 29251-30138
3234 MSKN01000033.1 GCA001937415_01540 gene open 30135-31127
3235 MSKN01000033.1 GCA001937415_01541 gene open 31491-33176 ffh
3236 MSKN01000033.1 GCA001937415_01542 gene open 33191-33802 citB
3237 MSKN01000033.1 GCA001937415_01543 gene open 33799-35037
3238 MSKN01000033.1 GCA001937415_01544 gene open 35046-35924
3239 MSKN01000033.1 GCA001937415_01545 gene open 35975-36994 rbbA
3240 MSKN01000033.1 GCA001937415_01546 gene open 37108-38265
3241 MSKN01000033.1 GCA001937415_01547 gene open 38840-39457
3242 MSKN01000033.1 GCA001937415_01548 gene open 39459-39695 ylqC
3243 MSKN01000033.1 GCA001937415_01549 gene open 40006-40554 rimM
3244 MSKN01000033.1 GCA001937415_01550 gene open 40551-41972 trmD
3245 MSKN01000033.1 GCA001937415_01551 gene open 41969-42883 lepB
3246 MSKN01000033.1 GCA001937415_01552 gene open 43127-43474 rplS
3247 MSKN01000033.1 GCA001937415_01553 gene open 43586-44806 lepB
3248 MSKN01000033.1 GCA001937415_01554 gene open 44803-45525
3249 MSKN01000033.1 GCA001937415_01555 gene open 45537-45938
3250 MSKN01000033.1 GCA001937415_01556 gene open 46102-46662 yraN
3251 MSKN01000033.1 GCA001937415_01557 gene open 46653-48224 yifB
3252 MSKN01000033.1 GCA001937415_01558 gene open 48221-49600 dprA
3253 MSKN01000033.1 GCA001937415_01559 gene open 49785-50708 xerC
3254 MSKN01000033.1 GCA001937415_01560 gene open 50736-51389
3255 MSKN01000033.1 GCA001937415_01561 gene open 52046-52894 rpsB
3256 MSKN01000033.1 GCA001937415_01562 gene open 53003-53842 tsf
3257 MSKN01000033.1 GCA001937415_01563 gene open 54090-54842 pyrH
3258 MSKN01000033.1 GCA001937415_01564 gene open 55006-55563 frr
3259 MSKN01000033.1 GCA001937415_01565 gene open 55628-56566 cdsA
3260 MSKN01000033.1 GCA001937415_01566 gene open 56639-57901 rlmN
3261 MSKN01000033.1 GCA001937415_01567 gene open 57898-58443
3262 MSKN01000033.1 GCA001937415_01568 gene open 58485-59777 dxr
3263 MSKN01000033.1 GCA001937415_01569 gene open 59774-61108
3264 MSKN01000033.1 GCA001937415_01570 gene open 61244-62392 ispG
3265 MSKN01000033.1 GCA001937415_01571 gene open 62442-63431
3266 MSKN01000033.1 GCA001937415_01572 gene open 63565-65400 proS
3267 MSKN01000033.1 GCA001937415_01573 gene open 65855-67231
3268 MSKN01000033.1 GCA001937415_01574 gene open 67313-68170
3269 MSKN01000033.1 GCA001937415_01575 gene open 68652-68885
3270 MSKN01000033.1 GCA001937415_01576 gene open 69663-70409
3271 MSKN01000033.1 GCA001937415_01577 gene open 70887-71075
3272 MSKN01000033.1 GCA001937415_01578 gene open 71142-72191
3273 MSKN01000033.1 GCA001937415_01579 gene open 72316-72834 rimP
3274 MSKN01000033.1 GCA001937415_01580 gene open 73041-74069 nusA
3275 MSKN01000033.1 GCA001937415_01581 gene open 74188-74520 ylxR
3276 MSKN01000033.1 GCA001937415_01582 gene open 74612-77560 infB
3277 MSKN01000033.1 GCA001937415_01583 gene open 77677-79248 ydhU
3278 MSKN01000033.1 GCA001937415_01584 gene open 79613-81955 norB
3279 MSKN01000033.1 GCA001937415_01585 gene open 81955-82881
3280 MSKN01000033.1 GCA001937415_01586 gene open 82932-83732 hflC
3281 MSKN01000033.1 GCA001937415_01587 gene open 83707-84699 rarD
3282 MSKN01000033.1 GCA001937415_01588 gene open 84897-85394 rbfA
3283 MSKN01000033.1 GCA001937415_01589 gene open 85391-86506 truB
3284 MSKN01000033.1 GCA001937415_01590 gene open 86578-86880
3285 MSKN01000033.1 GCA001937415_01591 gene open 86891-87700
3286 MSKN01000033.1 GCA001937415_01592 gene open 87712-90042
3287 MSKN01000033.1 GCA001937415_01593 gene open 90331-91356 ribF
3288 MSKN01000033.1 GCA001937415_01594 gene open 91576-91845 rpsO
3289 MSKN01000033.1 GCA001937415_01595 gene open 92390-94735 pnp
3290 MSKN01000033.1 GCA001937415_01596 gene open 94921-96327 pqqL
3291 MSKN01000033.1 GCA001937415_01597 gene open 96423-97319
3292 MSKN01000033.1 GCA001937415_01598 gene open 97451-98071
3293 MSKN01000033.1 GCA001937415_01599 gene open 98114-98866 dapB
3294 MSKN01000033.1 GCA001937415_01600 gene open 98920-99663
3295 MSKN01000033.1 GCA001937415_01601 gene open 99977-100873 dapA
3296 MSKN01000033.1 GCA001937415_01602 gene open 100896-101342
3297 MSKN01000033.1 GCA001937415_01603 gene open 101382-103163 menE
3298 MSKN01000033.1 GCA001937415_01604 gene open 103239-105155
3299 MSKN01000033.1 GCA001937415_01605 gene open 105315-107924
3300 MSKN01000033.1 GCA001937415_01606 gene open 108414-109352
3301 MSKN01000033.1 GCA001937415_01607 gene open 109426-110253
3302 MSKN01000033.1 GCA001937415_01608 gene open 110341-111666 dinB
3303 MSKN01000033.1 GCA001937415_01609 gene open 111735-112148
3304 MSKN01000033.1 GCA001937415_01610 gene open 112775-113206 mraZ
3305 MSKN01000033.1 GCA001937415_01611 gene open 113460-114587 rsmH
3306 MSKN01000033.1 GCA001937415_01612 gene open 114696-115160 ftsL
3307 MSKN01000033.1 GCA001937415_01613 gene open 115167-116966 ftsI
3308 MSKN01000033.1 GCA001937415_01614 gene open 117073-118659 murE
3309 MSKN01000033.1 GCA001937415_01615 gene open 118644-120095 murF
3310 MSKN01000033.1 GCA001937415_01616 gene open 120092-121192 mraY
3311 MSKN01000033.1 GCA001937415_01617 gene open 121295-122854 murD
3312 MSKN01000033.1 GCA001937415_01618 gene open 122851-124380 ftsW
3313 MSKN01000033.1 GCA001937415_01619 gene open 124364-125623 murG
3314 MSKN01000033.1 GCA001937415_01620 gene open 125620-127194 murC
3315 MSKN01000033.1 GCA001937415_01621 gene open 127191-128426
3316 MSKN01000033.1 GCA001937415_01622 gene open 128693-130063 ftsZ
3317 MSKN01000033.1 GCA001937415_01623 gene open 130093-130908
3318 MSKN01000033.1 GCA001937415_01624 gene open 131061-131525 sepF
3319 MSKN01000033.1 GCA001937415_01625 gene open 131538-131834 yggT
3320 MSKN01000033.1 GCA001937415_01626 gene open 132000-132608 divIVA
3321 MSKN01000033.1 GCA001937415_01627 gene open 132853-133647 lspA
3322 MSKN01000033.1 GCA001937415_01628 gene open 133644-134564 rluA
3323 MSKN01000033.1 GCA001937415_01629 gene open 134640-135608
3324 MSKN01000033.1 GCA001937415_01630 gene open 135785-139378 dnaE
3325 MSKN01000033.1 GCA001937415_01631 gene open 139941-140300
3326 MSKN01000033.1 GCA001937415_01632 gene open 140217-140483
3327 MSKN01000033.1 GCA001937415_01633 gene open 140670-143087
3328 MSKN01000033.1 GCA001937415_01634 gene open 143130-143531
3329 MSKN01000033.1 GCA001937415_01635 gene open 143685-144896
3330 MSKN01000033.1 GCA001937415_01636 gene open 144893-147286 metE
3331 MSKN01000033.1 GCA001937415_01637 gene open 147367-148734
3332 MSKN01000033.1 GCA001937415_01638 gene open 149040-149336
3333 MSKN01000033.1 GCA001937415_01639 gene open 149336-150907
3334 MSKN01000033.1 GCA001937415_01640 gene open 150904-151623
3335 MSKN01000033.1 GCA001937415_01641 gene open 151708-152910 wecB
3336 MSKN01000033.1 GCA001937415_01642 gene open 152907-154862 ydaL
3337 MSKN01000033.1 GCA001937415_01643 gene open 154957-156450
3338 MSKN01000033.1 GCA001937415_01644 gene open 156516-158807 recQ
3339 MSKN01000033.1 GCA001937415_01645 gene open 159149-160108
3340 MSKN01000033.1 GCA001937415_01646 gene open 160151-162076
3341 MSKN01000033.1 GCA001937415_01647 gene open 162467-163609 hisC
3342 MSKN01000033.1 GCA001937415_01648 gene open 163721-164320 hisB
3343 MSKN01000033.1 GCA001937415_01649 gene open 164320-165234
3344 MSKN01000033.1 GCA001937415_01650 gene open 165281-166864
3345 MSKN01000033.1 GCA001937415_01651 gene open 167254-167922 hisH
3346 MSKN01000033.1 GCA001937415_01652 gene open 167965-168717 priA
3347 MSKN01000033.1 GCA001937415_01653 gene open 168918-169706 sseB
3348 MSKN01000033.1 GCA001937415_01654 gene open 169729-170046
3349 MSKN01000033.1 GCA001937415_01655 gene open 170230-170901
3350 MSKN01000033.1 GCA001937415_01656 gene open 170898-172508
3351 MSKN01000033.1 GCA001937415_01657 gene open 172872-173471 infC
3352 MSKN01000033.1 GCA001937415_01658 gene open 173595-173789 rpmI
3353 MSKN01000033.1 GCA001937415_01659 gene open 173817-174197 rplT
3354 MSKN01000033.1 GCA001937415_01660 gene open 174321-175253 trmH
3355 MSKN01000033.1 GCA001937415_01661 gene open 175255-176535
3356 MSKN01000033.1 GCA001937415_01662 gene open 176746-177396
3357 MSKN01000033.1 GCA001937415_01663 gene open 177662-178447 glnQ
3358 MSKN01000033.1 GCA001937415_01664 gene open 178537-179517 hisJ
3359 MSKN01000033.1 GCA001937415_01665 gene open 179643-180299 hisM
3360 MSKN01000033.1 GCA001937415_01666 gene open 180296-181171
3361 MSKN01000033.1 GCA001937415_01667 gene open 181197-181289
3362 MSKN01000033.1 GCA001937415_01668 gene open 181549-182025 marR
3363 MSKN01000033.1 GCA001937415_01669 gene open 182084-182434
3364 MSKN01000033.1 GCA001937415_01670 gene open 182477-184147
3365 MSKN01000033.1 GCA001937415_01671 gene open 184147-185163
3366 MSKN01000033.1 GCA001937415_01672 gene open 185160-186023 soxR
3367 MSKN01000033.1 GCA001937415_01673 gene open 186225-187310 pheS
3368 MSKN01000033.1 GCA001937415_01674 gene open 187312-189969 pheT
3369 MSKN01000033.1 GCA001937415_01675 gene open 190006-190614
3370 MSKN01000033.1 GCA001937415_01676 gene open 190716-191822 argC
3371 MSKN01000033.1 GCA001937415_01677 gene open 191819-193015 argJ
3372 MSKN01000033.1 GCA001937415_01678 gene open 193012-193938 argB
3373 MSKN01000033.1 GCA001937415_01679 gene open 193935-195209
3374 MSKN01000033.1 GCA001937415_01680 gene open 195206-195793
3375 MSKN01000033.1 GCA001937415_01681 gene open 195875-197098 argG
3376 MSKN01000033.1 GCA001937415_01682 gene open 197140-198012 focA
3377 MSKN01000033.1 GCA001937415_01683 gene open 198197-199765 argH
3378 MSKN01000033.1 GCA001937415_01684 gene open 199798-200460
3379 MSKN01000033.1 GCA001937415_01685 gene open 200595-201020
3380 MSKN01000033.1 GCA001937415_01686 gene open 201062-201577
3381 MSKN01000033.1 GCA001937415_01687 gene open 201519-201770
3382 MSKN01000033.1 GCA001937415_01688 gene open 201801-203075 tyrS
3383 MSKN01000034.1 GCA001937415_01694 gene open 4217-4509 5_ureB_sRNA
3384 MSKN01000034.1 GCA001937415_01694 ncRNA open 4217-4509 5' ureB small RNA
3385 MSKN01000034.1 regulatory_region open 12374-12459 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
3386 MSKN01000034.1 GCA001937415_01689 CDS open 161-976 _na     271_aa ureD Urease accessory protein UreD
3387 MSKN01000034.1 GCA001937415_01690 CDS open 973-1650 _na     225_aa ureG urease accessory protein UreG
3388 MSKN01000034.1 GCA001937415_01691 CDS open 1685-2455 _na     256_aa ureF Urease accessory protein UreF
3389 MSKN01000034.1 GCA001937415_01692 CDS open 2436-2927 _na     163_aa ureE urease accessory protein UreE
3390 MSKN01000034.1 GCA001937415_01693 CDS open 2949-4661 _na     570_aa ureC urease subunit alpha
3391 MSKN01000034.1 GCA001937415_01695 CDS open 4679-4990 _na     103_aa ureB urease subunit beta
3392 MSKN01000034.1 GCA001937415_01696 CDS open 4987-5301 _na     104_aa ureA urease subunit gamma
3393 MSKN01000034.1 GCA001937415_01697 CDS open 5589-5711 _na     40_aa ykgO type B 50S ribosomal protein L36
3394 MSKN01000034.1 GCA001937415_01698 CDS open 5708-6277 _na     189_aa Formyltetrahydrofolate deformylase
3395 MSKN01000034.1 GCA001937415_01699 CDS open 6446-7630 _na     394_aa Amino acid permease
3396 MSKN01000034.1 GCA001937415_01700 CDS open 7832-9082 _na     416_aa Glutathionylspermidine synthase
3397 MSKN01000034.1 GCA001937415_01701 CDS open 9083-9508 _na     141_aa Zinc transporter
3398 MSKN01000034.1 GCA001937415_01702 CDS open 9648-9770 _na     40_aa ykgO type B 50S ribosomal protein L36
3399 MSKN01000034.1 GCA001937415_01703 CDS open 9851-10102 _na     83_aa type B 50S ribosomal protein L31
3400 MSKN01000034.1 GCA001937415_01704 CDS open 10248-10553 _na     101_aa rpsN 30S ribosomal protein S14
3401 MSKN01000034.1 GCA001937415_01705 CDS open 10553-10726 _na     57_aa rpmG 50S ribosomal protein L33
3402 MSKN01000034.1 GCA001937415_01706 CDS open 10723-10971 _na     82_aa rpmB 50S ribosomal protein L28
3403 MSKN01000034.1 GCA001937415_01707 CDS open 11018-12214 _na     398_aa cobW CobW C-terminal domain-containing protein
3404 MSKN01000034.1 GCA001937415_01708 CDS open 12525-13835 _na     436_aa glyA Serine hydroxymethyltransferase
3405 MSKN01000034.1 GCA001937415_01709 CDS open 13832-14728 _na     298_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
3406 MSKN01000034.1 GCA001937415_01710 CDS open 14915-16513 _na     532_aa Fructan beta-fructosidase
3407 MSKN01000034.1 GCA001937415_01711 CDS open 16616-18526 _na     636_aa Levansucrase
3408 MSKN01000034.1 GCA001937415_01712 CDS open 18860-20059 _na     399_aa choice-of-anchor L domain-containing protein
3409 MSKN01000034.1 GCA001937415_01713 CDS open 20153-20377 _na     74_aa DUF2933 domain-containing protein
3410 MSKN01000034.1 GCA001937415_01714 CDS open 20391-20696 _na     101_aa acylphosphatase
3411 MSKN01000034.1 GCA001937415_01715 CDS open 20743-21576 _na     277_aa xthA exodeoxyribonuclease III
3412 MSKN01000034.1 GCA001937415_01716 CDS open 21646-23067 _na     473_aa ABC3 transporter permease protein domain-containing protein
3413 MSKN01000034.1 GCA001937415_01717 CDS open 23064-23852 _na     262_aa lolD ABC transporter domain-containing protein
3414 MSKN01000034.1 GCA001937415_01718 CDS open 23849-24574 _na     241_aa Biotin-requiring enzyme
3415 MSKN01000034.1 GCA001937415_01719 CDS open 24571-24903 _na     110_aa Biotin-lipoyl-like domain protein
3416 MSKN01000034.1 GCA001937415_01720 CDS open 25098-26375 _na     425_aa galK galactokinase
3417 MSKN01000034.1 GCA001937415_01721 CDS open 26451-27299 _na     282_aa glpR HTH deoR-type domain-containing protein
3418 MSKN01000034.1 GCA001937415_01722 CDS open 27561-28214 _na     217_aa 2'-5' RNA ligase
3419 MSKN01000034.1 GCA001937415_01723 CDS open 28211-29233 _na     340_aa brkB YihY/virulence factor BrkB family protein
3420 MSKN01000034.1 GCA001937415_01724 CDS open 29300-30547 _na     415_aa Mannose-1-phosphate guanylyltransferase
3421 MSKN01000034.1 GCA001937415_01725 CDS open 30787-31887 _na     366_aa med ABC transporter substrate-binding protein PnrA-like domain-containing protein
3422 MSKN01000034.1 GCA001937415_01726 CDS open 31945-33474 _na     509_aa nupO ABC transporter domain-containing protein
3423 MSKN01000034.1 GCA001937415_01727 CDS open 33471-34814 _na     447_aa nupP ABC transporter permease
3424 MSKN01000034.1 GCA001937415_01728 CDS open 34818-36110 _na     430_aa ABC transporter permease
3425 MSKN01000034.1 GCA001937415_01729 CDS open 36107-36541 _na     144_aa cytidine deaminase
3426 MSKN01000034.1 GCA001937415_01730 CDS open 36582-37928 _na     448_aa deoA thymidine phosphorylase
3427 MSKN01000034.1 GCA001937415_01731 CDS open 37925-38746 _na     273_aa Peptidase C39-like domain-containing protein
3428 MSKN01000034.1 GCA001937415_01732 CDS open 38848-39078 _na     76_aa Major facilitator superfamily (MFS) profile domain-containing protein
3429 MSKN01000034.1 GCA001937415_01733 CDS open 39126-39779 _na     217_aa deoC deoxyribose-phosphate aldolase
3430 MSKN01000034.1 GCA001937415_01734 CDS open 39927-41129 _na     400_aa znuA Zinc ABC transporter substrate-binding protein
3431 MSKN01000034.1 GCA001937415_01735 CDS open 41137-41964 _na     275_aa znuC ABC transporter domain-containing protein
3432 MSKN01000034.1 GCA001937415_01736 CDS open 41961-43019 _na     352_aa Zinc ABC transporter permease
3433 MSKN01000034.1 GCA001937415_01737 CDS open 43016-43906 _na     296_aa ABC 3 transport family protein
3434 MSKN01000034.1 GCA001937415_01738 CDS open 43978-45696 _na     572_aa manB Phosphomannomutase
3435 MSKN01000034.1 GCA001937415_01739 CDS open 46018-46773 _na     251_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
3436 MSKN01000034.1 GCA001937415_01740 CDS open 46879-47046 _na     55_aa DUF3117 domain-containing protein
3437 MSKN01000034.1 GCA001937415_01741 CDS open 47186-47821 _na     211_aa trmR Methyltransferase domain-containing protein
3438 MSKN01000034.1 GCA001937415_01742 CDS open 47981-48895 _na     304_aa tatB Sec-independent protein translocase protein TatB
3439 MSKN01000034.1 GCA001937415_01743 CDS open 48928-50070 _na     380_aa paaD Iron-sulfur cluster carrier protein
3440 MSKN01000034.1 GCA001937415_01744 CDS open 50141-50713 _na     190_aa DUF1003 domain-containing protein
3441 MSKN01000034.1 GCA001937415_01745 CDS open 50706-51998 _na     430_aa mgtE CBS domain-containing protein
3442 MSKN01000034.1 GCA001937415_01746 CDS open 52037-52882 _na     281_aa General stress protein 17M-like domain-containing protein
3443 MSKN01000034.1 GCA001937415_01747 CDS open 52912-53760 _na     282_aa ycjR Xylose isomerase-like TIM barrel domain-containing protein
3444 MSKN01000034.1 GCA001937415_01748 CDS open 53767-54741 _na     324_aa czcD Cation efflux protein cytoplasmic domain-containing protein
3445 MSKN01000034.1 GCA001937415_01749 CDS open 54738-55103 _na     121_aa metalloregulator ArsR/SmtB family transcription factor
3446 MSKN01000034.1 GCA001937415_01750 CDS open 55172-56815 _na     547_aa pepP Xaa-Pro aminopeptidase
3447 MSKN01000034.1 GCA001937415_01751 CDS open 56881-57981 _na     366_aa Gfo/Idh/MocA family oxidoreductase
3448 MSKN01000034.1 GCA001937415_01752 CDS open 58041-58886 _na     281_aa PHP domain protein
3449 MSKN01000034.1 GCA001937415_01753 CDS open 58944-59573 _na     209_aa marC UPF0056 membrane protein
3450 MSKN01000034.1 GCA001937415_01754 CDS open 59640-61295 _na     551_aa srmB RNA helicase
3451 MSKN01000034.1 GCA001937415_01755 CDS open 61863-62540 _na     225_aa tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE-like protein
3452 MSKN01000034.1 GCA001937415_01756 CDS open 62723-63379 _na     218_aa Peptidase
3453 MSKN01000034.1 GCA001937415_01757 CDS open 63418-64629 _na     403_aa Chromosome condensation regulator RCC1
3454 MSKN01000034.1 GCA001937415_01758 CDS open 64704-64892 _na     62_aa yjbJ CsbD-like domain-containing protein
3455 MSKN01000034.1 GCA001937415_01759 CDS open 65169-66617 _na     482_aa codB Allantoin permease
3456 MSKN01000034.1 GCA001937415_01689 gene open 161-976 ureD
3457 MSKN01000034.1 GCA001937415_01690 gene open 973-1650 ureG
3458 MSKN01000034.1 GCA001937415_01691 gene open 1685-2455 ureF
3459 MSKN01000034.1 GCA001937415_01692 gene open 2436-2927 ureE
3460 MSKN01000034.1 GCA001937415_01693 gene open 2949-4661 ureC
3461 MSKN01000034.1 GCA001937415_01695 gene open 4679-4990 ureB
3462 MSKN01000034.1 GCA001937415_01696 gene open 4987-5301 ureA
3463 MSKN01000034.1 GCA001937415_01697 gene open 5589-5711 ykgO
3464 MSKN01000034.1 GCA001937415_01698 gene open 5708-6277
3465 MSKN01000034.1 GCA001937415_01699 gene open 6446-7630
3466 MSKN01000034.1 GCA001937415_01700 gene open 7832-9082
3467 MSKN01000034.1 GCA001937415_01701 gene open 9083-9508
3468 MSKN01000034.1 GCA001937415_01702 gene open 9648-9770 ykgO
3469 MSKN01000034.1 GCA001937415_01703 gene open 9851-10102
3470 MSKN01000034.1 GCA001937415_01704 gene open 10248-10553 rpsN
3471 MSKN01000034.1 GCA001937415_01705 gene open 10553-10726 rpmG
3472 MSKN01000034.1 GCA001937415_01706 gene open 10723-10971 rpmB
3473 MSKN01000034.1 GCA001937415_01707 gene open 11018-12214 cobW
3474 MSKN01000034.1 GCA001937415_01708 gene open 12525-13835 glyA
3475 MSKN01000034.1 GCA001937415_01709 gene open 13832-14728 folD
3476 MSKN01000034.1 GCA001937415_01710 gene open 14915-16513
3477 MSKN01000034.1 GCA001937415_01711 gene open 16616-18526
3478 MSKN01000034.1 GCA001937415_01712 gene open 18860-20059
3479 MSKN01000034.1 GCA001937415_01713 gene open 20153-20377
3480 MSKN01000034.1 GCA001937415_01714 gene open 20391-20696
3481 MSKN01000034.1 GCA001937415_01715 gene open 20743-21576 xthA
3482 MSKN01000034.1 GCA001937415_01716 gene open 21646-23067
3483 MSKN01000034.1 GCA001937415_01717 gene open 23064-23852 lolD
3484 MSKN01000034.1 GCA001937415_01718 gene open 23849-24574
3485 MSKN01000034.1 GCA001937415_01719 gene open 24571-24903
3486 MSKN01000034.1 GCA001937415_01720 gene open 25098-26375 galK
3487 MSKN01000034.1 GCA001937415_01721 gene open 26451-27299 glpR
3488 MSKN01000034.1 GCA001937415_01722 gene open 27561-28214
3489 MSKN01000034.1 GCA001937415_01723 gene open 28211-29233 brkB
3490 MSKN01000034.1 GCA001937415_01724 gene open 29300-30547
3491 MSKN01000034.1 GCA001937415_01725 gene open 30787-31887 med
3492 MSKN01000034.1 GCA001937415_01726 gene open 31945-33474 nupO
3493 MSKN01000034.1 GCA001937415_01727 gene open 33471-34814 nupP
3494 MSKN01000034.1 GCA001937415_01728 gene open 34818-36110
3495 MSKN01000034.1 GCA001937415_01729 gene open 36107-36541
3496 MSKN01000034.1 GCA001937415_01730 gene open 36582-37928 deoA
3497 MSKN01000034.1 GCA001937415_01731 gene open 37925-38746
3498 MSKN01000034.1 GCA001937415_01732 gene open 38848-39078
3499 MSKN01000034.1 GCA001937415_01733 gene open 39126-39779 deoC
3500 MSKN01000034.1 GCA001937415_01734 gene open 39927-41129 znuA