BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_001937445.1)
Select a Genome:
|
BAKTA Annotations for GCA_001937445.1
|
Search & Sort all 5416 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | MSKS01000011.1 | GCA001937445_00772 | CDS | open | 63425-64162 | _na 245_aa | Pentapeptide repeat-containing protein | |
| 1502 | MSKS01000011.1 | GCA001937445_00773 | CDS | open | 64159-64710 | _na 183_aa | Cell wall synthesis protein Wag31 | |
| 1503 | MSKS01000011.1 | GCA001937445_00774 | CDS | open | 64707-65300 | _na 197_aa | rloB | RloB domain-containing protein |
| 1504 | MSKS01000011.1 | GCA001937445_00775 | CDS | open | 65302-66603 | _na 433_aa | ATPase AAA-type core domain-containing protein | |
| 1505 | MSKS01000011.1 | GCA001937445_00776 | CDS | open | 66797-68470 | _na 557_aa | lysS | lysine--tRNA ligase |
| 1506 | MSKS01000011.1 | GCA001937445_00777 | CDS | open | 68574-69773 | _na 399_aa | hypothetical protein | |
| 1507 | MSKS01000011.1 | GCA001937445_00778 | CDS | open | 69857-70288 | _na 143_aa | panD | aspartate 1-decarboxylase |
| 1508 | MSKS01000011.1 | GCA001937445_00779 | CDS | open | 70620-71633 | _na 337_aa | panC | pantoate--beta-alanine ligase |
| 1509 | MSKS01000011.1 | GCA001937445_00780 | CDS | open | 71635-71874 | _na 79_aa | hypothetical protein | |
| 1510 | MSKS01000011.1 | GCA001937445_00781 | CDS | open | 72099-73085 | _na 328_aa | Oxidoreductase | |
| 1511 | MSKS01000011.1 | GCA001937445_00782 | CDS | open | 73086-74840 | _na 584_aa | YdbS-like PH domain-containing protein | |
| 1512 | MSKS01000011.1 | GCA001937445_00783 | CDS | open | 74837-75406 | _na 189_aa | YdbS-like PH domain-containing protein | |
| 1513 | MSKS01000011.1 | GCA001937445_00784 | CDS | open | 75403-75903 | _na 166_aa | DUF3180 domain-containing protein | |
| 1514 | MSKS01000011.1 | GCA001937445_00785 | CDS | open | 75903-78623 | _na 906_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 1515 | MSKS01000011.1 | GCA001937445_00786 | CDS | open | 78620-79516 | _na 298_aa | folP | dihydropteroate synthase |
| 1516 | MSKS01000011.1 | GCA001937445_00787 | CDS | open | 79885-81036 | _na 383_aa | ABC transporter domain-containing protein | |
| 1517 | MSKS01000011.1 | GCA001937445_00788 | CDS | open | 81036-83510 | _na 824_aa | ABC transporter permease | |
| 1518 | MSKS01000011.1 | GCA001937445_00789 | CDS | open | 83555-84229 | _na 224_aa | citB | Response regulator receiver domain protein |
| 1519 | MSKS01000011.1 | GCA001937445_00790 | CDS | open | 84271-85494 | _na 407_aa | histidine kinase | |
| 1520 | MSKS01000011.1 | GCA001937445_00791 | CDS | open | 85979-86155 | _na 58_aa | hypothetical protein | |
| 1521 | MSKS01000011.1 | GCA001937445_00792 | CDS | open | 86942-87265 | _na 107_aa | qacE | QacE family quaternary ammonium compound efflux SMR transporter |
| 1522 | MSKS01000011.1 | GCA001937445_00793 | CDS | open | 87262-87735 | _na 157_aa | ebrB | Multidrug resistance protein EbrB |
| 1523 | MSKS01000011.1 | GCA001937445_00794 | CDS | open | 87732-88142 | _na 136_aa | yvaD | YvaD family protein |
| 1524 | MSKS01000011.1 | GCA001937445_00795 | CDS | open | 88179-88682 | _na 167_aa | HXXEE domain-containing protein | |
| 1525 | MSKS01000011.1 | GCA001937445_00796 | CDS | open | 88861-89436 | _na 191_aa | TetR/AcrR family transcriptional regulator | |
| 1526 | MSKS01000011.1 | GCA001937445_00797 | CDS | open | 89695-90267 | _na 190_aa | folE | GTP cyclohydrolase I FolE |
| 1527 | MSKS01000011.1 | GCA001937445_00798 | CDS | open | 90320-92392 | _na 690_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 1528 | MSKS01000011.1 | GCA001937445_00799 | CDS | open | 92589-93398 | _na 269_aa | CRISPR-associated protein Cas6 C-terminal domain-containing protein | |
| 1529 | MSKS01000011.1 | GCA001937445_00800 | CDS | open | 94284-95198 | _na 304_aa | hypothetical protein | |
| 1530 | MSKS01000011.1 | GCA001937445_00801 | CDS | open | 98457-99107 | _na 216_aa | RNA-directed DNA polymerase | |
| 1531 | MSKS01000011.1 | GCA001937445_00802 | CDS | open | 99146-99841 | _na 231_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1532 | MSKS01000011.1 | GCA001937445_00803 | CDS | open | 99919-102219 | _na 766_aa | CRISPR-associated RAMP family protein | |
| 1533 | MSKS01000011.1 | GCA001937445_00804 | CDS | open | 102221-102790 | _na 189_aa | hypothetical protein | |
| 1534 | MSKS01000011.1 | GCA001937445_00805 | CDS | open | 102783-104612 | _na 609_aa | CRISPR-associated RAMP protein | |
| 1535 | MSKS01000011.1 | GCA001937445_00806 | CDS | open | 104609-106531 | _na 640_aa | CRISPR-associated RAMP protein | |
| 1536 | MSKS01000011.1 | GCA001937445_00807 | CDS | open | 106528-108624 | _na 698_aa | Cas10/Cmr2 second palm domain-containing protein | |
| 1537 | MSKS01000011.1 | GCA001937445_00808 | CDS | open | 110467-111327 | _na 286_aa | hypothetical protein | |
| 1538 | MSKS01000011.1 | GCA001937445_00809 | CDS | open | 111388-112131 | _na 247_aa | hypothetical protein | |
| 1539 | MSKS01000011.1 | GCA001937445_00810 | CDS | open | 114632-115045 | _na 137_aa | hypothetical protein | |
| 1540 | MSKS01000011.1 | GCA001937445_00811 | CDS | open | 115035-115640 | _na 201_aa | DUF6036 domain-containing protein | |
| 1541 | MSKS01000011.1 | GCA001937445_00812 | CDS | open | 115651-115791 | _na 46_aa | hypothetical protein | |
| 1542 | MSKS01000011.1 | GCA001937445_00813 | CDS | open | 116916-118274 | _na 452_aa | NlpC/P60 domain-containing protein | |
| 1543 | MSKS01000011.1 | GCA001937445_00814 | CDS | open | 118453-119007 | _na 184_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 1544 | MSKS01000011.1 | GCA001937445_00815 | CDS | open | 119121-120341 | _na 406_aa | Zinc-dependent metalloprotease | |
| 1545 | MSKS01000011.1 | GCA001937445_00816 | CDS | open | 120423-121817 | _na 464_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 1546 | MSKS01000011.1 | GCA001937445_00817 | CDS | open | 122053-122553 | _na 166_aa | ppa | Inorganic pyrophosphatase |
| 1547 | MSKS01000011.1 | GCA001937445_00818 | CDS | open | 122757-124160 | _na 467_aa | NlpC/P60 family protein | |
| 1548 | MSKS01000011.1 | GCA001937445_00819 | CDS | open | 124984-126408 | _na 474_aa | O-acetylhomoserine aminocarboxypropyltransferase | |
| 1549 | MSKS01000011.1 | GCA001937445_00820 | CDS | open | 126420-127640 | _na 406_aa | Homoserine O-acetyltransferase | |
| 1550 | MSKS01000011.1 | GCA001937445_00821 | CDS | open | 128061-129005 | _na 314_aa | nmrA | NmrA family protein |
| 1551 | MSKS01000011.1 | GCA001937445_00822 | CDS | open | 129128-129493 | _na 121_aa | Transcriptional regulator | |
| 1552 | MSKS01000011.1 | GCA001937445_00823 | CDS | open | 129758-132373 | _na 871_aa | exo-alpha-sialidase | |
| 1553 | MSKS01000011.1 | GCA001937445_00824 | CDS | open | 132986-133240 | _na 84_aa | Txe/YoeB family addiction module toxin | |
| 1554 | MSKS01000011.1 | GCA001937445_00825 | CDS | open | 133240-133491 | _na 83_aa | Antitoxin | |
| 1555 | MSKS01000011.1 | GCA001937445_00826 | CDS | open | 133665-133988 | _na 107_aa | vapI | HigA family addiction module antitoxin |
| 1556 | MSKS01000011.1 | GCA001937445_00827 | CDS | open | 134501-135919 | _na 472_aa | nhaP | Na+/H+ antiporter |
| 1557 | MSKS01000011.1 | GCA001937445_00828 | CDS | open | 136287-137531 | _na 414_aa | HipA-like C-terminal domain protein | |
| 1558 | MSKS01000011.1 | GCA001937445_00829 | CDS | open | 137528-137815 | _na 95_aa | Helix-turn-helix domain-containing protein | |
| 1559 | MSKS01000011.1 | GCA001937445_00830 | CDS | open | 138286-138633 | _na 115_aa | DUF86 domain-containing protein | |
| 1560 | MSKS01000011.1 | GCA001937445_00831 | CDS | open | 138620-138916 | _na 98_aa | Nucleotidyltransferase | |
| 1561 | MSKS01000011.1 | GCA001937445_00832 | CDS | open | 139140-139439 | _na 99_aa | hypothetical protein | |
| 1562 | MSKS01000011.1 | GCA001937445_00718 | gene | open | 35-1723 | motB | ||
| 1563 | MSKS01000011.1 | GCA001937445_00719 | gene | open | 2025-2714 | rplA | ||
| 1564 | MSKS01000011.1 | GCA001937445_00720 | gene | open | 2812-3243 | rplK | ||
| 1565 | MSKS01000011.1 | GCA001937445_00721 | gene | open | 3503-4324 | nusG | ||
| 1566 | MSKS01000011.1 | GCA001937445_00722 | gene | open | 4460-4696 | secE | ||
| 1567 | MSKS01000011.1 | GCA001937445_00724 | gene | open | 5054-6268 | aspB | ||
| 1568 | MSKS01000011.1 | GCA001937445_00725 | gene | open | 6496-7506 | |||
| 1569 | MSKS01000011.1 | GCA001937445_00726 | gene | open | 7598-8845 | |||
| 1570 | MSKS01000011.1 | GCA001937445_00727 | gene | open | 9207-10160 | |||
| 1571 | MSKS01000011.1 | GCA001937445_00728 | gene | open | 10343-11428 | |||
| 1572 | MSKS01000011.1 | GCA001937445_00729 | gene | open | 11748-12965 | |||
| 1573 | MSKS01000011.1 | GCA001937445_00730 | gene | open | 13147-13245 | |||
| 1574 | MSKS01000011.1 | GCA001937445_00731 | gene | open | 13392-13634 | |||
| 1575 | MSKS01000011.1 | GCA001937445_00732 | gene | open | 13912-15534 | trkH | ||
| 1576 | MSKS01000011.1 | GCA001937445_00733 | gene | open | 15597-16367 | acrR | ||
| 1577 | MSKS01000011.1 | GCA001937445_00734 | gene | open | 16430-18025 | |||
| 1578 | MSKS01000011.1 | GCA001937445_00735 | gene | open | 18066-18734 | trkA | ||
| 1579 | MSKS01000011.1 | GCA001937445_00736 | gene | open | 18820-19641 | |||
| 1580 | MSKS01000011.1 | GCA001937445_00737 | gene | open | 19575-20000 | |||
| 1581 | MSKS01000011.1 | GCA001937445_00738 | gene | open | 19997-20656 | dhaL | ||
| 1582 | MSKS01000011.1 | GCA001937445_00739 | gene | open | 20724-21881 | dhaK | ||
| 1583 | MSKS01000011.1 | GCA001937445_00740 | gene | open | 22055-24244 | |||
| 1584 | MSKS01000011.1 | GCA001937445_00741 | gene | open | 24350-24853 | |||
| 1585 | MSKS01000011.1 | GCA001937445_00742 | gene | open | 24957-26426 | yqiK | ||
| 1586 | MSKS01000011.1 | GCA001937445_00743 | gene | open | 26620-28002 | |||
| 1587 | MSKS01000011.1 | GCA001937445_00744 | gene | open | 28214-30304 | tkt | ||
| 1588 | MSKS01000011.1 | GCA001937445_00745 | gene | open | 30446-31864 | radA | ||
| 1589 | MSKS01000011.1 | GCA001937445_00746 | gene | open | 32182-33249 | disA | ||
| 1590 | MSKS01000011.1 | GCA001937445_00747 | gene | open | 33308-34552 | |||
| 1591 | MSKS01000011.1 | GCA001937445_00748 | gene | open | 34720-35718 | |||
| 1592 | MSKS01000011.1 | GCA001937445_00749 | gene | open | 35838-36023 | |||
| 1593 | MSKS01000011.1 | GCA001937445_00750 | gene | open | 36478-37356 | |||
| 1594 | MSKS01000011.1 | GCA001937445_00751 | gene | open | 37482-37967 | |||
| 1595 | MSKS01000011.1 | GCA001937445_00752 | gene | open | 38107-38739 | |||
| 1596 | MSKS01000011.1 | GCA001937445_00753 | gene | open | 38867-40012 | |||
| 1597 | MSKS01000011.1 | GCA001937445_00754 | gene | open | 40390-42201 | glpA | ||
| 1598 | MSKS01000011.1 | GCA001937445_00755 | gene | open | 42373-43113 | glpF | ||
| 1599 | MSKS01000011.1 | GCA001937445_00756 | gene | open | 43175-44722 | glpK | ||
| 1600 | MSKS01000011.1 | GCA001937445_00757 | gene | open | 44957-47029 | |||
| 1601 | MSKS01000011.1 | GCA001937445_00758 | gene | open | 47307-49016 | lldP | ||
| 1602 | MSKS01000011.1 | GCA001937445_00759 | gene | open | 49454-49597 | |||
| 1603 | MSKS01000011.1 | GCA001937445_00760 | gene | open | 49933-50139 | |||
| 1604 | MSKS01000011.1 | GCA001937445_00761 | gene | open | 50620-51450 | glpC | ||
| 1605 | MSKS01000011.1 | GCA001937445_00762 | gene | open | 51447-53180 | lutB | ||
| 1606 | MSKS01000011.1 | GCA001937445_00763 | gene | open | 53180-53830 | |||
| 1607 | MSKS01000011.1 | GCA001937445_00764 | gene | open | 54049-55566 | |||
| 1608 | MSKS01000011.1 | GCA001937445_00765 | gene | open | 55852-57120 | lldD | ||
| 1609 | MSKS01000011.1 | GCA001937445_00766 | gene | open | 57411-57608 | |||
| 1610 | MSKS01000011.1 | GCA001937445_00767 | gene | open | 57879-59450 | |||
| 1611 | MSKS01000011.1 | GCA001937445_00768 | gene | open | 59626-60150 | padR | ||
| 1612 | MSKS01000011.1 | GCA001937445_00769 | gene | open | 60147-61004 | |||
| 1613 | MSKS01000011.1 | GCA001937445_00770 | gene | open | 61001-63214 | |||
| 1614 | MSKS01000011.1 | GCA001937445_00771 | gene | open | 63169-63348 | |||
| 1615 | MSKS01000011.1 | GCA001937445_00772 | gene | open | 63425-64162 | |||
| 1616 | MSKS01000011.1 | GCA001937445_00773 | gene | open | 64159-64710 | |||
| 1617 | MSKS01000011.1 | GCA001937445_00774 | gene | open | 64707-65300 | rloB | ||
| 1618 | MSKS01000011.1 | GCA001937445_00775 | gene | open | 65302-66603 | |||
| 1619 | MSKS01000011.1 | GCA001937445_00776 | gene | open | 66797-68470 | lysS | ||
| 1620 | MSKS01000011.1 | GCA001937445_00777 | gene | open | 68574-69773 | |||
| 1621 | MSKS01000011.1 | GCA001937445_00778 | gene | open | 69857-70288 | panD | ||
| 1622 | MSKS01000011.1 | GCA001937445_00779 | gene | open | 70620-71633 | panC | ||
| 1623 | MSKS01000011.1 | GCA001937445_00780 | gene | open | 71635-71874 | |||
| 1624 | MSKS01000011.1 | GCA001937445_00781 | gene | open | 72099-73085 | |||
| 1625 | MSKS01000011.1 | GCA001937445_00782 | gene | open | 73086-74840 | |||
| 1626 | MSKS01000011.1 | GCA001937445_00783 | gene | open | 74837-75406 | |||
| 1627 | MSKS01000011.1 | GCA001937445_00784 | gene | open | 75403-75903 | |||
| 1628 | MSKS01000011.1 | GCA001937445_00785 | gene | open | 75903-78623 | folK | ||
| 1629 | MSKS01000011.1 | GCA001937445_00786 | gene | open | 78620-79516 | folP | ||
| 1630 | MSKS01000011.1 | GCA001937445_00787 | gene | open | 79885-81036 | |||
| 1631 | MSKS01000011.1 | GCA001937445_00788 | gene | open | 81036-83510 | |||
| 1632 | MSKS01000011.1 | GCA001937445_00789 | gene | open | 83555-84229 | citB | ||
| 1633 | MSKS01000011.1 | GCA001937445_00790 | gene | open | 84271-85494 | |||
| 1634 | MSKS01000011.1 | GCA001937445_00791 | gene | open | 85979-86155 | |||
| 1635 | MSKS01000011.1 | GCA001937445_00792 | gene | open | 86942-87265 | qacE | ||
| 1636 | MSKS01000011.1 | GCA001937445_00793 | gene | open | 87262-87735 | ebrB | ||
| 1637 | MSKS01000011.1 | GCA001937445_00794 | gene | open | 87732-88142 | yvaD | ||
| 1638 | MSKS01000011.1 | GCA001937445_00795 | gene | open | 88179-88682 | |||
| 1639 | MSKS01000011.1 | GCA001937445_00796 | gene | open | 88861-89436 | |||
| 1640 | MSKS01000011.1 | GCA001937445_00797 | gene | open | 89695-90267 | folE | ||
| 1641 | MSKS01000011.1 | GCA001937445_00798 | gene | open | 90320-92392 | ftsH | ||
| 1642 | MSKS01000011.1 | GCA001937445_00799 | gene | open | 92589-93398 | |||
| 1643 | MSKS01000011.1 | GCA001937445_00800 | gene | open | 94284-95198 | |||
| 1644 | MSKS01000011.1 | GCA001937445_00801 | gene | open | 98457-99107 | |||
| 1645 | MSKS01000011.1 | GCA001937445_00802 | gene | open | 99146-99841 | cas2 | ||
| 1646 | MSKS01000011.1 | GCA001937445_00803 | gene | open | 99919-102219 | |||
| 1647 | MSKS01000011.1 | GCA001937445_00804 | gene | open | 102221-102790 | |||
| 1648 | MSKS01000011.1 | GCA001937445_00805 | gene | open | 102783-104612 | |||
| 1649 | MSKS01000011.1 | GCA001937445_00806 | gene | open | 104609-106531 | |||
| 1650 | MSKS01000011.1 | GCA001937445_00807 | gene | open | 106528-108624 | |||
| 1651 | MSKS01000011.1 | GCA001937445_00808 | gene | open | 110467-111327 | |||
| 1652 | MSKS01000011.1 | GCA001937445_00809 | gene | open | 111388-112131 | |||
| 1653 | MSKS01000011.1 | GCA001937445_00810 | gene | open | 114632-115045 | |||
| 1654 | MSKS01000011.1 | GCA001937445_00811 | gene | open | 115035-115640 | |||
| 1655 | MSKS01000011.1 | GCA001937445_00812 | gene | open | 115651-115791 | |||
| 1656 | MSKS01000011.1 | GCA001937445_00813 | gene | open | 116916-118274 | |||
| 1657 | MSKS01000011.1 | GCA001937445_00814 | gene | open | 118453-119007 | hpt | ||
| 1658 | MSKS01000011.1 | GCA001937445_00815 | gene | open | 119121-120341 | |||
| 1659 | MSKS01000011.1 | GCA001937445_00816 | gene | open | 120423-121817 | dacB | ||
| 1660 | MSKS01000011.1 | GCA001937445_00817 | gene | open | 122053-122553 | ppa | ||
| 1661 | MSKS01000011.1 | GCA001937445_00818 | gene | open | 122757-124160 | |||
| 1662 | MSKS01000011.1 | GCA001937445_00819 | gene | open | 124984-126408 | |||
| 1663 | MSKS01000011.1 | GCA001937445_00820 | gene | open | 126420-127640 | |||
| 1664 | MSKS01000011.1 | GCA001937445_00821 | gene | open | 128061-129005 | nmrA | ||
| 1665 | MSKS01000011.1 | GCA001937445_00822 | gene | open | 129128-129493 | |||
| 1666 | MSKS01000011.1 | GCA001937445_00823 | gene | open | 129758-132373 | |||
| 1667 | MSKS01000011.1 | GCA001937445_00824 | gene | open | 132986-133240 | |||
| 1668 | MSKS01000011.1 | GCA001937445_00825 | gene | open | 133240-133491 | |||
| 1669 | MSKS01000011.1 | GCA001937445_00826 | gene | open | 133665-133988 | vapI | ||
| 1670 | MSKS01000011.1 | GCA001937445_00827 | gene | open | 134501-135919 | nhaP | ||
| 1671 | MSKS01000011.1 | GCA001937445_00828 | gene | open | 136287-137531 | |||
| 1672 | MSKS01000011.1 | GCA001937445_00829 | gene | open | 137528-137815 | |||
| 1673 | MSKS01000011.1 | GCA001937445_00830 | gene | open | 138286-138633 | |||
| 1674 | MSKS01000011.1 | GCA001937445_00831 | gene | open | 138620-138916 | |||
| 1675 | MSKS01000011.1 | GCA001937445_00832 | gene | open | 139140-139439 | |||
| 1676 | MSKS01000011.1 | GCA001937445_00723 | gene | open | 4793-4865 | trnW | ||
| 1677 | MSKS01000011.1 | GCA001937445_00723 | tRNA | open | 4793-4865 | trnW | tRNA-Trp(cca) | |
| 1678 | MSKS01000012.1 | GCA001937445_00833 | CDS | open | 68-346 | _na 92_aa | Transposase | |
| 1679 | MSKS01000012.1 | GCA001937445_00834 | CDS | open | 630-1355 | _na 241_aa | hypothetical protein | |
| 1680 | MSKS01000012.1 | GCA001937445_00835 | CDS | open | 1417-1650 | _na 77_aa | hypothetical protein | |
| 1681 | MSKS01000012.1 | GCA001937445_00833 | gene | open | 68-346 | |||
| 1682 | MSKS01000012.1 | GCA001937445_00834 | gene | open | 630-1355 | |||
| 1683 | MSKS01000012.1 | GCA001937445_00835 | gene | open | 1417-1650 | |||
| 1684 | MSKS01000013.1 | repeat_region | open | 129770-129992 | CRISPR array with 4 repeats of length 28%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 33 | |||
| 1685 | MSKS01000013.1 | GCA001937445_00836 | CDS | open | 106-1764 | _na 552_aa | ATP-dependent helicase | |
| 1686 | MSKS01000013.1 | GCA001937445_00837 | CDS | open | 1795-2784 | _na 329_aa | Cyclodehydratase | |
| 1687 | MSKS01000013.1 | GCA001937445_00838 | CDS | open | 2954-4201 | _na 415_aa | endopeptidase La | |
| 1688 | MSKS01000013.1 | GCA001937445_00839 | CDS | open | 4442-6007 | _na 521_aa | Zinc-dependent metalloprotease | |
| 1689 | MSKS01000013.1 | GCA001937445_00840 | CDS | open | 6085-6666 | _na 193_aa | DUF2017 domain-containing protein | |
| 1690 | MSKS01000013.1 | GCA001937445_00841 | CDS | open | 6901-10083 | _na 1060_aa | UPF0182 protein HMPREF0059_00283 | |
| 1691 | MSKS01000013.1 | GCA001937445_00843 | CDS | open | 11355-11573 | _na 72_aa | Resolvase/invertase-type recombinase catalytic domain-containing protein | |
| 1692 | MSKS01000013.1 | GCA001937445_00844 | CDS | open | 11570-13225 | _na 551_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 1693 | MSKS01000013.1 | GCA001937445_00845 | CDS | open | 13877-14752 | _na 291_aa | ppk2 | polyphosphate kinase 2 |
| 1694 | MSKS01000013.1 | GCA001937445_00846 | CDS | open | 14749-15504 | _na 251_aa | NAD-dependent protein deacylase | |
| 1695 | MSKS01000013.1 | GCA001937445_00847 | CDS | open | 15515-15940 | _na 141_aa | GtrA-like protein domain-containing protein | |
| 1696 | MSKS01000013.1 | GCA001937445_00848 | CDS | open | 16233-16448 | _na 71_aa | ATP-binding protein | |
| 1697 | MSKS01000013.1 | GCA001937445_00849 | CDS | open | 16691-20338 | _na 1215_aa | DNA 3'-5' helicase | |
| 1698 | MSKS01000013.1 | GCA001937445_00850 | CDS | open | 20335-23763 | _na 1142_aa | DNA 3'-5' helicase | |
| 1699 | MSKS01000013.1 | GCA001937445_00851 | CDS | open | 23786-25114 | _na 442_aa | ycbJ | Phosphotransferase enzyme family protein |
| 1700 | MSKS01000013.1 | GCA001937445_00852 | CDS | open | 25400-26650 | _na 416_aa | tadA | Bacterial type II secretion system protein E domain-containing protein |
| 1701 | MSKS01000013.1 | GCA001937445_00853 | CDS | open | 26650-27501 | _na 283_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 1702 | MSKS01000013.1 | GCA001937445_00854 | CDS | open | 27498-28451 | _na 317_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 1703 | MSKS01000013.1 | GCA001937445_00855 | CDS | open | 28539-28769 | _na 76_aa | DUF4244 domain-containing protein | |
| 1704 | MSKS01000013.1 | GCA001937445_00856 | CDS | open | 28882-29232 | _na 116_aa | TadE/TadG family type IV pilus assembly protein | |
| 1705 | MSKS01000013.1 | GCA001937445_00857 | CDS | open | 29389-29802 | _na 137_aa | Pilus assembly protein | |
| 1706 | MSKS01000013.1 | GCA001937445_00858 | CDS | open | 29799-30305 | _na 168_aa | Glycosyltransferase | |
| 1707 | MSKS01000013.1 | GCA001937445_00859 | CDS | open | 30375-30773 | _na 132_aa | Cyclic nucleotide-binding protein | |
| 1708 | MSKS01000013.1 | GCA001937445_00860 | CDS | open | 30804-31715 | _na 303_aa | lysR | HTH lysR-type domain-containing protein |
| 1709 | MSKS01000013.1 | GCA001937445_00861 | CDS | open | 31815-32936 | _na 373_aa | prfB | peptide chain release factor 2 |
| 1710 | MSKS01000013.1 | GCA001937445_00862 | CDS | open | 33180-34019 | _na 279_aa | CAAX protease family protein | |
| 1711 | MSKS01000013.1 | GCA001937445_00863 | CDS | open | 33958-34509 | _na 183_aa | Methylated-DNA--[protein]-cysteine S-methyltransferase | |
| 1712 | MSKS01000013.1 | GCA001937445_00864 | CDS | open | 34736-36418 | _na 560_aa | ettA | energy-dependent translational throttle protein EttA |
| 1713 | MSKS01000013.1 | GCA001937445_00865 | CDS | open | 36564-37268 | _na 234_aa | Peptidase M23 domain-containing protein | |
| 1714 | MSKS01000013.1 | GCA001937445_00866 | CDS | open | 37283-37477 | _na 64_aa | hypothetical protein | |
| 1715 | MSKS01000013.1 | GCA001937445_00867 | CDS | open | 37610-38590 | _na 326_aa | tesB | Acyl-CoA thioesterase II |
| 1716 | MSKS01000013.1 | GCA001937445_00868 | CDS | open | 38587-40284 | _na 565_aa | ptsA | Phosphoenolpyruvate-protein phosphotransferase |
| 1717 | MSKS01000013.1 | GCA001937445_00869 | CDS | open | 40661-40888 | _na 75_aa | PTS glucose/sucrose transporter subunit IIB | |
| 1718 | MSKS01000013.1 | GCA001937445_00870 | CDS | open | 41325-43538 | _na 737_aa | malQ | 4-alpha-glucanotransferase |
| 1719 | MSKS01000013.1 | GCA001937445_00871 | CDS | open | 43682-44143 | _na 153_aa | PTS glucose transporter subunit IIA | |
| 1720 | MSKS01000013.1 | GCA001937445_00872 | CDS | open | 44140-44370 | _na 76_aa | PTS EIIB type-1 domain-containing protein | |
| 1721 | MSKS01000013.1 | GCA001937445_00873 | CDS | open | 44564-45307 | _na 247_aa | mngR | HTH gntR-type domain-containing protein |
| 1722 | MSKS01000013.1 | GCA001937445_00874 | CDS | open | 45568-46446 | _na 292_aa | ptsG1 | PTS EIIC type-1 domain-containing protein |
| 1723 | MSKS01000013.1 | GCA001937445_00875 | CDS | open | 46388-47026 | _na 212_aa | PTS transporter subunit EIIC | |
| 1724 | MSKS01000013.1 | GCA001937445_00876 | CDS | open | 47147-49747 | _na 866_aa | pepN | aminopeptidase N |
| 1725 | MSKS01000013.1 | GCA001937445_00877 | CDS | open | 49941-51278 | _na 445_aa | Peptidase | |
| 1726 | MSKS01000013.1 | GCA001937445_00878 | CDS | open | 51504-52607 | _na 367_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 1727 | MSKS01000013.1 | GCA001937445_00879 | CDS | open | 52765-53727 | _na 320_aa | Peptidase | |
| 1728 | MSKS01000013.1 | GCA001937445_00880 | CDS | open | 53936-56128 | _na 730_aa | M13-type metalloendopeptidase | |
| 1729 | MSKS01000013.1 | GCA001937445_00881 | CDS | open | 56218-56724 | _na 168_aa | ribose-5-phosphate isomerase | |
| 1730 | MSKS01000013.1 | GCA001937445_00882 | CDS | open | 56727-57728 | _na 333_aa | nei | DNA-(apurinic or apyrimidinic site) lyase |
| 1731 | MSKS01000013.1 | GCA001937445_00883 | CDS | open | 57769-59067 | _na 432_aa | AB hydrolase-1 domain-containing protein | |
| 1732 | MSKS01000013.1 | GCA001937445_00884 | CDS | open | 59142-59717 | _na 191_aa | cysE | serine O-acetyltransferase |
| 1733 | MSKS01000013.1 | GCA001937445_00885 | CDS | open | 59844-60773 | _na 309_aa | cysK | cysteine synthase A |
| 1734 | MSKS01000013.1 | GCA001937445_00886 | CDS | open | 61015-61107 | _na 30_aa | hypothetical protein | |
| 1735 | MSKS01000013.1 | GCA001937445_00887 | CDS | open | 61335-62123 | _na 262_aa | Impact N-terminal domain-containing protein | |
| 1736 | MSKS01000013.1 | GCA001937445_00888 | CDS | open | 62279-62443 | _na 54_aa | rpmF | 50S ribosomal protein L32 |
| 1737 | MSKS01000013.1 | GCA001937445_00891 | CDS | open | 62951-64315 | _na 454_aa | tig | trigger factor |
| 1738 | MSKS01000013.1 | GCA001937445_00892 | CDS | open | 64491-65624 | _na 377_aa | bcsA | Glycosyltransferase 2-like domain-containing protein |
| 1739 | MSKS01000013.1 | GCA001937445_00893 | CDS | open | 66202-66570 | _na 122_aa | Cupin type-2 domain-containing protein | |
| 1740 | MSKS01000013.1 | GCA001937445_00894 | CDS | open | 66898-67536 | _na 212_aa | clpP | ATP-dependent Clp protease proteolytic subunit |
| 1741 | MSKS01000013.1 | GCA001937445_00895 | CDS | open | 67538-68212 | _na 224_aa | clpP | ATP-dependent Clp protease proteolytic subunit |
| 1742 | MSKS01000013.1 | GCA001937445_00896 | CDS | open | 68446-69768 | _na 440_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 1743 | MSKS01000013.1 | GCA001937445_00897 | CDS | open | 69765-70097 | _na 110_aa | chorismate mutase | |
| 1744 | MSKS01000013.1 | GCA001937445_00898 | CDS | open | 70226-72127 | _na 633_aa | fAA1 | Acyl-CoA synthetase |
| 1745 | MSKS01000013.1 | GCA001937445_00899 | CDS | open | 72175-74004 | _na 609_aa | fAA1 | Acyl-CoA synthetase |
| 1746 | MSKS01000013.1 | GCA001937445_00900 | CDS | open | 74377-75669 | _na 430_aa | Tat (Twin-arginine translocation) pathway signal sequence | |
| 1747 | MSKS01000013.1 | GCA001937445_00901 | CDS | open | 75775-76812 | _na 345_aa | ugpA | ABC transmembrane type-1 domain-containing protein |
| 1748 | MSKS01000013.1 | GCA001937445_00902 | CDS | open | 76809-77675 | _na 288_aa | ugpE | ABC transmembrane type-1 domain-containing protein |
| 1749 | MSKS01000013.1 | GCA001937445_00903 | CDS | open | 77867-79651 | _na 594_aa | Alpha-amylase | |
| 1750 | MSKS01000013.1 | GCA001937445_00904 | CDS | open | 79632-80645 | _na 337_aa | lacI | Bacterial regulatory protein%2C LacI family |
| 1751 | MSKS01000013.1 | GCA001937445_00905 | CDS | open | 80725-81645 | _na 306_aa | Tat pathway signal sequence domain protein | |
| 1752 | MSKS01000013.1 | GCA001937445_00906 | CDS | open | 81744-84560 | _na 938_aa | valS | valine--tRNA ligase |
| 1753 | MSKS01000013.1 | GCA001937445_00907 | CDS | open | 84753-86402 | _na 549_aa | arc | proteasome ATPase |
| 1754 | MSKS01000013.1 | GCA001937445_00908 | CDS | open | 86408-88183 | _na 591_aa | pafA2 | Proteasome accessory factor PafA2 |
| 1755 | MSKS01000013.1 | GCA001937445_00909 | CDS | open | 88180-88368 | _na 62_aa | Prokaryotic ubiquitin-like protein Pup | |
| 1756 | MSKS01000013.1 | GCA001937445_00910 | CDS | open | 88365-89909 | _na 514_aa | Proteasome protein | |
| 1757 | MSKS01000013.1 | GCA001937445_00911 | CDS | open | 90110-90760 | _na 216_aa | Permease | |
| 1758 | MSKS01000013.1 | GCA001937445_00912 | CDS | open | 90763-91599 | _na 278_aa | Cobalt transporter | |
| 1759 | MSKS01000013.1 | GCA001937445_00913 | CDS | open | 91602-93077 | _na 491_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 1760 | MSKS01000013.1 | GCA001937445_00914 | CDS | open | 93239-93874 | _na 211_aa | ABC transporter permease | |
| 1761 | MSKS01000013.1 | GCA001937445_00915 | CDS | open | 93867-96353 | _na 828_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 1762 | MSKS01000013.1 | GCA001937445_00916 | CDS | open | 96364-98259 | _na 631_aa | ABC transporter ATP-binding protein | |
| 1763 | MSKS01000013.1 | GCA001937445_00917 | CDS | open | 98262-100001 | _na 579_aa | mdlB | ABC transporter ATP-binding protein |
| 1764 | MSKS01000013.1 | GCA001937445_00918 | CDS | open | 100220-101173 | _na 317_aa | rbbA | ABC transporter domain-containing protein |
| 1765 | MSKS01000013.1 | GCA001937445_00919 | CDS | open | 101291-102100 | _na 269_aa | ABC transporter | |
| 1766 | MSKS01000013.1 | GCA001937445_00920 | CDS | open | 102157-102999 | _na 280_aa | tetR | TetR family transcriptional regulator |
| 1767 | MSKS01000013.1 | GCA001937445_00921 | CDS | open | 103104-103790 | _na 228_aa | sirB | Sirohydrochlorin cobaltochelatase |
| 1768 | MSKS01000013.1 | GCA001937445_00922 | CDS | open | 103787-104830 | _na 347_aa | putative membrane transporter protein | |
| 1769 | MSKS01000013.1 | GCA001937445_00923 | CDS | open | 104873-105682 | _na 269_aa | uroporphyrinogen-III C-methyltransferase | |
| 1770 | MSKS01000013.1 | GCA001937445_00924 | CDS | open | 105686-107044 | _na 452_aa | cysN | sulfate adenylyltransferase |
| 1771 | MSKS01000013.1 | GCA001937445_00925 | CDS | open | 107044-108048 | _na 334_aa | cysD | sulfate adenylyltransferase subunit CysD |
| 1772 | MSKS01000013.1 | GCA001937445_00926 | CDS | open | 108045-108836 | _na 263_aa | cysH | phosphoadenylyl-sulfate reductase |
| 1773 | MSKS01000013.1 | GCA001937445_00927 | CDS | open | 108833-110536 | _na 567_aa | cysI | assimilatory sulfite reductase (ferredoxin) |
| 1774 | MSKS01000013.1 | GCA001937445_00928 | CDS | open | 111003-111827 | _na 274_aa | proC | pyrroline-5-carboxylate reductase |
| 1775 | MSKS01000013.1 | GCA001937445_00929 | CDS | open | 111916-113283 | _na 455_aa | yuiF | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein |
| 1776 | MSKS01000013.1 | GCA001937445_00930 | CDS | open | 113399-114181 | _na 260_aa | ydfG | Oxidoreductase |
| 1777 | MSKS01000013.1 | GCA001937445_00931 | CDS | open | 114300-115142 | _na 280_aa | Translation initiation factor IF-2 | |
| 1778 | MSKS01000013.1 | GCA001937445_00932 | CDS | open | 115302-116249 | _na 315_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 1779 | MSKS01000013.1 | GCA001937445_00933 | CDS | open | 116731-120102 | _na 1123_aa | ileS | isoleucine--tRNA ligase |
| 1780 | MSKS01000013.1 | GCA001937445_00934 | CDS | open | 120518-123469 | _na 983_aa | HD Cas3-type domain-containing protein | |
| 1781 | MSKS01000013.1 | GCA001937445_00935 | CDS | open | 123466-125133 | _na 555_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 1782 | MSKS01000013.1 | GCA001937445_00936 | CDS | open | 125130-125858 | _na 242_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 1783 | MSKS01000013.1 | GCA001937445_00937 | CDS | open | 125861-126988 | _na 375_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 1784 | MSKS01000013.1 | GCA001937445_00938 | CDS | open | 126988-127704 | _na 238_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 1785 | MSKS01000013.1 | GCA001937445_00939 | CDS | open | 127695-128243 | _na 182_aa | type I-E CRISPR-associated protein Cas6/Cse3/CasE | |
| 1786 | MSKS01000013.1 | GCA001937445_00940 | CDS | open | 128240-128383 | _na 47_aa | hypothetical protein | |
| 1787 | MSKS01000013.1 | GCA001937445_00941 | CDS | open | 128389-129327 | _na 312_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 1788 | MSKS01000013.1 | GCA001937445_00836 | gene | open | 106-1764 | |||
| 1789 | MSKS01000013.1 | GCA001937445_00837 | gene | open | 1795-2784 | |||
| 1790 | MSKS01000013.1 | GCA001937445_00838 | gene | open | 2954-4201 | |||
| 1791 | MSKS01000013.1 | GCA001937445_00839 | gene | open | 4442-6007 | |||
| 1792 | MSKS01000013.1 | GCA001937445_00840 | gene | open | 6085-6666 | |||
| 1793 | MSKS01000013.1 | GCA001937445_00841 | gene | open | 6901-10083 | |||
| 1794 | MSKS01000013.1 | GCA001937445_00843 | gene | open | 11355-11573 | |||
| 1795 | MSKS01000013.1 | GCA001937445_00844 | gene | open | 11570-13225 | |||
| 1796 | MSKS01000013.1 | GCA001937445_00845 | gene | open | 13877-14752 | ppk2 | ||
| 1797 | MSKS01000013.1 | GCA001937445_00846 | gene | open | 14749-15504 | |||
| 1798 | MSKS01000013.1 | GCA001937445_00847 | gene | open | 15515-15940 | |||
| 1799 | MSKS01000013.1 | GCA001937445_00848 | gene | open | 16233-16448 | |||
| 1800 | MSKS01000013.1 | GCA001937445_00849 | gene | open | 16691-20338 | |||
| 1801 | MSKS01000013.1 | GCA001937445_00850 | gene | open | 20335-23763 | |||
| 1802 | MSKS01000013.1 | GCA001937445_00851 | gene | open | 23786-25114 | ycbJ | ||
| 1803 | MSKS01000013.1 | GCA001937445_00852 | gene | open | 25400-26650 | tadA | ||
| 1804 | MSKS01000013.1 | GCA001937445_00853 | gene | open | 26650-27501 | gspF | ||
| 1805 | MSKS01000013.1 | GCA001937445_00854 | gene | open | 27498-28451 | gspF | ||
| 1806 | MSKS01000013.1 | GCA001937445_00855 | gene | open | 28539-28769 | |||
| 1807 | MSKS01000013.1 | GCA001937445_00856 | gene | open | 28882-29232 | |||
| 1808 | MSKS01000013.1 | GCA001937445_00857 | gene | open | 29389-29802 | |||
| 1809 | MSKS01000013.1 | GCA001937445_00858 | gene | open | 29799-30305 | |||
| 1810 | MSKS01000013.1 | GCA001937445_00859 | gene | open | 30375-30773 | |||
| 1811 | MSKS01000013.1 | GCA001937445_00860 | gene | open | 30804-31715 | lysR | ||
| 1812 | MSKS01000013.1 | GCA001937445_00861 | gene | open | 31815-32936 | prfB | ||
| 1813 | MSKS01000013.1 | GCA001937445_00862 | gene | open | 33180-34019 | |||
| 1814 | MSKS01000013.1 | GCA001937445_00863 | gene | open | 33958-34509 | |||
| 1815 | MSKS01000013.1 | GCA001937445_00864 | gene | open | 34736-36418 | ettA | ||
| 1816 | MSKS01000013.1 | GCA001937445_00865 | gene | open | 36564-37268 | |||
| 1817 | MSKS01000013.1 | GCA001937445_00866 | gene | open | 37283-37477 | |||
| 1818 | MSKS01000013.1 | GCA001937445_00867 | gene | open | 37610-38590 | tesB | ||
| 1819 | MSKS01000013.1 | GCA001937445_00868 | gene | open | 38587-40284 | ptsA | ||
| 1820 | MSKS01000013.1 | GCA001937445_00869 | gene | open | 40661-40888 | |||
| 1821 | MSKS01000013.1 | GCA001937445_00870 | gene | open | 41325-43538 | malQ | ||
| 1822 | MSKS01000013.1 | GCA001937445_00871 | gene | open | 43682-44143 | |||
| 1823 | MSKS01000013.1 | GCA001937445_00872 | gene | open | 44140-44370 | |||
| 1824 | MSKS01000013.1 | GCA001937445_00873 | gene | open | 44564-45307 | mngR | ||
| 1825 | MSKS01000013.1 | GCA001937445_00874 | gene | open | 45568-46446 | ptsG1 | ||
| 1826 | MSKS01000013.1 | GCA001937445_00875 | gene | open | 46388-47026 | |||
| 1827 | MSKS01000013.1 | GCA001937445_00876 | gene | open | 47147-49747 | pepN | ||
| 1828 | MSKS01000013.1 | GCA001937445_00877 | gene | open | 49941-51278 | |||
| 1829 | MSKS01000013.1 | GCA001937445_00878 | gene | open | 51504-52607 | |||
| 1830 | MSKS01000013.1 | GCA001937445_00879 | gene | open | 52765-53727 | |||
| 1831 | MSKS01000013.1 | GCA001937445_00880 | gene | open | 53936-56128 | |||
| 1832 | MSKS01000013.1 | GCA001937445_00881 | gene | open | 56218-56724 | |||
| 1833 | MSKS01000013.1 | GCA001937445_00882 | gene | open | 56727-57728 | nei | ||
| 1834 | MSKS01000013.1 | GCA001937445_00883 | gene | open | 57769-59067 | |||
| 1835 | MSKS01000013.1 | GCA001937445_00884 | gene | open | 59142-59717 | cysE | ||
| 1836 | MSKS01000013.1 | GCA001937445_00885 | gene | open | 59844-60773 | cysK | ||
| 1837 | MSKS01000013.1 | GCA001937445_00886 | gene | open | 61015-61107 | |||
| 1838 | MSKS01000013.1 | GCA001937445_00887 | gene | open | 61335-62123 | |||
| 1839 | MSKS01000013.1 | GCA001937445_00888 | gene | open | 62279-62443 | rpmF | ||
| 1840 | MSKS01000013.1 | GCA001937445_00891 | gene | open | 62951-64315 | tig | ||
| 1841 | MSKS01000013.1 | GCA001937445_00892 | gene | open | 64491-65624 | bcsA | ||
| 1842 | MSKS01000013.1 | GCA001937445_00893 | gene | open | 66202-66570 | |||
| 1843 | MSKS01000013.1 | GCA001937445_00894 | gene | open | 66898-67536 | clpP | ||
| 1844 | MSKS01000013.1 | GCA001937445_00895 | gene | open | 67538-68212 | clpP | ||
| 1845 | MSKS01000013.1 | GCA001937445_00896 | gene | open | 68446-69768 | clpX | ||
| 1846 | MSKS01000013.1 | GCA001937445_00897 | gene | open | 69765-70097 | |||
| 1847 | MSKS01000013.1 | GCA001937445_00898 | gene | open | 70226-72127 | fAA1 | ||
| 1848 | MSKS01000013.1 | GCA001937445_00899 | gene | open | 72175-74004 | fAA1 | ||
| 1849 | MSKS01000013.1 | GCA001937445_00900 | gene | open | 74377-75669 | |||
| 1850 | MSKS01000013.1 | GCA001937445_00901 | gene | open | 75775-76812 | ugpA | ||
| 1851 | MSKS01000013.1 | GCA001937445_00902 | gene | open | 76809-77675 | ugpE | ||
| 1852 | MSKS01000013.1 | GCA001937445_00903 | gene | open | 77867-79651 | |||
| 1853 | MSKS01000013.1 | GCA001937445_00904 | gene | open | 79632-80645 | lacI | ||
| 1854 | MSKS01000013.1 | GCA001937445_00905 | gene | open | 80725-81645 | |||
| 1855 | MSKS01000013.1 | GCA001937445_00906 | gene | open | 81744-84560 | valS | ||
| 1856 | MSKS01000013.1 | GCA001937445_00907 | gene | open | 84753-86402 | arc | ||
| 1857 | MSKS01000013.1 | GCA001937445_00908 | gene | open | 86408-88183 | pafA2 | ||
| 1858 | MSKS01000013.1 | GCA001937445_00909 | gene | open | 88180-88368 | |||
| 1859 | MSKS01000013.1 | GCA001937445_00910 | gene | open | 88365-89909 | |||
| 1860 | MSKS01000013.1 | GCA001937445_00911 | gene | open | 90110-90760 | |||
| 1861 | MSKS01000013.1 | GCA001937445_00912 | gene | open | 90763-91599 | |||
| 1862 | MSKS01000013.1 | GCA001937445_00913 | gene | open | 91602-93077 | ccmA | ||
| 1863 | MSKS01000013.1 | GCA001937445_00914 | gene | open | 93239-93874 | |||
| 1864 | MSKS01000013.1 | GCA001937445_00915 | gene | open | 93867-96353 | ccmA | ||
| 1865 | MSKS01000013.1 | GCA001937445_00916 | gene | open | 96364-98259 | |||
| 1866 | MSKS01000013.1 | GCA001937445_00917 | gene | open | 98262-100001 | mdlB | ||
| 1867 | MSKS01000013.1 | GCA001937445_00918 | gene | open | 100220-101173 | rbbA | ||
| 1868 | MSKS01000013.1 | GCA001937445_00919 | gene | open | 101291-102100 | |||
| 1869 | MSKS01000013.1 | GCA001937445_00920 | gene | open | 102157-102999 | tetR | ||
| 1870 | MSKS01000013.1 | GCA001937445_00921 | gene | open | 103104-103790 | sirB | ||
| 1871 | MSKS01000013.1 | GCA001937445_00922 | gene | open | 103787-104830 | |||
| 1872 | MSKS01000013.1 | GCA001937445_00923 | gene | open | 104873-105682 | |||
| 1873 | MSKS01000013.1 | GCA001937445_00924 | gene | open | 105686-107044 | cysN | ||
| 1874 | MSKS01000013.1 | GCA001937445_00925 | gene | open | 107044-108048 | cysD | ||
| 1875 | MSKS01000013.1 | GCA001937445_00926 | gene | open | 108045-108836 | cysH | ||
| 1876 | MSKS01000013.1 | GCA001937445_00927 | gene | open | 108833-110536 | cysI | ||
| 1877 | MSKS01000013.1 | GCA001937445_00928 | gene | open | 111003-111827 | proC | ||
| 1878 | MSKS01000013.1 | GCA001937445_00929 | gene | open | 111916-113283 | yuiF | ||
| 1879 | MSKS01000013.1 | GCA001937445_00930 | gene | open | 113399-114181 | ydfG | ||
| 1880 | MSKS01000013.1 | GCA001937445_00931 | gene | open | 114300-115142 | |||
| 1881 | MSKS01000013.1 | GCA001937445_00932 | gene | open | 115302-116249 | pdxI | ||
| 1882 | MSKS01000013.1 | GCA001937445_00933 | gene | open | 116731-120102 | ileS | ||
| 1883 | MSKS01000013.1 | GCA001937445_00934 | gene | open | 120518-123469 | |||
| 1884 | MSKS01000013.1 | GCA001937445_00935 | gene | open | 123466-125133 | casA | ||
| 1885 | MSKS01000013.1 | GCA001937445_00936 | gene | open | 125130-125858 | casB | ||
| 1886 | MSKS01000013.1 | GCA001937445_00937 | gene | open | 125861-126988 | cas7e | ||
| 1887 | MSKS01000013.1 | GCA001937445_00938 | gene | open | 126988-127704 | cas5e | ||
| 1888 | MSKS01000013.1 | GCA001937445_00939 | gene | open | 127695-128243 | |||
| 1889 | MSKS01000013.1 | GCA001937445_00940 | gene | open | 128240-128383 | |||
| 1890 | MSKS01000013.1 | GCA001937445_00941 | gene | open | 128389-129327 | cas1e | ||
| 1891 | MSKS01000013.1 | GCA001937445_00842 | gene | open | 10203-10279 | trnfM | ||
| 1892 | MSKS01000013.1 | GCA001937445_00889 | gene | open | 62478-62548 | trnG | ||
| 1893 | MSKS01000013.1 | GCA001937445_00890 | gene | open | 62597-62670 | trnP | ||
| 1894 | MSKS01000013.1 | GCA001937445_00842 | tRNA | open | 10203-10279 | trnfM | tRNA-fMet(cat) | |
| 1895 | MSKS01000013.1 | GCA001937445_00889 | tRNA | open | 62478-62548 | trnG | tRNA-Gly(tcc) | |
| 1896 | MSKS01000013.1 | GCA001937445_00890 | tRNA | open | 62597-62670 | trnP | tRNA-Pro(tgg) | |
| 1897 | MSKS01000014.1 | GCA001937445_00964 | gene | open | 28280-28389 | Actinomyces-1 | ||
| 1898 | MSKS01000014.1 | GCA001937445_00964 | ncRNA | open | 28280-28389 | Actinomyces-1 RNA | ||
| 1899 | MSKS01000014.1 | GCA001937445_00942 | CDS | open | 106-573 | _na 155_aa | hypothetical protein | |
| 1900 | MSKS01000014.1 | GCA001937445_00943 | CDS | open | 563-1300 | _na 245_aa | Nitroreductase domain-containing protein | |
| 1901 | MSKS01000014.1 | GCA001937445_00944 | CDS | open | 1508-1711 | _na 67_aa | Thiocillin family RiPP | |
| 1902 | MSKS01000014.1 | GCA001937445_00945 | CDS | open | 1807-3045 | _na 412_aa | pqqD | PqqD family protein |
| 1903 | MSKS01000014.1 | GCA001937445_00946 | CDS | open | 3042-5684 | _na 880_aa | DUF222 domain-containing protein | |
| 1904 | MSKS01000014.1 | GCA001937445_00947 | CDS | open | 5681-6907 | _na 408_aa | Thiopeptide-type bacteriocin biosynthesis domain protein | |
| 1905 | MSKS01000014.1 | GCA001937445_00948 | CDS | open | 7528-8982 | _na 484_aa | purB | adenylosuccinate lyase |
| 1906 | MSKS01000014.1 | GCA001937445_00949 | CDS | open | 8979-9389 | _na 136_aa | Amino acid permease | |
| 1907 | MSKS01000014.1 | GCA001937445_00950 | CDS | open | 9626-10066 | _na 146_aa | GNAT family N-acetyltransferase | |
| 1908 | MSKS01000014.1 | GCA001937445_00951 | CDS | open | 10449-10712 | _na 87_aa | Nucleotidyltransferase | |
| 1909 | MSKS01000014.1 | GCA001937445_00952 | CDS | open | 10709-11098 | _na 129_aa | Antitoxin | |
| 1910 | MSKS01000014.1 | GCA001937445_00953 | CDS | open | 11105-11476 | _na 123_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 1911 | MSKS01000014.1 | GCA001937445_00954 | CDS | open | 11584-12348 | _na 254_aa | FAD-binding FR-type domain-containing protein | |
| 1912 | MSKS01000014.1 | GCA001937445_00955 | CDS | open | 12545-13639 | _na 364_aa | dcm | Cytosine-specific methyltransferase |
| 1913 | MSKS01000014.1 | GCA001937445_00956 | CDS | open | 13785-16616 | _na 943_aa | DUF1156 domain-containing protein | |
| 1914 | MSKS01000014.1 | GCA001937445_00957 | CDS | open | 16618-20031 | _na 1137_aa | Swt1-like HEPN domain-containing protein | |
| 1915 | MSKS01000014.1 | GCA001937445_00958 | CDS | open | 20034-21542 | _na 502_aa | mutL | Histidine kinase/HSP90-like ATPase domain-containing protein |
| 1916 | MSKS01000014.1 | GCA001937445_00959 | CDS | open | 21546-22538 | _na 330_aa | PD-(D/E)XK motif protein | |
| 1917 | MSKS01000014.1 | GCA001937445_00960 | CDS | open | 22542-25556 | _na 1004_aa | Putative endonuclease Z1 domain-containing protein | |
| 1918 | MSKS01000014.1 | GCA001937445_00961 | CDS | open | 25648-26028 | _na 126_aa | DNA mismatch endonuclease Vsr | |
| 1919 | MSKS01000014.1 | GCA001937445_00962 | CDS | open | 26041-27345 | _na 434_aa | Aminopeptidase | |
| 1920 | MSKS01000014.1 | GCA001937445_00963 | CDS | open | 27447-28118 | _na 223_aa | Class I SAM-dependent methyltransferase | |
| 1921 | MSKS01000014.1 | GCA001937445_00965 | CDS | open | 28661-28882 | _na 73_aa | hypothetical protein | |
| 1922 | MSKS01000014.1 | GCA001937445_00966 | CDS | open | 28900-30843 | _na 647_aa | AB hydrolase-1 domain-containing protein | |
| 1923 | MSKS01000014.1 | GCA001937445_00967 | CDS | open | 30976-31383 | _na 135_aa | Phage holin family protein | |
| 1924 | MSKS01000014.1 | GCA001937445_00968 | CDS | open | 31430-32587 | _na 385_aa | hisC | histidinol-phosphate transaminase |
| 1925 | MSKS01000014.1 | GCA001937445_00969 | CDS | open | 32650-33561 | _na 303_aa | YwiC-like protein | |
| 1926 | MSKS01000014.1 | GCA001937445_00970 | CDS | open | 34034-35293 | _na 419_aa | Triacylglycerol lipase | |
| 1927 | MSKS01000014.1 | GCA001937445_00971 | CDS | open | 35648-37330 | _na 560_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 1928 | MSKS01000014.1 | GCA001937445_00972 | CDS | open | 37553-38605 | _na 350_aa | hypothetical protein | |
| 1929 | MSKS01000014.1 | GCA001937445_00973 | CDS | open | 38805-39203 | _na 132_aa | ridA | Enamine/imine deaminase |
| 1930 | MSKS01000014.1 | GCA001937445_00974 | CDS | open | 39392-40411 | _na 339_aa | DUF5129 domain-containing protein | |
| 1931 | MSKS01000014.1 | GCA001937445_00975 | CDS | open | 40461-42086 | _na 541_aa | DUF5129 domain-containing protein | |
| 1932 | MSKS01000014.1 | GCA001937445_00976 | CDS | open | 42240-43130 | _na 296_aa | DUF5926 domain-containing protein | |
| 1933 | MSKS01000014.1 | GCA001937445_00977 | CDS | open | 43258-43869 | _na 203_aa | Flavodoxin-like fold domain-containing protein | |
| 1934 | MSKS01000014.1 | GCA001937445_00978 | CDS | open | 43869-44426 | _na 185_aa | acrR | HTH tetR-type domain-containing protein |
| 1935 | MSKS01000014.1 | GCA001937445_00979 | CDS | open | 44715-45374 | _na 219_aa | HTH tetR-type domain-containing protein | |
| 1936 | MSKS01000014.1 | GCA001937445_00980 | CDS | open | 45481-46449 | _na 322_aa | DUF4162 domain-containing protein | |
| 1937 | MSKS01000014.1 | GCA001937445_00981 | CDS | open | 46446-47585 | _na 379_aa | ABC transporter permease | |
| 1938 | MSKS01000014.1 | GCA001937445_00982 | CDS | open | 47582-48688 | _na 368_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 1939 | MSKS01000014.1 | GCA001937445_00983 | CDS | open | 49504-51528 | _na 674_aa | DUF885 domain-containing protein | |
| 1940 | MSKS01000014.1 | GCA001937445_00942 | gene | open | 106-573 | |||
| 1941 | MSKS01000014.1 | GCA001937445_00943 | gene | open | 563-1300 | |||
| 1942 | MSKS01000014.1 | GCA001937445_00944 | gene | open | 1508-1711 | |||
| 1943 | MSKS01000014.1 | GCA001937445_00945 | gene | open | 1807-3045 | pqqD | ||
| 1944 | MSKS01000014.1 | GCA001937445_00946 | gene | open | 3042-5684 | |||
| 1945 | MSKS01000014.1 | GCA001937445_00947 | gene | open | 5681-6907 | |||
| 1946 | MSKS01000014.1 | GCA001937445_00948 | gene | open | 7528-8982 | purB | ||
| 1947 | MSKS01000014.1 | GCA001937445_00949 | gene | open | 8979-9389 | |||
| 1948 | MSKS01000014.1 | GCA001937445_00950 | gene | open | 9626-10066 | |||
| 1949 | MSKS01000014.1 | GCA001937445_00951 | gene | open | 10449-10712 | |||
| 1950 | MSKS01000014.1 | GCA001937445_00952 | gene | open | 10709-11098 | |||
| 1951 | MSKS01000014.1 | GCA001937445_00953 | gene | open | 11105-11476 | |||
| 1952 | MSKS01000014.1 | GCA001937445_00954 | gene | open | 11584-12348 | |||
| 1953 | MSKS01000014.1 | GCA001937445_00955 | gene | open | 12545-13639 | dcm | ||
| 1954 | MSKS01000014.1 | GCA001937445_00956 | gene | open | 13785-16616 | |||
| 1955 | MSKS01000014.1 | GCA001937445_00957 | gene | open | 16618-20031 | |||
| 1956 | MSKS01000014.1 | GCA001937445_00958 | gene | open | 20034-21542 | mutL | ||
| 1957 | MSKS01000014.1 | GCA001937445_00959 | gene | open | 21546-22538 | |||
| 1958 | MSKS01000014.1 | GCA001937445_00960 | gene | open | 22542-25556 | |||
| 1959 | MSKS01000014.1 | GCA001937445_00961 | gene | open | 25648-26028 | |||
| 1960 | MSKS01000014.1 | GCA001937445_00962 | gene | open | 26041-27345 | |||
| 1961 | MSKS01000014.1 | GCA001937445_00963 | gene | open | 27447-28118 | |||
| 1962 | MSKS01000014.1 | GCA001937445_00965 | gene | open | 28661-28882 | |||
| 1963 | MSKS01000014.1 | GCA001937445_00966 | gene | open | 28900-30843 | |||
| 1964 | MSKS01000014.1 | GCA001937445_00967 | gene | open | 30976-31383 | |||
| 1965 | MSKS01000014.1 | GCA001937445_00968 | gene | open | 31430-32587 | hisC | ||
| 1966 | MSKS01000014.1 | GCA001937445_00969 | gene | open | 32650-33561 | |||
| 1967 | MSKS01000014.1 | GCA001937445_00970 | gene | open | 34034-35293 | |||
| 1968 | MSKS01000014.1 | GCA001937445_00971 | gene | open | 35648-37330 | pgm | ||
| 1969 | MSKS01000014.1 | GCA001937445_00972 | gene | open | 37553-38605 | |||
| 1970 | MSKS01000014.1 | GCA001937445_00973 | gene | open | 38805-39203 | ridA | ||
| 1971 | MSKS01000014.1 | GCA001937445_00974 | gene | open | 39392-40411 | |||
| 1972 | MSKS01000014.1 | GCA001937445_00975 | gene | open | 40461-42086 | |||
| 1973 | MSKS01000014.1 | GCA001937445_00976 | gene | open | 42240-43130 | |||
| 1974 | MSKS01000014.1 | GCA001937445_00977 | gene | open | 43258-43869 | |||
| 1975 | MSKS01000014.1 | GCA001937445_00978 | gene | open | 43869-44426 | acrR | ||
| 1976 | MSKS01000014.1 | GCA001937445_00979 | gene | open | 44715-45374 | |||
| 1977 | MSKS01000014.1 | GCA001937445_00980 | gene | open | 45481-46449 | |||
| 1978 | MSKS01000014.1 | GCA001937445_00981 | gene | open | 46446-47585 | |||
| 1979 | MSKS01000014.1 | GCA001937445_00982 | gene | open | 47582-48688 | |||
| 1980 | MSKS01000014.1 | GCA001937445_00983 | gene | open | 49504-51528 | |||
| 1981 | MSKS01000015.1 | GCA001937445_00984 | CDS | open | 56-847 | _na 263_aa | hypothetical protein | |
| 1982 | MSKS01000015.1 | GCA001937445_00985 | CDS | open | 1002-2258 | _na 418_aa | hypothetical protein | |
| 1983 | MSKS01000015.1 | GCA001937445_00986 | CDS | open | 2260-2559 | _na 99_aa | Phage protein | |
| 1984 | MSKS01000015.1 | GCA001937445_00987 | CDS | open | 2575-2739 | _na 54_aa | hypothetical protein | |
| 1985 | MSKS01000015.1 | GCA001937445_00988 | CDS | open | 3127-3651 | _na 174_aa | DinB-like domain-containing protein | |
| 1986 | MSKS01000015.1 | GCA001937445_00989 | CDS | open | 3773-5008 | _na 411_aa | nagA | Amidohydrolase-related domain-containing protein |
| 1987 | MSKS01000015.1 | GCA001937445_00990 | CDS | open | 5118-6374 | _na 418_aa | Winged helix DNA-binding domain-containing protein | |
| 1988 | MSKS01000015.1 | GCA001937445_00991 | CDS | open | 6385-7080 | _na 231_aa | nucS | endonuclease NucS |
| 1989 | MSKS01000015.1 | GCA001937445_00992 | CDS | open | 7502-7918 | _na 138_aa | DUF2550 domain-containing protein | |
| 1990 | MSKS01000015.1 | GCA001937445_00993 | CDS | open | 7922-8188 | _na 88_aa | atpC | F0F1 ATP synthase subunit epsilon |
| 1991 | MSKS01000015.1 | GCA001937445_00994 | CDS | open | 8241-9677 | _na 478_aa | atpD | F0F1 ATP synthase subunit beta |
| 1992 | MSKS01000015.1 | GCA001937445_00995 | CDS | open | 9770-10717 | _na 315_aa | atpG | F0F1 ATP synthase subunit gamma |
| 1993 | MSKS01000015.1 | GCA001937445_00996 | CDS | open | 10719-12350 | _na 543_aa | atpA | F0F1 ATP synthase subunit alpha |
| 1994 | MSKS01000015.1 | GCA001937445_00997 | CDS | open | 12456-13271 | _na 271_aa | ATP synthase subunit delta | |
| 1995 | MSKS01000015.1 | GCA001937445_00998 | CDS | open | 13268-13855 | _na 195_aa | F0F1 ATP synthase subunit B | |
| 1996 | MSKS01000015.1 | GCA001937445_00999 | CDS | open | 13855-14064 | _na 69_aa | atpE | ATP synthase F0 subunit C |
| 1997 | MSKS01000015.1 | GCA001937445_01000 | CDS | open | 14144-15025 | _na 293_aa | atpB | F0F1 ATP synthase subunit A |
| 1998 | MSKS01000015.1 | GCA001937445_01001 | CDS | open | 15235-15696 | _na 153_aa | Pseudouridine synthase | |
| 1999 | MSKS01000015.1 | GCA001937445_01002 | CDS | open | 15693-16943 | _na 416_aa | rfe | Glycosyltransferase%2C group 4 family |
| 2000 | MSKS01000015.1 | GCA001937445_01003 | CDS | open | 16940-17695 | _na 251_aa | L-threonylcarbamoyladenylate synthase |

