BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_001937445.1)
Select a Genome:
|
BAKTA Annotations for GCA_001937445.1
|
Search & Sort all 5416 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4001 | MSKS01000033.1 | GCA001937445_01993 | CDS | open | 1851-3164 | _na 437_aa | aRO8 | Aminotransferase class I/classII large domain-containing protein |
| 4002 | MSKS01000033.1 | GCA001937445_01994 | CDS | open | 3173-4120 | _na 315_aa | ddlA | D-alanine--D-alanine ligase |
| 4003 | MSKS01000033.1 | GCA001937445_01995 | CDS | open | 8740-9720 | _na 326_aa | ParB-like protein | |
| 4004 | MSKS01000033.1 | GCA001937445_01996 | CDS | open | 10332-11234 | _na 300_aa | parA | AAA domain-containing protein |
| 4005 | MSKS01000033.1 | GCA001937445_01997 | CDS | open | 11342-11986 | _na 214_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 4006 | MSKS01000033.1 | GCA001937445_01998 | CDS | open | 11989-12597 | _na 202_aa | R3H domain-containing protein | |
| 4007 | MSKS01000033.1 | GCA001937445_01999 | CDS | open | 12651-13835 | _na 394_aa | yidC | membrane protein insertase YidC |
| 4008 | MSKS01000033.1 | GCA001937445_02000 | CDS | open | 13929-14213 | _na 94_aa | yidD | membrane protein insertion efficiency factor YidD |
| 4009 | MSKS01000033.1 | GCA001937445_02001 | CDS | open | 14236-14514 | _na 92_aa | rnpA | ribonuclease P protein component |
| 4010 | MSKS01000033.1 | GCA001937445_02002 | CDS | open | 14606-14743 | _na 45_aa | rpmH | 50S ribosomal protein L34 |
| 4011 | MSKS01000033.1 | GCA001937445_02003 | CDS | open | 15342-17030 | _na 562_aa | dnaA | chromosomal replication initiator protein DnaA |
| 4012 | MSKS01000033.1 | GCA001937445_02004 | CDS | open | 17260-17409 | _na 49_aa | hypothetical protein | |
| 4013 | MSKS01000033.1 | GCA001937445_02005 | CDS | open | 17686-18816 | _na 376_aa | dnaN | DNA polymerase III subunit beta |
| 4014 | MSKS01000033.1 | GCA001937445_02006 | CDS | open | 18830-20047 | _na 405_aa | recF | DNA replication/repair protein RecF |
| 4015 | MSKS01000033.1 | GCA001937445_02007 | CDS | open | 20040-20717 | _na 225_aa | PF05258 family protein | |
| 4016 | MSKS01000033.1 | GCA001937445_02008 | CDS | open | 21044-23071 | _na 675_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 4017 | MSKS01000033.1 | GCA001937445_02009 | CDS | open | 23140-25821 | _na 893_aa | gyrA | DNA gyrase subunit A |
| 4018 | MSKS01000033.1 | GCA001937445_02010 | CDS | open | 25818-26315 | _na 165_aa | DUF3566 domain-containing protein | |
| 4019 | MSKS01000033.1 | GCA001937445_02012 | CDS | open | 26469-26603 | _na 44_aa | hypothetical protein | |
| 4020 | MSKS01000033.1 | GCA001937445_02014 | CDS | open | 26779-27408 | _na 209_aa | tetR | TetR family transcriptional regulator |
| 4021 | MSKS01000033.1 | GCA001937445_02015 | CDS | open | 27503-28009 | _na 168_aa | HXXEE domain-containing protein | |
| 4022 | MSKS01000033.1 | GCA001937445_02016 | CDS | open | 28131-28520 | _na 129_aa | DUF3147 domain-containing protein | |
| 4023 | MSKS01000033.1 | GCA001937445_02017 | CDS | open | 28466-28720 | _na 84_aa | xRE | HTH cro/C1-type domain-containing protein |
| 4024 | MSKS01000033.1 | GCA001937445_02018 | CDS | open | 28731-29222 | _na 163_aa | HTH marR-type domain-containing protein | |
| 4025 | MSKS01000033.1 | GCA001937445_02019 | CDS | open | 29618-30589 | _na 323_aa | qor | Mycocerosic acid synthase |
| 4026 | MSKS01000033.1 | GCA001937445_02020 | CDS | open | 30637-31104 | _na 155_aa | Integron-associated effector binding protein domain-containing protein | |
| 4027 | MSKS01000033.1 | GCA001937445_02021 | CDS | open | 31101-31949 | _na 282_aa | HTH araC/xylS-type domain-containing protein | |
| 4028 | MSKS01000033.1 | GCA001937445_02022 | CDS | open | 32001-32789 | _na 262_aa | ABC transporter | |
| 4029 | MSKS01000033.1 | GCA001937445_02023 | CDS | open | 32789-33703 | _na 304_aa | ABC transporter ATP-binding protein | |
| 4030 | MSKS01000033.1 | GCA001937445_02024 | CDS | open | 33703-33924 | _na 73_aa | Phospholipase | |
| 4031 | MSKS01000033.1 | GCA001937445_02025 | CDS | open | 33974-34516 | _na 180_aa | HTH arsR-type domain-containing protein | |
| 4032 | MSKS01000033.1 | GCA001937445_02026 | CDS | open | 34653-37499 | _na 948_aa | Collagen-binding protein | |
| 4033 | MSKS01000033.1 | GCA001937445_02027 | CDS | open | 37840-38601 | _na 253_aa | Heavy-metal chelation domain-containing protein | |
| 4034 | MSKS01000033.1 | GCA001937445_02028 | CDS | open | 38737-39282 | _na 181_aa | Apolipoprotein A1/A4/E domain | |
| 4035 | MSKS01000033.1 | GCA001937445_02029 | CDS | open | 39451-39981 | _na 176_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 4036 | MSKS01000033.1 | GCA001937445_02030 | CDS | open | 40167-41021 | _na 284_aa | Peptidase S54 rhomboid domain-containing protein | |
| 4037 | MSKS01000033.1 | GCA001937445_01992 | gene | open | 186-1622 | thrC | ||
| 4038 | MSKS01000033.1 | GCA001937445_01993 | gene | open | 1851-3164 | aRO8 | ||
| 4039 | MSKS01000033.1 | GCA001937445_01994 | gene | open | 3173-4120 | ddlA | ||
| 4040 | MSKS01000033.1 | GCA001937445_01995 | gene | open | 8740-9720 | |||
| 4041 | MSKS01000033.1 | GCA001937445_01996 | gene | open | 10332-11234 | parA | ||
| 4042 | MSKS01000033.1 | GCA001937445_01997 | gene | open | 11342-11986 | rsmG | ||
| 4043 | MSKS01000033.1 | GCA001937445_01998 | gene | open | 11989-12597 | |||
| 4044 | MSKS01000033.1 | GCA001937445_01999 | gene | open | 12651-13835 | yidC | ||
| 4045 | MSKS01000033.1 | GCA001937445_02000 | gene | open | 13929-14213 | yidD | ||
| 4046 | MSKS01000033.1 | GCA001937445_02001 | gene | open | 14236-14514 | rnpA | ||
| 4047 | MSKS01000033.1 | GCA001937445_02002 | gene | open | 14606-14743 | rpmH | ||
| 4048 | MSKS01000033.1 | GCA001937445_02003 | gene | open | 15342-17030 | dnaA | ||
| 4049 | MSKS01000033.1 | GCA001937445_02004 | gene | open | 17260-17409 | |||
| 4050 | MSKS01000033.1 | GCA001937445_02005 | gene | open | 17686-18816 | dnaN | ||
| 4051 | MSKS01000033.1 | GCA001937445_02006 | gene | open | 18830-20047 | recF | ||
| 4052 | MSKS01000033.1 | GCA001937445_02007 | gene | open | 20040-20717 | |||
| 4053 | MSKS01000033.1 | GCA001937445_02008 | gene | open | 21044-23071 | gyrB | ||
| 4054 | MSKS01000033.1 | GCA001937445_02009 | gene | open | 23140-25821 | gyrA | ||
| 4055 | MSKS01000033.1 | GCA001937445_02010 | gene | open | 25818-26315 | |||
| 4056 | MSKS01000033.1 | GCA001937445_02012 | gene | open | 26469-26603 | |||
| 4057 | MSKS01000033.1 | GCA001937445_02014 | gene | open | 26779-27408 | tetR | ||
| 4058 | MSKS01000033.1 | GCA001937445_02015 | gene | open | 27503-28009 | |||
| 4059 | MSKS01000033.1 | GCA001937445_02016 | gene | open | 28131-28520 | |||
| 4060 | MSKS01000033.1 | GCA001937445_02017 | gene | open | 28466-28720 | xRE | ||
| 4061 | MSKS01000033.1 | GCA001937445_02018 | gene | open | 28731-29222 | |||
| 4062 | MSKS01000033.1 | GCA001937445_02019 | gene | open | 29618-30589 | qor | ||
| 4063 | MSKS01000033.1 | GCA001937445_02020 | gene | open | 30637-31104 | |||
| 4064 | MSKS01000033.1 | GCA001937445_02021 | gene | open | 31101-31949 | |||
| 4065 | MSKS01000033.1 | GCA001937445_02022 | gene | open | 32001-32789 | |||
| 4066 | MSKS01000033.1 | GCA001937445_02023 | gene | open | 32789-33703 | |||
| 4067 | MSKS01000033.1 | GCA001937445_02024 | gene | open | 33703-33924 | |||
| 4068 | MSKS01000033.1 | GCA001937445_02025 | gene | open | 33974-34516 | |||
| 4069 | MSKS01000033.1 | GCA001937445_02026 | gene | open | 34653-37499 | |||
| 4070 | MSKS01000033.1 | GCA001937445_02027 | gene | open | 37840-38601 | |||
| 4071 | MSKS01000033.1 | GCA001937445_02028 | gene | open | 38737-39282 | |||
| 4072 | MSKS01000033.1 | GCA001937445_02029 | gene | open | 39451-39981 | ppiB | ||
| 4073 | MSKS01000033.1 | GCA001937445_02030 | gene | open | 40167-41021 | |||
| 4074 | MSKS01000033.1 | GCA001937445_02011 | gene | open | 26365-26438 | trnI | ||
| 4075 | MSKS01000033.1 | GCA001937445_02013 | gene | open | 26636-26711 | trnA | ||
| 4076 | MSKS01000033.1 | GCA001937445_02011 | tRNA | open | 26365-26438 | trnI | tRNA-Ile(gat) | |
| 4077 | MSKS01000033.1 | GCA001937445_02013 | tRNA | open | 26636-26711 | trnA | tRNA-Ala(tgc) | |
| 4078 | MSKS01000034.1 | GCA001937445_02031 | CDS | open | 63-1325 | _na 420_aa | Glutamine--fructose-6-phosphate aminotransferase [isomerizing] | |
| 4079 | MSKS01000034.1 | GCA001937445_02032 | CDS | open | 1395-1820 | _na 141_aa | Holo-[acyl-carrier-protein] synthase | |
| 4080 | MSKS01000034.1 | GCA001937445_02033 | CDS | open | 2064-3998 | _na 644_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 4081 | MSKS01000034.1 | GCA001937445_02034 | CDS | open | 4045-5436 | _na 463_aa | alr | alanine racemase |
| 4082 | MSKS01000034.1 | GCA001937445_02035 | CDS | open | 5517-6155 | _na 212_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 4083 | MSKS01000034.1 | GCA001937445_02036 | CDS | open | 6152-7201 | _na 349_aa | Lipoprotein | |
| 4084 | MSKS01000034.1 | GCA001937445_02037 | CDS | open | 7211-7969 | _na 252_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 4085 | MSKS01000034.1 | GCA001937445_02038 | CDS | open | 7995-8585 | _na 196_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 4086 | MSKS01000034.1 | GCA001937445_02039 | CDS | open | 8974-9726 | _na 250_aa | Succinate dehydrogenase cytochrome B subunit%2C b558 family | |
| 4087 | MSKS01000034.1 | GCA001937445_02040 | CDS | open | 9739-11739 | _na 666_aa | sdhA | Succinate dehydrogenase flavoprotein subunit |
| 4088 | MSKS01000034.1 | GCA001937445_02041 | CDS | open | 11736-12506 | _na 256_aa | sdhB | succinate dehydrogenase |
| 4089 | MSKS01000034.1 | GCA001937445_02042 | CDS | open | 12603-13457 | _na 284_aa | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system | |
| 4090 | MSKS01000034.1 | GCA001937445_02043 | CDS | open | 13778-14491 | _na 237_aa | hypothetical protein | |
| 4091 | MSKS01000034.1 | GCA001937445_02044 | CDS | open | 14582-15199 | _na 205_aa | tag | DNA-3-methyladenine glycosylase I |
| 4092 | MSKS01000034.1 | GCA001937445_02045 | CDS | open | 15363-16409 | _na 348_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 4093 | MSKS01000034.1 | GCA001937445_02046 | CDS | open | 16437-17165 | _na 242_aa | acrR | Tetracyclin repressor%2C C-terminal all-alpha domain protein |
| 4094 | MSKS01000034.1 | GCA001937445_02047 | CDS | open | 17286-21107 | _na 1273_aa | cydD | thiol reductant ABC exporter subunit CydD |
| 4095 | MSKS01000034.1 | GCA001937445_02048 | CDS | open | 21367-21552 | _na 61_aa | hypothetical protein | |
| 4096 | MSKS01000034.1 | GCA001937445_02031 | gene | open | 63-1325 | |||
| 4097 | MSKS01000034.1 | GCA001937445_02032 | gene | open | 1395-1820 | |||
| 4098 | MSKS01000034.1 | GCA001937445_02033 | gene | open | 2064-3998 | |||
| 4099 | MSKS01000034.1 | GCA001937445_02034 | gene | open | 4045-5436 | alr | ||
| 4100 | MSKS01000034.1 | GCA001937445_02035 | gene | open | 5517-6155 | tsaE | ||
| 4101 | MSKS01000034.1 | GCA001937445_02036 | gene | open | 6152-7201 | |||
| 4102 | MSKS01000034.1 | GCA001937445_02037 | gene | open | 7211-7969 | tsaB | ||
| 4103 | MSKS01000034.1 | GCA001937445_02038 | gene | open | 7995-8585 | rimI | ||
| 4104 | MSKS01000034.1 | GCA001937445_02039 | gene | open | 8974-9726 | |||
| 4105 | MSKS01000034.1 | GCA001937445_02040 | gene | open | 9739-11739 | sdhA | ||
| 4106 | MSKS01000034.1 | GCA001937445_02041 | gene | open | 11736-12506 | sdhB | ||
| 4107 | MSKS01000034.1 | GCA001937445_02042 | gene | open | 12603-13457 | |||
| 4108 | MSKS01000034.1 | GCA001937445_02043 | gene | open | 13778-14491 | |||
| 4109 | MSKS01000034.1 | GCA001937445_02044 | gene | open | 14582-15199 | tag | ||
| 4110 | MSKS01000034.1 | GCA001937445_02045 | gene | open | 15363-16409 | tsaD | ||
| 4111 | MSKS01000034.1 | GCA001937445_02046 | gene | open | 16437-17165 | acrR | ||
| 4112 | MSKS01000034.1 | GCA001937445_02047 | gene | open | 17286-21107 | cydD | ||
| 4113 | MSKS01000034.1 | GCA001937445_02048 | gene | open | 21367-21552 | |||
| 4114 | MSKS01000035.1 | GCA001937445_02049 | CDS | open | 212-631 | _na 139_aa | DUF983 domain-containing protein | |
| 4115 | MSKS01000035.1 | GCA001937445_02050 | CDS | open | 911-1387 | _na 158_aa | DUF1795 domain-containing protein | |
| 4116 | MSKS01000035.1 | GCA001937445_02051 | CDS | open | 1384-2151 | _na 255_aa | espG | ESX secretion-associated protein EspG |
| 4117 | MSKS01000035.1 | GCA001937445_02049 | gene | open | 212-631 | |||
| 4118 | MSKS01000035.1 | GCA001937445_02050 | gene | open | 911-1387 | |||
| 4119 | MSKS01000035.1 | GCA001937445_02051 | gene | open | 1384-2151 | espG | ||
| 4120 | MSKS01000037.1 | GCA001937445_02052 | CDS | open | 1280-2062 | _na 260_aa | Bacteriocin biosynthesis cyclodehydratase domain protein | |
| 4121 | MSKS01000037.1 | GCA001937445_02053 | CDS | open | 2067-3467 | _na 466_aa | ycaO | YcaO domain-containing protein |
| 4122 | MSKS01000037.1 | GCA001937445_02054 | CDS | open | 3732-4457 | _na 241_aa | DNA-binding response regulator | |
| 4123 | MSKS01000037.1 | GCA001937445_02055 | CDS | open | 4508-5497 | _na 329_aa | hypothetical protein | |
| 4124 | MSKS01000037.1 | GCA001937445_02056 | CDS | open | 5644-5925 | _na 93_aa | frmR | Copper-sensing transcriptional repressor CsoR |
| 4125 | MSKS01000037.1 | GCA001937445_02057 | CDS | open | 6010-6279 | _na 89_aa | copZ | HMA domain-containing protein |
| 4126 | MSKS01000037.1 | GCA001937445_02058 | CDS | open | 6474-8534 | _na 686_aa | Dextranase | |
| 4127 | MSKS01000037.1 | GCA001937445_02059 | CDS | open | 8640-11354 | _na 904_aa | ATPase P | |
| 4128 | MSKS01000037.1 | GCA001937445_02060 | CDS | open | 11725-13122 | _na 465_aa | cysteine-S-conjugate beta-lyase | |
| 4129 | MSKS01000037.1 | GCA001937445_02061 | CDS | open | 13254-14462 | _na 402_aa | metC | Cystathionine gamma-synthase |
| 4130 | MSKS01000037.1 | GCA001937445_02062 | CDS | open | 14578-16407 | _na 609_aa | Proteinase | |
| 4131 | MSKS01000037.1 | GCA001937445_02063 | CDS | open | 16621-17112 | _na 163_aa | Zinc ribbon domain-containing protein | |
| 4132 | MSKS01000037.1 | GCA001937445_02064 | CDS | open | 17136-17807 | _na 223_aa | hypothetical protein | |
| 4133 | MSKS01000037.1 | GCA001937445_02066 | CDS | open | 18566-19891 | _na 441_aa | Cardiolipin synthase N-terminal domain-containing protein | |
| 4134 | MSKS01000037.1 | GCA001937445_02068 | CDS | open | 20445-21155 | _na 236_aa | DNA alkylation repair enzyme | |
| 4135 | MSKS01000037.1 | GCA001937445_02069 | CDS | open | 21278-22261 | _na 327_aa | HTH deoR-type domain-containing protein | |
| 4136 | MSKS01000037.1 | GCA001937445_02070 | CDS | open | 22366-22752 | _na 128_aa | VOC domain-containing protein | |
| 4137 | MSKS01000037.1 | GCA001937445_02071 | CDS | open | 23011-24423 | _na 470_aa | MFS transporter | |
| 4138 | MSKS01000037.1 | GCA001937445_02073 | CDS | open | 25048-26397 | _na 449_aa | yihS | N-acylglucosamine 2-epimerase |
| 4139 | MSKS01000037.1 | GCA001937445_02074 | CDS | open | 26543-28201 | _na 552_aa | Glucoside ABC transporter substrate-binding protein | |
| 4140 | MSKS01000037.1 | GCA001937445_02075 | CDS | open | 28201-29340 | _na 379_aa | Haloacid dehalogenase | |
| 4141 | MSKS01000037.1 | GCA001937445_02076 | CDS | open | 29352-30458 | _na 368_aa | serS | serine--tRNA ligase |
| 4142 | MSKS01000037.1 | GCA001937445_02052 | gene | open | 1280-2062 | |||
| 4143 | MSKS01000037.1 | GCA001937445_02053 | gene | open | 2067-3467 | ycaO | ||
| 4144 | MSKS01000037.1 | GCA001937445_02054 | gene | open | 3732-4457 | |||
| 4145 | MSKS01000037.1 | GCA001937445_02055 | gene | open | 4508-5497 | |||
| 4146 | MSKS01000037.1 | GCA001937445_02056 | gene | open | 5644-5925 | frmR | ||
| 4147 | MSKS01000037.1 | GCA001937445_02057 | gene | open | 6010-6279 | copZ | ||
| 4148 | MSKS01000037.1 | GCA001937445_02058 | gene | open | 6474-8534 | |||
| 4149 | MSKS01000037.1 | GCA001937445_02059 | gene | open | 8640-11354 | |||
| 4150 | MSKS01000037.1 | GCA001937445_02060 | gene | open | 11725-13122 | |||
| 4151 | MSKS01000037.1 | GCA001937445_02061 | gene | open | 13254-14462 | metC | ||
| 4152 | MSKS01000037.1 | GCA001937445_02062 | gene | open | 14578-16407 | |||
| 4153 | MSKS01000037.1 | GCA001937445_02063 | gene | open | 16621-17112 | |||
| 4154 | MSKS01000037.1 | GCA001937445_02064 | gene | open | 17136-17807 | |||
| 4155 | MSKS01000037.1 | GCA001937445_02066 | gene | open | 18566-19891 | |||
| 4156 | MSKS01000037.1 | GCA001937445_02068 | gene | open | 20445-21155 | |||
| 4157 | MSKS01000037.1 | GCA001937445_02069 | gene | open | 21278-22261 | |||
| 4158 | MSKS01000037.1 | GCA001937445_02070 | gene | open | 22366-22752 | |||
| 4159 | MSKS01000037.1 | GCA001937445_02071 | gene | open | 23011-24423 | |||
| 4160 | MSKS01000037.1 | GCA001937445_02073 | gene | open | 25048-26397 | yihS | ||
| 4161 | MSKS01000037.1 | GCA001937445_02074 | gene | open | 26543-28201 | |||
| 4162 | MSKS01000037.1 | GCA001937445_02075 | gene | open | 28201-29340 | |||
| 4163 | MSKS01000037.1 | GCA001937445_02076 | gene | open | 29352-30458 | serS | ||
| 4164 | MSKS01000037.1 | GCA001937445_02065 | gene | open | 18352-18427 | trnR | ||
| 4165 | MSKS01000037.1 | GCA001937445_02067 | gene | open | 20104-20193 | trnS | ||
| 4166 | MSKS01000037.1 | GCA001937445_02072 | gene | open | 24716-24801 | trnS | ||
| 4167 | MSKS01000037.1 | GCA001937445_02065 | tRNA | open | 18352-18427 | trnR | tRNA-Arg(acg) | |
| 4168 | MSKS01000037.1 | GCA001937445_02067 | tRNA | open | 20104-20193 | trnS | tRNA-Ser(gct) | |
| 4169 | MSKS01000037.1 | GCA001937445_02072 | tRNA | open | 24716-24801 | trnS | tRNA-Ser(tga) | |
| 4170 | MSKS01000038.1 | GCA001937445_02120 | gene | open | 55873-56241 | ssrA | ||
| 4171 | MSKS01000038.1 | GCA001937445_02120 | tmRNA | open | 55873-56241 | ssrA | transfer-messenger RNA%2C SsrA | |
| 4172 | MSKS01000038.1 | GCA001937445_02077 | CDS | open | 144-1457 | _na 437_aa | yjjB | Threonine/serine exporter family protein |
| 4173 | MSKS01000038.1 | GCA001937445_02078 | CDS | open | 1562-3340 | _na 592_aa | RCK C-terminal domain-containing protein | |
| 4174 | MSKS01000038.1 | GCA001937445_02079 | CDS | open | 3627-5411 | _na 594_aa | ilvB | acetolactate synthase large subunit |
| 4175 | MSKS01000038.1 | GCA001937445_02080 | CDS | open | 5417-5929 | _na 170_aa | ilvN | acetolactate synthase small subunit |
| 4176 | MSKS01000038.1 | GCA001937445_02081 | CDS | open | 5939-6970 | _na 343_aa | ilvC | ketol-acid reductoisomerase |
| 4177 | MSKS01000038.1 | GCA001937445_02082 | CDS | open | 7050-8309 | _na 419_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 4178 | MSKS01000038.1 | GCA001937445_02083 | CDS | open | 8306-8926 | _na 206_aa | HTH tetR-type domain-containing protein | |
| 4179 | MSKS01000038.1 | GCA001937445_02084 | CDS | open | 9043-10110 | _na 355_aa | leuB | 3-isopropylmalate dehydrogenase |
| 4180 | MSKS01000038.1 | GCA001937445_02085 | CDS | open | 10178-10837 | _na 219_aa | Mucin-associated surface protein | |
| 4181 | MSKS01000038.1 | GCA001937445_02086 | CDS | open | 10872-11492 | _na 206_aa | Gametogenetin | |
| 4182 | MSKS01000038.1 | GCA001937445_02087 | CDS | open | 11786-12961 | _na 391_aa | ilvE | branched-chain amino acid aminotransferase |
| 4183 | MSKS01000038.1 | GCA001937445_02088 | CDS | open | 13141-14277 | _na 378_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 4184 | MSKS01000038.1 | GCA001937445_02089 | CDS | open | 14353-15660 | _na 435_aa | wecC | UDP-N-acetyl-D-mannosamine dehydrogenase |
| 4185 | MSKS01000038.1 | GCA001937445_02090 | CDS | open | 15642-18851 | _na 1069_aa | Glycosyltransferase 2-like domain-containing protein | |
| 4186 | MSKS01000038.1 | GCA001937445_02091 | CDS | open | 19116-19508 | _na 130_aa | tagD | glycerol-3-phosphate cytidylyltransferase |
| 4187 | MSKS01000038.1 | GCA001937445_02092 | CDS | open | 19649-21685 | _na 678_aa | CDP-glycerol glycerophosphotransferase family protein | |
| 4188 | MSKS01000038.1 | GCA001937445_02093 | CDS | open | 21838-23637 | _na 599_aa | CDP-glycerol glycerophosphotransferase family protein | |
| 4189 | MSKS01000038.1 | GCA001937445_02094 | CDS | open | 23634-25478 | _na 614_aa | Glycosyltransferase 61 catalytic domain-containing protein | |
| 4190 | MSKS01000038.1 | GCA001937445_02095 | CDS | open | 25463-27400 | _na 645_aa | Glycosyltransferase | |
| 4191 | MSKS01000038.1 | GCA001937445_02096 | CDS | open | 27397-29793 | _na 798_aa | Glycosyl transferase | |
| 4192 | MSKS01000038.1 | GCA001937445_02097 | CDS | open | 29793-31037 | _na 414_aa | Glycosyltransferase%2C group 2 family protein | |
| 4193 | MSKS01000038.1 | GCA001937445_02098 | CDS | open | 31088-31864 | _na 258_aa | SGNH/GDSL hydrolase family protein | |
| 4194 | MSKS01000038.1 | GCA001937445_02099 | CDS | open | 31867-32904 | _na 345_aa | ABC transporter domain-containing protein | |
| 4195 | MSKS01000038.1 | GCA001937445_02100 | CDS | open | 32891-33805 | _na 304_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 4196 | MSKS01000038.1 | GCA001937445_02101 | CDS | open | 33802-35520 | _na 572_aa | Glycosyl transferase family 1 | |
| 4197 | MSKS01000038.1 | GCA001937445_02102 | CDS | open | 35513-36787 | _na 424_aa | wbuB | Glycosyltransferase WbuB |
| 4198 | MSKS01000038.1 | GCA001937445_02103 | CDS | open | 36792-37832 | _na 346_aa | Glycosyltransferase%2C group 4 family | |
| 4199 | MSKS01000038.1 | GCA001937445_02104 | CDS | open | 37829-38311 | _na 160_aa | Dolichyl-phosphate beta-D-mannosyltransferase | |
| 4200 | MSKS01000038.1 | GCA001937445_02105 | CDS | open | 38784-39203 | _na 139_aa | tagD | glycerol-3-phosphate cytidylyltransferase |
| 4201 | MSKS01000038.1 | GCA001937445_02106 | CDS | open | 39211-40071 | _na 286_aa | NodB-like y domain-containing protein | |
| 4202 | MSKS01000038.1 | GCA001937445_02108 | CDS | open | 40475-41185 | _na 236_aa | orn | oligoribonuclease |
| 4203 | MSKS01000038.1 | GCA001937445_02109 | CDS | open | 41270-43777 | _na 835_aa | non-specific serine/threonine protein kinase | |
| 4204 | MSKS01000038.1 | GCA001937445_02110 | CDS | open | 43876-46566 | _na 896_aa | fHA | ABC transporter domain-containing protein |
| 4205 | MSKS01000038.1 | GCA001937445_02112 | CDS | open | 47344-48945 | _na 533_aa | G domain-containing protein | |
| 4206 | MSKS01000038.1 | GCA001937445_02113 | CDS | open | 48942-50441 | _na 499_aa | G domain-containing protein | |
| 4207 | MSKS01000038.1 | GCA001937445_02114 | CDS | open | 50610-51305 | _na 231_aa | Single-stranded DNA-binding protein | |
| 4208 | MSKS01000038.1 | GCA001937445_02115 | CDS | open | 51298-51858 | _na 186_aa | TY-Chap N-terminal domain-containing protein | |
| 4209 | MSKS01000038.1 | GCA001937445_02116 | CDS | open | 52026-52763 | _na 245_aa | ftsE | cell division ATP-binding protein FtsE |
| 4210 | MSKS01000038.1 | GCA001937445_02117 | CDS | open | 52776-53693 | _na 305_aa | ftsX | permease-like cell division protein FtsX |
| 4211 | MSKS01000038.1 | GCA001937445_02118 | CDS | open | 53700-55016 | _na 438_aa | Peptidase M23 | |
| 4212 | MSKS01000038.1 | GCA001937445_02119 | CDS | open | 55172-55723 | _na 183_aa | smpB | SsrA-binding protein SmpB |
| 4213 | MSKS01000038.1 | GCA001937445_02077 | gene | open | 144-1457 | yjjB | ||
| 4214 | MSKS01000038.1 | GCA001937445_02078 | gene | open | 1562-3340 | |||
| 4215 | MSKS01000038.1 | GCA001937445_02079 | gene | open | 3627-5411 | ilvB | ||
| 4216 | MSKS01000038.1 | GCA001937445_02080 | gene | open | 5417-5929 | ilvN | ||
| 4217 | MSKS01000038.1 | GCA001937445_02081 | gene | open | 5939-6970 | ilvC | ||
| 4218 | MSKS01000038.1 | GCA001937445_02082 | gene | open | 7050-8309 | |||
| 4219 | MSKS01000038.1 | GCA001937445_02083 | gene | open | 8306-8926 | |||
| 4220 | MSKS01000038.1 | GCA001937445_02084 | gene | open | 9043-10110 | leuB | ||
| 4221 | MSKS01000038.1 | GCA001937445_02085 | gene | open | 10178-10837 | |||
| 4222 | MSKS01000038.1 | GCA001937445_02086 | gene | open | 10872-11492 | |||
| 4223 | MSKS01000038.1 | GCA001937445_02087 | gene | open | 11786-12961 | ilvE | ||
| 4224 | MSKS01000038.1 | GCA001937445_02088 | gene | open | 13141-14277 | |||
| 4225 | MSKS01000038.1 | GCA001937445_02089 | gene | open | 14353-15660 | wecC | ||
| 4226 | MSKS01000038.1 | GCA001937445_02090 | gene | open | 15642-18851 | |||
| 4227 | MSKS01000038.1 | GCA001937445_02091 | gene | open | 19116-19508 | tagD | ||
| 4228 | MSKS01000038.1 | GCA001937445_02092 | gene | open | 19649-21685 | |||
| 4229 | MSKS01000038.1 | GCA001937445_02093 | gene | open | 21838-23637 | |||
| 4230 | MSKS01000038.1 | GCA001937445_02094 | gene | open | 23634-25478 | |||
| 4231 | MSKS01000038.1 | GCA001937445_02095 | gene | open | 25463-27400 | |||
| 4232 | MSKS01000038.1 | GCA001937445_02096 | gene | open | 27397-29793 | |||
| 4233 | MSKS01000038.1 | GCA001937445_02097 | gene | open | 29793-31037 | |||
| 4234 | MSKS01000038.1 | GCA001937445_02098 | gene | open | 31088-31864 | |||
| 4235 | MSKS01000038.1 | GCA001937445_02099 | gene | open | 31867-32904 | |||
| 4236 | MSKS01000038.1 | GCA001937445_02100 | gene | open | 32891-33805 | |||
| 4237 | MSKS01000038.1 | GCA001937445_02101 | gene | open | 33802-35520 | |||
| 4238 | MSKS01000038.1 | GCA001937445_02102 | gene | open | 35513-36787 | wbuB | ||
| 4239 | MSKS01000038.1 | GCA001937445_02103 | gene | open | 36792-37832 | |||
| 4240 | MSKS01000038.1 | GCA001937445_02104 | gene | open | 37829-38311 | |||
| 4241 | MSKS01000038.1 | GCA001937445_02105 | gene | open | 38784-39203 | tagD | ||
| 4242 | MSKS01000038.1 | GCA001937445_02106 | gene | open | 39211-40071 | |||
| 4243 | MSKS01000038.1 | GCA001937445_02108 | gene | open | 40475-41185 | orn | ||
| 4244 | MSKS01000038.1 | GCA001937445_02109 | gene | open | 41270-43777 | |||
| 4245 | MSKS01000038.1 | GCA001937445_02110 | gene | open | 43876-46566 | fHA | ||
| 4246 | MSKS01000038.1 | GCA001937445_02112 | gene | open | 47344-48945 | |||
| 4247 | MSKS01000038.1 | GCA001937445_02113 | gene | open | 48942-50441 | |||
| 4248 | MSKS01000038.1 | GCA001937445_02114 | gene | open | 50610-51305 | |||
| 4249 | MSKS01000038.1 | GCA001937445_02115 | gene | open | 51298-51858 | |||
| 4250 | MSKS01000038.1 | GCA001937445_02116 | gene | open | 52026-52763 | ftsE | ||
| 4251 | MSKS01000038.1 | GCA001937445_02117 | gene | open | 52776-53693 | ftsX | ||
| 4252 | MSKS01000038.1 | GCA001937445_02118 | gene | open | 53700-55016 | |||
| 4253 | MSKS01000038.1 | GCA001937445_02119 | gene | open | 55172-55723 | smpB | ||
| 4254 | MSKS01000038.1 | GCA001937445_02107 | gene | open | 40281-40356 | trnH | ||
| 4255 | MSKS01000038.1 | GCA001937445_02111 | gene | open | 46964-47036 | trnR | ||
| 4256 | MSKS01000038.1 | GCA001937445_02107 | tRNA | open | 40281-40356 | trnH | tRNA-His(gtg) | |
| 4257 | MSKS01000038.1 | GCA001937445_02111 | tRNA | open | 46964-47036 | trnR | tRNA-Arg(tct) | |
| 4258 | MSKS01000039.1 | GCA001937445_02121 | CDS | open | 149-1207 | _na 352_aa | hypothetical protein | |
| 4259 | MSKS01000039.1 | GCA001937445_02122 | CDS | open | 1312-2361 | _na 349_aa | PASTA domain-containing protein | |
| 4260 | MSKS01000039.1 | GCA001937445_02121 | gene | open | 149-1207 | |||
| 4261 | MSKS01000039.1 | GCA001937445_02122 | gene | open | 1312-2361 | |||
| 4262 | MSKS01000041.1 | GCA001937445_02123 | CDS | open | 134-1123 | _na 329_aa | galE | UDP-glucose 4-epimerase GalE |
| 4263 | MSKS01000041.1 | GCA001937445_02124 | CDS | open | 1215-2696 | _na 493_aa | Transcriptional regulator | |
| 4264 | MSKS01000041.1 | GCA001937445_02125 | CDS | open | 2712-3998 | _na 428_aa | Transcriptional regulator | |
| 4265 | MSKS01000041.1 | GCA001937445_02126 | CDS | open | 4106-5059 | _na 317_aa | dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol%2C alpha-3-L-rhamnosyltransferase | |
| 4266 | MSKS01000041.1 | GCA001937445_02127 | CDS | open | 5094-5507 | _na 137_aa | DUF2304 domain-containing protein | |
| 4267 | MSKS01000041.1 | GCA001937445_02128 | CDS | open | 5531-6205 | _na 224_aa | Glycosyltransferase 2-like domain-containing protein | |
| 4268 | MSKS01000041.1 | GCA001937445_02129 | CDS | open | 6500-7156 | _na 218_aa | N-acetyltransferase | |
| 4269 | MSKS01000041.1 | GCA001937445_02130 | CDS | open | 7156-8289 | _na 377_aa | wecE | DegT/DnrJ/EryC1/StrS family aminotransferase |
| 4270 | MSKS01000041.1 | GCA001937445_02131 | CDS | open | 8291-9358 | _na 355_aa | mviM | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein |
| 4271 | MSKS01000041.1 | GCA001937445_02132 | CDS | open | 9355-10746 | _na 463_aa | rfbX | RfbX |
| 4272 | MSKS01000041.1 | GCA001937445_02133 | CDS | open | 10712-12037 | _na 441_aa | Glycosyl transferase | |
| 4273 | MSKS01000041.1 | GCA001937445_02134 | CDS | open | 12101-13219 | _na 372_aa | Glycosyltransferase | |
| 4274 | MSKS01000041.1 | GCA001937445_02135 | CDS | open | 13232-14950 | _na 572_aa | asparagine synthase (glutamine-hydrolyzing) | |
| 4275 | MSKS01000041.1 | GCA001937445_02136 | CDS | open | 15234-16415 | _na 393_aa | Glycosyl transferase | |
| 4276 | MSKS01000041.1 | GCA001937445_02137 | CDS | open | 16408-17655 | _na 415_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 4277 | MSKS01000041.1 | GCA001937445_02138 | CDS | open | 17652-19649 | _na 665_aa | Tat pathway signal sequence | |
| 4278 | MSKS01000041.1 | GCA001937445_02139 | CDS | open | 19771-21075 | _na 434_aa | wecC | UDP-glucose/GDP-mannose dehydrogenase C-terminal domain-containing protein |
| 4279 | MSKS01000041.1 | GCA001937445_02140 | CDS | open | 21107-23173 | _na 688_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 4280 | MSKS01000041.1 | GCA001937445_02141 | CDS | open | 23202-23486 | _na 94_aa | Antibiotic biosynthesis monooxygenase | |
| 4281 | MSKS01000041.1 | GCA001937445_02142 | CDS | open | 23533-23874 | _na 113_aa | hicB | Toxin-antitoxin system HicB family antitoxin |
| 4282 | MSKS01000041.1 | GCA001937445_02143 | CDS | open | 23946-25589 | _na 547_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 4283 | MSKS01000041.1 | GCA001937445_02144 | CDS | open | 25830-26768 | _na 312_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 4284 | MSKS01000041.1 | GCA001937445_02145 | CDS | open | 26880-27875 | _na 331_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 4285 | MSKS01000041.1 | GCA001937445_02123 | gene | open | 134-1123 | galE | ||
| 4286 | MSKS01000041.1 | GCA001937445_02124 | gene | open | 1215-2696 | |||
| 4287 | MSKS01000041.1 | GCA001937445_02125 | gene | open | 2712-3998 | |||
| 4288 | MSKS01000041.1 | GCA001937445_02126 | gene | open | 4106-5059 | |||
| 4289 | MSKS01000041.1 | GCA001937445_02127 | gene | open | 5094-5507 | |||
| 4290 | MSKS01000041.1 | GCA001937445_02128 | gene | open | 5531-6205 | |||
| 4291 | MSKS01000041.1 | GCA001937445_02129 | gene | open | 6500-7156 | |||
| 4292 | MSKS01000041.1 | GCA001937445_02130 | gene | open | 7156-8289 | wecE | ||
| 4293 | MSKS01000041.1 | GCA001937445_02131 | gene | open | 8291-9358 | mviM | ||
| 4294 | MSKS01000041.1 | GCA001937445_02132 | gene | open | 9355-10746 | rfbX | ||
| 4295 | MSKS01000041.1 | GCA001937445_02133 | gene | open | 10712-12037 | |||
| 4296 | MSKS01000041.1 | GCA001937445_02134 | gene | open | 12101-13219 | |||
| 4297 | MSKS01000041.1 | GCA001937445_02135 | gene | open | 13232-14950 | |||
| 4298 | MSKS01000041.1 | GCA001937445_02136 | gene | open | 15234-16415 | |||
| 4299 | MSKS01000041.1 | GCA001937445_02137 | gene | open | 16408-17655 | |||
| 4300 | MSKS01000041.1 | GCA001937445_02138 | gene | open | 17652-19649 | |||
| 4301 | MSKS01000041.1 | GCA001937445_02139 | gene | open | 19771-21075 | wecC | ||
| 4302 | MSKS01000041.1 | GCA001937445_02140 | gene | open | 21107-23173 | |||
| 4303 | MSKS01000041.1 | GCA001937445_02141 | gene | open | 23202-23486 | |||
| 4304 | MSKS01000041.1 | GCA001937445_02142 | gene | open | 23533-23874 | hicB | ||
| 4305 | MSKS01000041.1 | GCA001937445_02143 | gene | open | 23946-25589 | |||
| 4306 | MSKS01000041.1 | GCA001937445_02144 | gene | open | 25830-26768 | wcaA | ||
| 4307 | MSKS01000041.1 | GCA001937445_02145 | gene | open | 26880-27875 | rfbB | ||
| 4308 | MSKS01000042.1 | repeat_region | open | 52-821 | CRISPR array with 13 repeats of length 28%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 33 | |||
| 4309 | MSKS01000042.1 | repeat_region | open | 1151-3085 | CRISPR array with 32 repeats of length 28%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 33 | |||
| 4310 | MSKS01000042.1 | GCA001937445_02146 | CDS | open | 3173-3331 | _na 52_aa | hypothetical protein | |
| 4311 | MSKS01000042.1 | GCA001937445_02147 | CDS | open | 3564-4505 | _na 313_aa | ATP-grasp fold amidoligase family protein | |
| 4312 | MSKS01000042.1 | GCA001937445_02148 | CDS | open | 4751-6097 | _na 448_aa | yveK | Polysaccharide biosynthesis tyrosine autokinase |
| 4313 | MSKS01000042.1 | GCA001937445_02149 | CDS | open | 6907-8832 | _na 641_aa | flaA1 | Polysaccharide biosynthesis protein |
| 4314 | MSKS01000042.1 | GCA001937445_02150 | CDS | open | 8832-10043 | _na 403_aa | Capsular biosynthesis protein | |
| 4315 | MSKS01000042.1 | GCA001937445_02151 | CDS | open | 10040-10726 | _na 228_aa | Bacterial sugar transferase domain-containing protein | |
| 4316 | MSKS01000042.1 | GCA001937445_02152 | CDS | open | 10758-11540 | _na 260_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 4317 | MSKS01000042.1 | GCA001937445_02153 | CDS | open | 11606-12757 | _na 383_aa | Capsular biosynthesis protein | |
| 4318 | MSKS01000042.1 | GCA001937445_02154 | CDS | open | 12767-13873 | _na 368_aa | Polysaccharide polymerase | |
| 4319 | MSKS01000042.1 | GCA001937445_02155 | CDS | open | 13873-14301 | _na 142_aa | Serine acetyltransferase | |
| 4320 | MSKS01000042.1 | GCA001937445_02156 | CDS | open | 14298-14405 | _na 35_aa | hypothetical protein | |
| 4321 | MSKS01000042.1 | GCA001937445_02157 | CDS | open | 14389-15816 | _na 475_aa | Polysaccharide biosynthesis protein C-terminal domain-containing protein | |
| 4322 | MSKS01000042.1 | GCA001937445_02158 | CDS | open | 15837-17159 | _na 440_aa | UDP-glucose 6-dehydrogenase | |
| 4323 | MSKS01000042.1 | GCA001937445_02159 | CDS | open | 17524-19332 | _na 602_aa | tetrahydrofolate synthase | |
| 4324 | MSKS01000042.1 | GCA001937445_02160 | CDS | open | 19612-21297 | _na 561_aa | amyA | Glucohydrolase |
| 4325 | MSKS01000042.1 | GCA001937445_02161 | CDS | open | 21401-23452 | _na 683_aa | nagE | PTS beta-glucoside transporter subunit IIABC |
| 4326 | MSKS01000042.1 | GCA001937445_02162 | CDS | open | 23619-24350 | _na 243_aa | mngR | Trehalose operon transcriptional repressor |
| 4327 | MSKS01000042.1 | GCA001937445_02163 | CDS | open | 24723-25403 | _na 226_aa | dhaL | dihydroxyacetone kinase subunit DhaL |
| 4328 | MSKS01000042.1 | GCA001937445_02164 | CDS | open | 25489-25929 | _na 146_aa | ndk | nucleoside-diphosphate kinase |
| 4329 | MSKS01000042.1 | GCA001937445_02165 | CDS | open | 26056-27300 | _na 414_aa | natB | ABC-2 family transporter protein |
| 4330 | MSKS01000042.1 | GCA001937445_02166 | CDS | open | 27300-28247 | _na 315_aa | ATP-binding cassette domain-containing protein | |
| 4331 | MSKS01000042.1 | GCA001937445_02167 | CDS | open | 28280-32218 | _na 1312_aa | Chromosome partition protein Smc | |
| 4332 | MSKS01000042.1 | GCA001937445_02168 | CDS | open | 32380-32754 | _na 124_aa | Cell division protein DivIVA | |
| 4333 | MSKS01000042.1 | GCA001937445_02169 | CDS | open | 33112-34272 | _na 386_aa | ftsY | signal recognition particle-docking protein FtsY |
| 4334 | MSKS01000042.1 | GCA001937445_02170 | CDS | open | 34403-35014 | _na 203_aa | citB | Two component system response regulator |
| 4335 | MSKS01000042.1 | GCA001937445_02171 | CDS | open | 35093-36250 | _na 385_aa | Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein | |
| 4336 | MSKS01000042.1 | GCA001937445_02172 | CDS | open | 36279-37148 | _na 289_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 4337 | MSKS01000042.1 | GCA001937445_02173 | CDS | open | 37145-38137 | _na 330_aa | ABC transporter domain-containing protein | |
| 4338 | MSKS01000042.1 | GCA001937445_02174 | CDS | open | 38501-40189 | _na 562_aa | ffh | signal recognition particle protein |
| 4339 | MSKS01000042.1 | GCA001937445_02175 | CDS | open | 40204-40815 | _na 203_aa | citB | Response regulatory domain-containing protein |
| 4340 | MSKS01000042.1 | GCA001937445_02176 | CDS | open | 40812-41912 | _na 366_aa | Two-component sensor histidine kinase | |
| 4341 | MSKS01000042.1 | GCA001937445_02177 | CDS | open | 42041-42919 | _na 292_aa | ABC transporter | |
| 4342 | MSKS01000042.1 | GCA001937445_02178 | CDS | open | 42970-43989 | _na 339_aa | rbbA | Multidrug ABC transporter ATP-binding protein |
| 4343 | MSKS01000042.1 | GCA001937445_02179 | CDS | open | 44103-45260 | _na 385_aa | Serine/arginine repetitive matrix protein 1 | |
| 4344 | MSKS01000042.1 | GCA001937445_02180 | CDS | open | 45835-46452 | _na 205_aa | hypothetical protein | |
| 4345 | MSKS01000042.1 | GCA001937445_02181 | CDS | open | 46454-46690 | _na 78_aa | ylqC | RNA-binding protein |
| 4346 | MSKS01000042.1 | GCA001937445_02182 | CDS | open | 47001-47549 | _na 182_aa | rimM | ribosome maturation factor RimM |
| 4347 | MSKS01000042.1 | GCA001937445_02183 | CDS | open | 47546-48967 | _na 473_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 4348 | MSKS01000042.1 | GCA001937445_02184 | CDS | open | 48964-49878 | _na 304_aa | lepB | signal peptidase I |
| 4349 | MSKS01000042.1 | GCA001937445_02185 | CDS | open | 50122-50469 | _na 115_aa | rplS | 50S ribosomal protein L19 |
| 4350 | MSKS01000042.1 | GCA001937445_02186 | CDS | open | 50581-51801 | _na 406_aa | lepB | signal peptidase I |
| 4351 | MSKS01000042.1 | GCA001937445_02187 | CDS | open | 51798-52520 | _na 240_aa | ribonuclease HII | |
| 4352 | MSKS01000042.1 | GCA001937445_02188 | CDS | open | 52532-52933 | _na 133_aa | Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII | |
| 4353 | MSKS01000042.1 | GCA001937445_02189 | CDS | open | 53097-53657 | _na 186_aa | yraN | YraN family protein |
| 4354 | MSKS01000042.1 | GCA001937445_02190 | CDS | open | 53648-55219 | _na 523_aa | yifB | Mg chelatase |
| 4355 | MSKS01000042.1 | GCA001937445_02191 | CDS | open | 55216-56595 | _na 459_aa | dprA | DNA-processing protein DprA |
| 4356 | MSKS01000042.1 | GCA001937445_02192 | CDS | open | 56773-57696 | _na 307_aa | xerC | Tyrosine recombinase XerC |
| 4357 | MSKS01000042.1 | GCA001937445_02193 | CDS | open | 57724-58377 | _na 217_aa | Peptidase M23 domain-containing protein | |
| 4358 | MSKS01000042.1 | GCA001937445_02194 | CDS | open | 59034-59882 | _na 282_aa | rpsB | 30S ribosomal protein S2 |
| 4359 | MSKS01000042.1 | GCA001937445_02195 | CDS | open | 59990-60829 | _na 279_aa | tsf | translation elongation factor Ts |
| 4360 | MSKS01000042.1 | GCA001937445_02196 | CDS | open | 61094-61846 | _na 250_aa | pyrH | UMP kinase |
| 4361 | MSKS01000042.1 | GCA001937445_02197 | CDS | open | 62010-62567 | _na 185_aa | frr | ribosome recycling factor |
| 4362 | MSKS01000042.1 | GCA001937445_02198 | CDS | open | 62632-63570 | _na 312_aa | cdsA | Phosphatidate cytidylyltransferase |
| 4363 | MSKS01000042.1 | GCA001937445_02199 | CDS | open | 63643-64905 | _na 420_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 4364 | MSKS01000042.1 | GCA001937445_02200 | CDS | open | 64902-65447 | _na 181_aa | Cell division protein DivIVA | |
| 4365 | MSKS01000042.1 | GCA001937445_02201 | CDS | open | 65480-66778 | _na 432_aa | dxr | 1-deoxy-D-xylulose-5-phosphate reductoisomerase |
| 4366 | MSKS01000042.1 | GCA001937445_02202 | CDS | open | 66775-68109 | _na 444_aa | Peptidase%2C M50 family | |
| 4367 | MSKS01000042.1 | GCA001937445_02203 | CDS | open | 68245-69393 | _na 382_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 4368 | MSKS01000042.1 | GCA001937445_02204 | CDS | open | 69443-70432 | _na 329_aa | N-acetyltransferase domain-containing protein | |
| 4369 | MSKS01000042.1 | GCA001937445_02205 | CDS | open | 70566-72401 | _na 611_aa | proS | proline--tRNA ligase |
| 4370 | MSKS01000042.1 | GCA001937445_02206 | CDS | open | 72929-74305 | _na 458_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 4371 | MSKS01000042.1 | GCA001937445_02207 | CDS | open | 74387-75244 | _na 285_aa | HTH lysR-type domain-containing protein | |
| 4372 | MSKS01000042.1 | GCA001937445_02208 | CDS | open | 75810-76046 | _na 78_aa | hypothetical protein | |
| 4373 | MSKS01000042.1 | GCA001937445_02209 | CDS | open | 76048-77097 | _na 349_aa | Tat pathway signal protein | |
| 4374 | MSKS01000042.1 | GCA001937445_02210 | CDS | open | 77212-77730 | _na 172_aa | rimP | Ribosome maturation factor RimP |
| 4375 | MSKS01000042.1 | GCA001937445_02211 | CDS | open | 77937-78965 | _na 342_aa | nusA | Transcription termination/antitermination protein NusA |
| 4376 | MSKS01000042.1 | GCA001937445_02212 | CDS | open | 79084-79416 | _na 110_aa | ylxR | YlxR domain-containing protein |
| 4377 | MSKS01000042.1 | GCA001937445_02213 | CDS | open | 79508-82456 | _na 982_aa | infB | translation initiation factor IF-2 |
| 4378 | MSKS01000042.1 | GCA001937445_02214 | CDS | open | 82573-84144 | _na 523_aa | ydhU | Oxidoreductase molybdopterin-binding domain-containing protein |
| 4379 | MSKS01000042.1 | GCA001937445_02215 | CDS | open | 84509-86851 | _na 780_aa | norB | Nitric oxide reductase subunit B cytochrome c-like domain-containing protein |
| 4380 | MSKS01000042.1 | GCA001937445_02216 | CDS | open | 86851-87771 | _na 306_aa | Transposase | |
| 4381 | MSKS01000042.1 | GCA001937445_02217 | CDS | open | 87822-88622 | _na 266_aa | hflC | Band 7 domain-containing protein |
| 4382 | MSKS01000042.1 | GCA001937445_02218 | CDS | open | 88597-89589 | _na 330_aa | rarD | EamA family transporter RarD |
| 4383 | MSKS01000042.1 | GCA001937445_02219 | CDS | open | 89787-90284 | _na 165_aa | rbfA | 30S ribosome-binding factor RbfA |
| 4384 | MSKS01000042.1 | GCA001937445_02220 | CDS | open | 90281-91396 | _na 371_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 4385 | MSKS01000042.1 | GCA001937445_02221 | CDS | open | 91468-91770 | _na 100_aa | DUF4266 domain-containing protein | |
| 4386 | MSKS01000042.1 | GCA001937445_02222 | CDS | open | 91793-92614 | _na 273_aa | ABC transporter domain-containing protein | |
| 4387 | MSKS01000042.1 | GCA001937445_02223 | CDS | open | 92626-92778 | _na 50_aa | hypothetical protein | |
| 4388 | MSKS01000042.1 | GCA001937445_02146 | gene | open | 3173-3331 | |||
| 4389 | MSKS01000042.1 | GCA001937445_02147 | gene | open | 3564-4505 | |||
| 4390 | MSKS01000042.1 | GCA001937445_02148 | gene | open | 4751-6097 | yveK | ||
| 4391 | MSKS01000042.1 | GCA001937445_02149 | gene | open | 6907-8832 | flaA1 | ||
| 4392 | MSKS01000042.1 | GCA001937445_02150 | gene | open | 8832-10043 | |||
| 4393 | MSKS01000042.1 | GCA001937445_02151 | gene | open | 10040-10726 | |||
| 4394 | MSKS01000042.1 | GCA001937445_02152 | gene | open | 10758-11540 | wcaA | ||
| 4395 | MSKS01000042.1 | GCA001937445_02153 | gene | open | 11606-12757 | |||
| 4396 | MSKS01000042.1 | GCA001937445_02154 | gene | open | 12767-13873 | |||
| 4397 | MSKS01000042.1 | GCA001937445_02155 | gene | open | 13873-14301 | |||
| 4398 | MSKS01000042.1 | GCA001937445_02156 | gene | open | 14298-14405 | |||
| 4399 | MSKS01000042.1 | GCA001937445_02157 | gene | open | 14389-15816 | |||
| 4400 | MSKS01000042.1 | GCA001937445_02158 | gene | open | 15837-17159 | |||
| 4401 | MSKS01000042.1 | GCA001937445_02159 | gene | open | 17524-19332 | |||
| 4402 | MSKS01000042.1 | GCA001937445_02160 | gene | open | 19612-21297 | amyA | ||
| 4403 | MSKS01000042.1 | GCA001937445_02161 | gene | open | 21401-23452 | nagE | ||
| 4404 | MSKS01000042.1 | GCA001937445_02162 | gene | open | 23619-24350 | mngR | ||
| 4405 | MSKS01000042.1 | GCA001937445_02163 | gene | open | 24723-25403 | dhaL | ||
| 4406 | MSKS01000042.1 | GCA001937445_02164 | gene | open | 25489-25929 | ndk | ||
| 4407 | MSKS01000042.1 | GCA001937445_02165 | gene | open | 26056-27300 | natB | ||
| 4408 | MSKS01000042.1 | GCA001937445_02166 | gene | open | 27300-28247 | |||
| 4409 | MSKS01000042.1 | GCA001937445_02167 | gene | open | 28280-32218 | |||
| 4410 | MSKS01000042.1 | GCA001937445_02168 | gene | open | 32380-32754 | |||
| 4411 | MSKS01000042.1 | GCA001937445_02169 | gene | open | 33112-34272 | ftsY | ||
| 4412 | MSKS01000042.1 | GCA001937445_02170 | gene | open | 34403-35014 | citB | ||
| 4413 | MSKS01000042.1 | GCA001937445_02171 | gene | open | 35093-36250 | |||
| 4414 | MSKS01000042.1 | GCA001937445_02172 | gene | open | 36279-37148 | |||
| 4415 | MSKS01000042.1 | GCA001937445_02173 | gene | open | 37145-38137 | |||
| 4416 | MSKS01000042.1 | GCA001937445_02174 | gene | open | 38501-40189 | ffh | ||
| 4417 | MSKS01000042.1 | GCA001937445_02175 | gene | open | 40204-40815 | citB | ||
| 4418 | MSKS01000042.1 | GCA001937445_02176 | gene | open | 40812-41912 | |||
| 4419 | MSKS01000042.1 | GCA001937445_02177 | gene | open | 42041-42919 | |||
| 4420 | MSKS01000042.1 | GCA001937445_02178 | gene | open | 42970-43989 | rbbA | ||
| 4421 | MSKS01000042.1 | GCA001937445_02179 | gene | open | 44103-45260 | |||
| 4422 | MSKS01000042.1 | GCA001937445_02180 | gene | open | 45835-46452 | |||
| 4423 | MSKS01000042.1 | GCA001937445_02181 | gene | open | 46454-46690 | ylqC | ||
| 4424 | MSKS01000042.1 | GCA001937445_02182 | gene | open | 47001-47549 | rimM | ||
| 4425 | MSKS01000042.1 | GCA001937445_02183 | gene | open | 47546-48967 | trmD | ||
| 4426 | MSKS01000042.1 | GCA001937445_02184 | gene | open | 48964-49878 | lepB | ||
| 4427 | MSKS01000042.1 | GCA001937445_02185 | gene | open | 50122-50469 | rplS | ||
| 4428 | MSKS01000042.1 | GCA001937445_02186 | gene | open | 50581-51801 | lepB | ||
| 4429 | MSKS01000042.1 | GCA001937445_02187 | gene | open | 51798-52520 | |||
| 4430 | MSKS01000042.1 | GCA001937445_02188 | gene | open | 52532-52933 | |||
| 4431 | MSKS01000042.1 | GCA001937445_02189 | gene | open | 53097-53657 | yraN | ||
| 4432 | MSKS01000042.1 | GCA001937445_02190 | gene | open | 53648-55219 | yifB | ||
| 4433 | MSKS01000042.1 | GCA001937445_02191 | gene | open | 55216-56595 | dprA | ||
| 4434 | MSKS01000042.1 | GCA001937445_02192 | gene | open | 56773-57696 | xerC | ||
| 4435 | MSKS01000042.1 | GCA001937445_02193 | gene | open | 57724-58377 | |||
| 4436 | MSKS01000042.1 | GCA001937445_02194 | gene | open | 59034-59882 | rpsB | ||
| 4437 | MSKS01000042.1 | GCA001937445_02195 | gene | open | 59990-60829 | tsf | ||
| 4438 | MSKS01000042.1 | GCA001937445_02196 | gene | open | 61094-61846 | pyrH | ||
| 4439 | MSKS01000042.1 | GCA001937445_02197 | gene | open | 62010-62567 | frr | ||
| 4440 | MSKS01000042.1 | GCA001937445_02198 | gene | open | 62632-63570 | cdsA | ||
| 4441 | MSKS01000042.1 | GCA001937445_02199 | gene | open | 63643-64905 | rlmN | ||
| 4442 | MSKS01000042.1 | GCA001937445_02200 | gene | open | 64902-65447 | |||
| 4443 | MSKS01000042.1 | GCA001937445_02201 | gene | open | 65480-66778 | dxr | ||
| 4444 | MSKS01000042.1 | GCA001937445_02202 | gene | open | 66775-68109 | |||
| 4445 | MSKS01000042.1 | GCA001937445_02203 | gene | open | 68245-69393 | ispG | ||
| 4446 | MSKS01000042.1 | GCA001937445_02204 | gene | open | 69443-70432 | |||
| 4447 | MSKS01000042.1 | GCA001937445_02205 | gene | open | 70566-72401 | proS | ||
| 4448 | MSKS01000042.1 | GCA001937445_02206 | gene | open | 72929-74305 | |||
| 4449 | MSKS01000042.1 | GCA001937445_02207 | gene | open | 74387-75244 | |||
| 4450 | MSKS01000042.1 | GCA001937445_02208 | gene | open | 75810-76046 | |||
| 4451 | MSKS01000042.1 | GCA001937445_02209 | gene | open | 76048-77097 | |||
| 4452 | MSKS01000042.1 | GCA001937445_02210 | gene | open | 77212-77730 | rimP | ||
| 4453 | MSKS01000042.1 | GCA001937445_02211 | gene | open | 77937-78965 | nusA | ||
| 4454 | MSKS01000042.1 | GCA001937445_02212 | gene | open | 79084-79416 | ylxR | ||
| 4455 | MSKS01000042.1 | GCA001937445_02213 | gene | open | 79508-82456 | infB | ||
| 4456 | MSKS01000042.1 | GCA001937445_02214 | gene | open | 82573-84144 | ydhU | ||
| 4457 | MSKS01000042.1 | GCA001937445_02215 | gene | open | 84509-86851 | norB | ||
| 4458 | MSKS01000042.1 | GCA001937445_02216 | gene | open | 86851-87771 | |||
| 4459 | MSKS01000042.1 | GCA001937445_02217 | gene | open | 87822-88622 | hflC | ||
| 4460 | MSKS01000042.1 | GCA001937445_02218 | gene | open | 88597-89589 | rarD | ||
| 4461 | MSKS01000042.1 | GCA001937445_02219 | gene | open | 89787-90284 | rbfA | ||
| 4462 | MSKS01000042.1 | GCA001937445_02220 | gene | open | 90281-91396 | truB | ||
| 4463 | MSKS01000042.1 | GCA001937445_02221 | gene | open | 91468-91770 | |||
| 4464 | MSKS01000042.1 | GCA001937445_02222 | gene | open | 91793-92614 | |||
| 4465 | MSKS01000042.1 | GCA001937445_02223 | gene | open | 92626-92778 | |||
| 4466 | MSKS01000043.1 | GCA001937445_02224 | CDS | open | 219-1325 | _na 368_aa | ispA | Geranylgeranyl pyrophosphate synthase |
| 4467 | MSKS01000043.1 | GCA001937445_02225 | CDS | open | 1322-2935 | _na 537_aa | nuoN | NADH-quinone oxidoreductase subunit NuoN |
| 4468 | MSKS01000043.1 | GCA001937445_02226 | CDS | open | 2932-4536 | _na 534_aa | nuoM | NADH-quinone oxidoreductase subunit M |
| 4469 | MSKS01000043.1 | GCA001937445_02227 | CDS | open | 4550-6544 | _na 664_aa | nuoL | NADH-quinone oxidoreductase subunit L |
| 4470 | MSKS01000043.1 | GCA001937445_02228 | CDS | open | 6562-6867 | _na 101_aa | nuoK | NADH-quinone oxidoreductase subunit NuoK |
| 4471 | MSKS01000043.1 | GCA001937445_02229 | CDS | open | 6864-7862 | _na 332_aa | NADH-quinone oxidoreductase subunit J | |
| 4472 | MSKS01000043.1 | GCA001937445_02230 | CDS | open | 7859-8569 | _na 236_aa | nuoI | NADH-quinone oxidoreductase subunit NuoI |
| 4473 | MSKS01000043.1 | GCA001937445_02231 | CDS | open | 8562-10208 | _na 548_aa | nuoH | NADH-quinone oxidoreductase subunit NuoH |
| 4474 | MSKS01000043.1 | GCA001937445_02232 | CDS | open | 10205-12952 | _na 915_aa | nuoG | NADH-quinone oxidoreductase subunit G |
| 4475 | MSKS01000043.1 | GCA001937445_02233 | CDS | open | 12956-14287 | _na 443_aa | nuoF | NADH-quinone oxidoreductase subunit NuoF |
| 4476 | MSKS01000043.1 | GCA001937445_02234 | CDS | open | 14284-15054 | _na 256_aa | nuoE | NADH-quinone oxidoreductase subunit NuoE |
| 4477 | MSKS01000043.1 | GCA001937445_02235 | CDS | open | 15054-16442 | _na 462_aa | nuoD | NADH-quinone oxidoreductase subunit D |
| 4478 | MSKS01000043.1 | GCA001937445_02236 | CDS | open | 16442-17218 | _na 258_aa | nuoC | NADH-quinone oxidoreductase subunit C |
| 4479 | MSKS01000043.1 | GCA001937445_02237 | CDS | open | 17215-17838 | _na 207_aa | nuoB | NADH-quinone oxidoreductase subunit B |
| 4480 | MSKS01000043.1 | GCA001937445_02238 | CDS | open | 17892-18251 | _na 119_aa | nuoA | NADH-quinone oxidoreductase subunit |
| 4481 | MSKS01000043.1 | GCA001937445_02239 | CDS | open | 18248-19549 | _na 433_aa | fixC | FAD-binding domain-containing protein |
| 4482 | MSKS01000043.1 | GCA001937445_02240 | CDS | open | 19915-20652 | _na 245_aa | ubiE | demethylmenaquinone methyltransferase |
| 4483 | MSKS01000043.1 | GCA001937445_02241 | CDS | open | 20701-22062 | _na 453_aa | isochorismate synthase | |
| 4484 | MSKS01000043.1 | GCA001937445_02242 | CDS | open | 22125-22757 | _na 210_aa | DUF421 domain-containing protein | |
| 4485 | MSKS01000043.1 | GCA001937445_02224 | gene | open | 219-1325 | ispA | ||
| 4486 | MSKS01000043.1 | GCA001937445_02225 | gene | open | 1322-2935 | nuoN | ||
| 4487 | MSKS01000043.1 | GCA001937445_02226 | gene | open | 2932-4536 | nuoM | ||
| 4488 | MSKS01000043.1 | GCA001937445_02227 | gene | open | 4550-6544 | nuoL | ||
| 4489 | MSKS01000043.1 | GCA001937445_02228 | gene | open | 6562-6867 | nuoK | ||
| 4490 | MSKS01000043.1 | GCA001937445_02229 | gene | open | 6864-7862 | |||
| 4491 | MSKS01000043.1 | GCA001937445_02230 | gene | open | 7859-8569 | nuoI | ||
| 4492 | MSKS01000043.1 | GCA001937445_02231 | gene | open | 8562-10208 | nuoH | ||
| 4493 | MSKS01000043.1 | GCA001937445_02232 | gene | open | 10205-12952 | nuoG | ||
| 4494 | MSKS01000043.1 | GCA001937445_02233 | gene | open | 12956-14287 | nuoF | ||
| 4495 | MSKS01000043.1 | GCA001937445_02234 | gene | open | 14284-15054 | nuoE | ||
| 4496 | MSKS01000043.1 | GCA001937445_02235 | gene | open | 15054-16442 | nuoD | ||
| 4497 | MSKS01000043.1 | GCA001937445_02236 | gene | open | 16442-17218 | nuoC | ||
| 4498 | MSKS01000043.1 | GCA001937445_02237 | gene | open | 17215-17838 | nuoB | ||
| 4499 | MSKS01000043.1 | GCA001937445_02238 | gene | open | 17892-18251 | nuoA | ||
| 4500 | MSKS01000043.1 | GCA001937445_02239 | gene | open | 18248-19549 | fixC |

