HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Haemophilus parainfluenzae (GCA_001949885.1)

Select a Genome:
BAKTA Annotations for GCA_001949885.1
Genome Selected: Haemophilus parainfluenzae
ContigsBases CDSrRNA tmRNAtRNA
21 1978057 1906 5 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3968 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3968 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 MPJK01000012.1 GCA001949885_00694 gene open 110315-111028
1502 MPJK01000012.1 GCA001949885_00695 gene open 111110-112054 tehA
1503 MPJK01000012.1 GCA001949885_00696 gene open 112212-113501 serS
1504 MPJK01000012.1 GCA001949885_00697 gene open 113740-113958
1505 MPJK01000012.1 GCA001949885_00698 gene open 114010-114144
1506 MPJK01000012.1 GCA001949885_00699 gene open 114144-114944
1507 MPJK01000012.1 GCA001949885_00700 gene open 115078-115740
1508 MPJK01000012.1 GCA001949885_00701 gene open 115756-117009
1509 MPJK01000012.1 GCA001949885_00702 gene open 117075-117923
1510 MPJK01000012.1 GCA001949885_00703 gene open 117963-120107 dnaX
1511 MPJK01000012.1 GCA001949885_00704 gene open 120124-120666 apt
1512 MPJK01000012.1 GCA001949885_00705 gene open 120780-121739 lpxM
1513 MPJK01000012.1 GCA001949885_00706 gene open 121749-122516
1514 MPJK01000012.1 GCA001949885_00707 gene open 122527-123399 mepA
1515 MPJK01000012.1 GCA001949885_00708 gene open 123465-124538 aroC
1516 MPJK01000012.1 GCA001949885_00709 gene open 124554-127898 mscK
1517 MPJK01000012.1 GCA001949885_00710 gene open 127915-129264 menE
1518 MPJK01000012.1 GCA001949885_00711 gene open 129269-129910 seqA
1519 MPJK01000012.1 GCA001949885_00712 gene open 129981-130766
1520 MPJK01000012.1 GCA001949885_00713 gene open 130891-131415 fldA
1521 MPJK01000012.1 GCA001949885_00714 gene open 131449-131883 fur
1522 MPJK01000012.1 GCA001949885_00715 gene open 131976-133742 cysI
1523 MPJK01000012.1 GCA001949885_00716 gene open 133759-135552
1524 MPJK01000012.1 GCA001949885_00717 gene open 135610-136893
1525 MPJK01000012.1 GCA001949885_00718 gene open 137120-138043 cysD
1526 MPJK01000012.1 GCA001949885_00719 gene open 138064-138798
1527 MPJK01000012.1 GCA001949885_00720 gene open 138809-140239 cysG
1528 MPJK01000012.1 GCA001949885_00721 gene open 140251-141258
1529 MPJK01000012.1 GCA001949885_00722 gene open 141516-142337 cysT
1530 MPJK01000012.1 GCA001949885_00723 gene open 142347-143162 cysW
1531 MPJK01000012.1 GCA001949885_00724 gene open 143180-144256
1532 MPJK01000012.1 GCA001949885_00725 gene open 144499-149646
1533 MPJK01000012.1 GCA001949885_00726 gene open 149779-150030
1534 MPJK01000012.1 GCA001949885_00727 gene open 150108-150395
1535 MPJK01000012.1 GCA001949885_00728 gene open 150735-152069 argG
1536 MPJK01000012.1 GCA001949885_00729 gene open 152121-152951
1537 MPJK01000012.1 GCA001949885_00730 gene open 153024-153884 purC
1538 MPJK01000012.1 GCA001949885_00731 gene open 154106-155689 prfC
1539 MPJK01000012.1 GCA001949885_00736 gene open 156339-157082
1540 MPJK01000012.1 GCA001949885_00737 gene open 157066-158388 hemA
1541 MPJK01000012.1 GCA001949885_00738 gene open 158524-159225 gloB
1542 MPJK01000012.1 GCA001949885_00739 gene open 159254-159952
1543 MPJK01000012.1 GCA001949885_00740 gene open 159953-160291
1544 MPJK01000012.1 GCA001949885_00741 gene open 160471-162234 ycaO
1545 MPJK01000012.1 GCA001949885_00742 gene open 162389-165034 gyrA
1546 MPJK01000012.1 GCA001949885_00743 gene open 165133-165690
1547 MPJK01000012.1 GCA001949885_00744 gene open 165714-166319
1548 MPJK01000012.1 GCA001949885_00745 gene open 166316-166771
1549 MPJK01000012.1 GCA001949885_00746 gene open 166824-167738 hflC
1550 MPJK01000012.1 GCA001949885_00747 gene open 167784-169232 modF
1551 MPJK01000012.1 GCA001949885_00748 gene open 169290-170531 sstT
1552 MPJK01000012.1 GCA001949885_00749 gene open 170808-171254 lexA
1553 MPJK01000012.1 GCA001949885_00750 gene open 171333-171884
1554 MPJK01000012.1 GCA001949885_00751 gene open 172046-173470 lpdA
1555 MPJK01000012.1 GCA001949885_00752 gene open 173563-175461 aceF
1556 MPJK01000012.1 GCA001949885_00753 gene open 175551-178217 aceE
1557 MPJK01000012.1 GCA001949885_00754 gene open 178525-178983 mgsA
1558 MPJK01000012.1 GCA001949885_00755 gene open 179039-180541
1559 MPJK01000012.1 GCA001949885_00756 gene open 180809-182710 dnaK
1560 MPJK01000012.1 GCA001949885_00757 gene open 182947-183351
1561 MPJK01000012.1 GCA001949885_00758 gene open 183414-184550 dnaJ
1562 MPJK01000012.1 GCA001949885_00759 gene open 184625-185680 modC
1563 MPJK01000012.1 GCA001949885_00760 gene open 185667-186383 modB
1564 MPJK01000012.1 GCA001949885_00761 gene open 186478-187242 modA
1565 MPJK01000012.1 GCA001949885_00762 gene open 187377-188144
1566 MPJK01000012.1 GCA001949885_00763 gene open 188195-188788 yfbR
1567 MPJK01000012.1 GCA001949885_00764 gene open 188798-189820 degS
1568 MPJK01000012.1 GCA001949885_00765 gene open 189824-190954 ribD
1569 MPJK01000012.1 GCA001949885_00766 gene open 190956-191405 nrdR
1570 MPJK01000012.1 GCA001949885_00767 gene open 191483-194842 recC
1571 MPJK01000012.1 GCA001949885_00768 gene open 194880-195146
1572 MPJK01000012.1 GCA001949885_00769 gene open 195160-195846
1573 MPJK01000012.1 GCA001949885_00770 gene open 195843-196559
1574 MPJK01000012.1 GCA001949885_00771 gene open 196556-197074
1575 MPJK01000012.1 GCA001949885_00772 gene open 197283-198074 suhB
1576 MPJK01000012.1 GCA001949885_00773 gene open 198120-199136 bioB
1577 MPJK01000012.1 GCA001949885_00774 gene open 199210-199839 thiQ
1578 MPJK01000012.1 GCA001949885_00775 gene open 199832-201436 thiP
1579 MPJK01000012.1 GCA001949885_00776 gene open 201442-202440 thiB
1580 MPJK01000012.1 GCA001949885_00777 gene open 202713-203039 grxD
1581 MPJK01000012.1 GCA001949885_00778 gene open 203115-203915
1582 MPJK01000012.1 GCA001949885_00779 gene open 203908-204357
1583 MPJK01000012.1 GCA001949885_00780 gene open 204367-204948 lemA
1584 MPJK01000012.1 GCA001949885_00781 gene open 205048-206121 ompA
1585 MPJK01000012.1 GCA001949885_00782 gene open 206522-209599
1586 MPJK01000012.1 GCA001949885_00783 gene open 209683-212547 valS
1587 MPJK01000012.1 GCA001949885_00784 gene open 212600-213112
1588 MPJK01000012.1 GCA001949885_00785 gene open 213102-213428 yqfB
1589 MPJK01000012.1 GCA001949885_00786 gene open 213497-213928
1590 MPJK01000012.1 GCA001949885_00787 gene open 213873-214103
1591 MPJK01000012.1 GCA001949885_00788 gene open 214167-215561 fumC
1592 MPJK01000012.1 GCA001949885_00789 gene open 215661-216275
1593 MPJK01000012.1 GCA001949885_00790 gene open 216314-217213
1594 MPJK01000012.1 GCA001949885_00791 gene open 217345-217608 grxA
1595 MPJK01000012.1 GCA001949885_00792 gene open 217665-220691
1596 MPJK01000012.1 GCA001949885_00793 gene open 220814-222013 manA
1597 MPJK01000012.1 GCA001949885_00794 gene open 222086-222586 crr
1598 MPJK01000012.1 GCA001949885_00795 gene open 222646-224373 ptsI
1599 MPJK01000012.1 GCA001949885_00796 gene open 224453-224710 ptsH
1600 MPJK01000012.1 GCA001949885_00797 gene open 224863-225900 rsgA
1601 MPJK01000012.1 GCA001949885_00798 gene open 225977-226525 orn
1602 MPJK01000012.1 GCA001949885_00801 gene open 226905-227375 tsaE
1603 MPJK01000012.1 GCA001949885_00802 gene open 227387-229000
1604 MPJK01000012.1 GCA001949885_00803 gene open 229009-230853 mutL
1605 MPJK01000012.1 GCA001949885_00804 gene open 230855-231808 miaA
1606 MPJK01000012.1 GCA001949885_00805 gene open 231812-234745 glnE
1607 MPJK01000012.1 GCA001949885_00732 gene open 155825-155899 trnQ
1608 MPJK01000012.1 GCA001949885_00733 gene open 155947-156021 trnQ
1609 MPJK01000012.1 GCA001949885_00734 gene open 156049-156133 trnL
1610 MPJK01000012.1 GCA001949885_00735 gene open 156139-156215 trnM
1611 MPJK01000012.1 GCA001949885_00799 gene open 226619-226694 trnG
1612 MPJK01000012.1 GCA001949885_00800 gene open 226714-226789 trnG
1613 MPJK01000012.1 GCA001949885_00732 tRNA open 155825-155899 trnQ tRNA-Gln(ttg)
1614 MPJK01000012.1 GCA001949885_00733 tRNA open 155947-156021 trnQ tRNA-Gln(ttg)
1615 MPJK01000012.1 GCA001949885_00734 tRNA open 156049-156133 trnL tRNA-Leu(tag)
1616 MPJK01000012.1 GCA001949885_00735 tRNA open 156139-156215 trnM tRNA-Met(cat)
1617 MPJK01000012.1 GCA001949885_00799 tRNA open 226619-226694 trnG tRNA-Gly(gcc)
1618 MPJK01000012.1 GCA001949885_00800 tRNA open 226714-226789 trnG tRNA-Gly(gcc)
1619 MPJK01000013.1 GCA001949885_00806 CDS open 261-1544 _na     427_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1620 MPJK01000013.1 GCA001949885_00807 CDS open 1666-2730 _na     354_aa wecA undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase
1621 MPJK01000013.1 GCA001949885_00806 gene open 261-1544 hemL
1622 MPJK01000013.1 GCA001949885_00807 gene open 1666-2730 wecA
1623 MPJK01000013.1 GCA001949885_00808 gene open 2913-2989 trnR
1624 MPJK01000013.1 GCA001949885_00809 gene open 3020-3095 trnH
1625 MPJK01000013.1 GCA001949885_00810 gene open 3120-3196 trnP
1626 MPJK01000013.1 GCA001949885_00808 tRNA open 2913-2989 trnR tRNA-Arg(ccg)
1627 MPJK01000013.1 GCA001949885_00809 tRNA open 3020-3095 trnH tRNA-His(gtg)
1628 MPJK01000013.1 GCA001949885_00810 tRNA open 3120-3196 trnP tRNA-Pro(tgg)
1629 MPJK01000014.1 GCA001949885_00811 CDS open 29-1171 _na     380_aa tuf elongation factor Tu
1630 MPJK01000014.1 GCA001949885_00811 gene open 29-1171 tuf
1631 MPJK01000015.1 GCA001949885_00863 gene open 50973-51170 6S
1632 MPJK01000015.1 GCA001949885_00863 ncRNA open 50973-51170 6S / SsrS RNA
1633 MPJK01000015.1 regulatory_region open 8861-8982 Glycine riboswitch aptamer
1634 MPJK01000015.1 repeat_region open 194318-194868 CRISPR array with 8 repeats of length 37%2C consensus sequence GTCGAAAGACATTGCCCTGTTCCAAAGGGATTGAGAC and spacer length 35
1635 MPJK01000015.1 GCA001949885_00812 CDS open 54-794 _na     246_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
1636 MPJK01000015.1 GCA001949885_00813 CDS open 831-1181 _na     116_aa rplS 50S ribosomal protein L19
1637 MPJK01000015.1 GCA001949885_00814 CDS open 1242-2594 _na     450_aa rho transcription termination factor Rho
1638 MPJK01000015.1 GCA001949885_00815 CDS open 2735-4108 _na     457_aa argH argininosuccinate lyase
1639 MPJK01000015.1 GCA001949885_00816 CDS open 4269-4760 _na     163_aa yajQ YajQ family cyclic di-GMP-binding protein
1640 MPJK01000015.1 GCA001949885_00817 CDS open 4781-5725 _na     314_aa serB phosphoserine phosphatase
1641 MPJK01000015.1 GCA001949885_00818 CDS open 5794-6471 _na     225_aa ahpA Hemolysin regulation protein AhpA
1642 MPJK01000015.1 GCA001949885_00819 CDS open 6557-8554 _na     665_aa tkt transketolase
1643 MPJK01000015.1 GCA001949885_00820 CDS open 9070-10440 _na     456_aa Sodium:alanine symporter
1644 MPJK01000015.1 GCA001949885_00821 CDS open 10682-11005 _na     107_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1645 MPJK01000015.1 GCA001949885_00822 CDS open 11050-11193 _na     47_aa hypothetical protein
1646 MPJK01000015.1 GCA001949885_00823 CDS open 11249-12643 _na     464_aa mltF membrane-bound lytic murein transglycosylase MltF
1647 MPJK01000015.1 GCA001949885_00824 CDS open 12739-14589 _na     616_aa deaD ATP-dependent RNA helicase DeaD
1648 MPJK01000015.1 GCA001949885_00825 CDS open 14665-15606 _na     313_aa nlpI lipoprotein NlpI
1649 MPJK01000015.1 GCA001949885_00826 CDS open 15671-17809 _na     712_aa pnp polyribonucleotide nucleotidyltransferase
1650 MPJK01000015.1 GCA001949885_00827 CDS open 18053-18520 _na     155_aa nanQ N-acetylneuraminate anomerase
1651 MPJK01000015.1 GCA001949885_00828 CDS open 18573-18794 _na     73_aa tusA UPF0033 domain-containing protein
1652 MPJK01000015.1 GCA001949885_00829 CDS open 18804-19847 _na     347_aa Putative inner membrane protein
1653 MPJK01000015.1 GCA001949885_00830 CDS open 20016-21392 _na     458_aa Thiosulfate sulfur transferase
1654 MPJK01000015.1 GCA001949885_00831 CDS open 21407-22393 _na     328_aa Transport system permease
1655 MPJK01000015.1 GCA001949885_00832 CDS open 22521-23825 _na     434_aa UPF0597 protein HMPREF9417_0660
1656 MPJK01000015.1 GCA001949885_00833 CDS open 23844-24158 _na     104_aa Cupin domain protein
1657 MPJK01000015.1 GCA001949885_00834 CDS open 24170-26968 _na     932_aa polA DNA polymerase I
1658 MPJK01000015.1 GCA001949885_00835 CDS open 27129-27434 _na     101_aa zapA Cell division protein ZapA
1659 MPJK01000015.1 GCA001949885_00836 CDS open 27483-28223 _na     246_aa queH Epoxyqueuosine reductase QueH
1660 MPJK01000015.1 GCA001949885_00837 CDS open 28225-29220 _na     331_aa ispB octaprenyl diphosphate synthase
1661 MPJK01000015.1 GCA001949885_00838 CDS open 29443-29754 _na     103_aa rplU 50S ribosomal protein L21
1662 MPJK01000015.1 GCA001949885_00839 CDS open 29775-30032 _na     85_aa rpmA 50S ribosomal protein L27
1663 MPJK01000015.1 GCA001949885_00840 CDS open 30209-31126 _na     305_aa eamA EamA domain-containing protein
1664 MPJK01000015.1 GCA001949885_00841 CDS open 31154-32326 _na     390_aa cgtA Obg family GTPase CgtA
1665 MPJK01000015.1 GCA001949885_00842 CDS open 32377-32514 _na     45_aa ykgO type B 50S ribosomal protein L36
1666 MPJK01000015.1 GCA001949885_00843 CDS open 32524-32790 _na     88_aa rpmE2 type B 50S ribosomal protein L31
1667 MPJK01000015.1 GCA001949885_00844 CDS open 32951-33433 _na     160_aa smpB SsrA-binding protein SmpB
1668 MPJK01000015.1 GCA001949885_00845 CDS open 33548-34258 _na     236_aa arcA two-component system response regulator ArcA
1669 MPJK01000015.1 GCA001949885_00846 CDS open 34436-36205 _na     589_aa dsbD Thiol:disulfide interchange protein DsbD
1670 MPJK01000015.1 GCA001949885_00847 CDS open 36323-36721 _na     132_aa Membrane protein
1671 MPJK01000015.1 GCA001949885_00848 CDS open 36903-38501 _na     532_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1672 MPJK01000015.1 GCA001949885_00849 CDS open 38597-39886 _na     429_aa purD Phosphoribosylamine--glycine ligase
1673 MPJK01000015.1 GCA001949885_00850 CDS open 39911-41134 _na     407_aa DUF711 domain-containing protein
1674 MPJK01000015.1 GCA001949885_00851 CDS open 41198-41767 _na     189_aa Lipoprotein
1675 MPJK01000015.1 GCA001949885_00852 CDS open 41883-43145 _na     420_aa glyA Serine hydroxymethyltransferase
1676 MPJK01000015.1 GCA001949885_00853 CDS open 43145-43420 _na     91_aa DUF1294 domain-containing protein
1677 MPJK01000015.1 GCA001949885_00854 CDS open 43495-44028 _na     177_aa dsbB disulfide bond formation protein DsbB
1678 MPJK01000015.1 GCA001949885_00855 CDS open 44047-45585 _na     512_aa nhaB Na(+)/H(+) antiporter NhaB
1679 MPJK01000015.1 GCA001949885_00856 CDS open 45719-46447 _na     242_aa fadR fatty acid metabolism transcriptional regulator FadR
1680 MPJK01000015.1 GCA001949885_00857 CDS open 46506-47240 _na     244_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
1681 MPJK01000015.1 GCA001949885_00858 CDS open 47240-47800 _na     186_aa YqgE/AlgH family protein
1682 MPJK01000015.1 GCA001949885_00859 CDS open 47800-48219 _na     139_aa ruvX Holliday junction resolvase RuvX
1683 MPJK01000015.1 GCA001949885_00860 CDS open 48268-49005 _na     245_aa pgeF peptidoglycan editing factor PgeF
1684 MPJK01000015.1 GCA001949885_00861 CDS open 49007-49981 _na     324_aa rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
1685 MPJK01000015.1 GCA001949885_00862 CDS open 50091-50882 _na     263_aa bamD Outer membrane protein assembly factor BamD
1686 MPJK01000015.1 GCA001949885_00864 CDS open 51101-51769 _na     222_aa 5-formyltetrahydrofolate cyclo-ligase
1687 MPJK01000015.1 GCA001949885_00865 CDS open 51905-54475 _na     856_aa clpB ATP-dependent chaperone ClpB
1688 MPJK01000015.1 GCA001949885_00866 CDS open 54588-55181 _na     197_aa mog molybdopterin adenylyltransferase
1689 MPJK01000015.1 GCA001949885_00867 CDS open 55183-55521 _na     112_aa glnB nitrogen regulatory protein P-II
1690 MPJK01000015.1 GCA001949885_00868 CDS open 55521-56561 _na     346_aa tqsA Autoinducer 2 exporter TqsA
1691 MPJK01000015.1 GCA001949885_00869 CDS open 56644-57618 _na     324_aa secF Protein-export membrane protein SecF
1692 MPJK01000015.1 GCA001949885_00870 CDS open 57629-59479 _na     616_aa secD Protein translocase subunit SecD
1693 MPJK01000015.1 GCA001949885_00871 CDS open 59503-59793 _na     96_aa yajC preprotein translocase subunit YajC
1694 MPJK01000015.1 GCA001949885_00872 CDS open 59896-60123 _na     75_aa UPF0033 domain-containing protein
1695 MPJK01000015.1 GCA001949885_00873 CDS open 60127-60639 _na     170_aa Hemerythrin HHE cation-binding domain-containing protein
1696 MPJK01000015.1 GCA001949885_00874 CDS open 60704-61852 _na     382_aa tgt tRNA guanosine(34) transglycosylase Tgt
1697 MPJK01000015.1 GCA001949885_00875 CDS open 61965-63056 _na     363_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1698 MPJK01000015.1 GCA001949885_00876 CDS open 63249-64628 _na     459_aa yegQ tRNA 5-hydroxyuridine modification protein YegQ
1699 MPJK01000015.1 GCA001949885_00877 CDS open 64808-66124 _na     438_aa nCS2 Putative permease HI_0125
1700 MPJK01000015.1 GCA001949885_00878 CDS open 66324-66854 _na     176_aa ppa Inorganic pyrophosphatase
1701 MPJK01000015.1 GCA001949885_00879 CDS open 67013-67201 _na     62_aa Transcriptional regulator
1702 MPJK01000015.1 GCA001949885_00880 CDS open 67402-67743 _na     113_aa hypothetical protein
1703 MPJK01000015.1 GCA001949885_00881 CDS open 67964-68611 _na     215_aa hypothetical protein
1704 MPJK01000015.1 GCA001949885_00882 CDS open 69040-69285 _na     81_aa S-formylglutathione hydrolase
1705 MPJK01000015.1 GCA001949885_00883 CDS open 69484-72708 _na     1074_aa Outer membrane autotransporter barrel domain protein
1706 MPJK01000015.1 GCA001949885_00884 CDS open 72913-73929 _na     338_aa galE UDP-glucose 4-epimerase
1707 MPJK01000015.1 GCA001949885_00885 CDS open 74010-75284 _na     424_aa AmpG-related permease
1708 MPJK01000015.1 GCA001949885_00886 CDS open 75383-76027 _na     214_aa adk adenylate kinase
1709 MPJK01000015.1 GCA001949885_00887 CDS open 76125-78149 _na     674_aa DUF945 domain-containing protein
1710 MPJK01000015.1 GCA001949885_00888 CDS open 78173-78265 _na     30_aa hypothetical protein
1711 MPJK01000015.1 GCA001949885_00889 CDS open 78223-79185 _na     320_aa lipA lipoyl synthase
1712 MPJK01000015.1 GCA001949885_00890 CDS open 79248-79889 _na     213_aa lipB lipoyl(octanoyl) transferase LipB
1713 MPJK01000015.1 GCA001949885_00891 CDS open 79891-80169 _na     92_aa ybeD DUF493 domain-containing protein
1714 MPJK01000015.1 GCA001949885_00892 CDS open 80277-81464 _na     395_aa serine-type D-Ala-D-Ala carboxypeptidase
1715 MPJK01000015.1 GCA001949885_00893 CDS open 81483-82343 _na     286_aa Rare lipoprotein A
1716 MPJK01000015.1 GCA001949885_00894 CDS open 82398-83513 _na     371_aa rodA rod shape-determining protein RodA
1717 MPJK01000015.1 GCA001949885_00895 CDS open 83513-85489 _na     658_aa mrdA penicillin-binding protein 2
1718 MPJK01000015.1 GCA001949885_00896 CDS open 85505-85972 _na     155_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
1719 MPJK01000015.1 GCA001949885_00897 CDS open 86012-86320 _na     102_aa rsfS ribosome silencing factor
1720 MPJK01000015.1 GCA001949885_00898 CDS open 86473-88122 _na     549_aa putative transporter
1721 MPJK01000015.1 GCA001949885_00899 CDS open 88289-90079 _na     596_aa Multidrug ABC transporter membrane protein/ATP-binding protein
1722 MPJK01000015.1 GCA001949885_00900 CDS open 90251-91306 _na     351_aa mreB Cell shape-determining protein MreB
1723 MPJK01000015.1 GCA001949885_00901 CDS open 91393-92457 _na     354_aa mreC rod shape-determining protein MreC
1724 MPJK01000015.1 GCA001949885_00902 CDS open 92457-92945 _na     162_aa mreD rod shape-determining protein MreD
1725 MPJK01000015.1 GCA001949885_00903 CDS open 92987-94246 _na     419_aa rhlB ATP-dependent RNA helicase RhlB
1726 MPJK01000015.1 GCA001949885_00904 CDS open 94357-94617 _na     86_aa N-acetyltransferase domain-containing protein
1727 MPJK01000015.1 GCA001949885_00905 CDS open 94614-94820 _na     68_aa yacG DNA gyrase inhibitor YacG
1728 MPJK01000015.1 GCA001949885_00906 CDS open 94813-95433 _na     206_aa coaE dephospho-CoA kinase
1729 MPJK01000015.1 GCA001949885_00907 CDS open 95520-96197 _na     225_aa Peptidase%2C A24 family
1730 MPJK01000015.1 GCA001949885_00908 CDS open 96194-97417 _na     407_aa Bacterial type II secretion system domain protein F
1731 MPJK01000015.1 GCA001949885_00909 CDS open 97426-98805 _na     459_aa Type II/IV secretion system protein
1732 MPJK01000015.1 GCA001949885_00910 CDS open 98812-99255 _na     147_aa ppdD prepilin peptidase-dependent pilin
1733 MPJK01000015.1 GCA001949885_00911 CDS open 99398-99949 _na     183_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
1734 MPJK01000015.1 GCA001949885_00912 CDS open 100446-101039 _na     197_aa rppH RNA pyrophosphohydrolase
1735 MPJK01000015.1 GCA001949885_00913 CDS open 101039-101833 _na     264_aa putative membrane transporter protein
1736 MPJK01000015.1 GCA001949885_00914 CDS open 101842-102651 _na     269_aa lgt prolipoprotein diacylglyceryl transferase
1737 MPJK01000015.1 GCA001949885_00915 CDS open 102662-103513 _na     283_aa thyA thymidylate synthase
1738 MPJK01000015.1 GCA001949885_00916 CDS open 103550-104041 _na     163_aa tadA tRNA adenosine(34) deaminase TadA
1739 MPJK01000015.1 GCA001949885_00917 CDS open 104038-104697 _na     219_aa ung uracil-DNA glycosylase
1740 MPJK01000015.1 GCA001949885_00918 CDS open 104963-105346 _na     127_aa grcA autonomous glycyl radical cofactor GrcA
1741 MPJK01000015.1 GCA001949885_00919 CDS open 105488-107311 _na     607_aa lepA translation elongation factor 4
1742 MPJK01000015.1 GCA001949885_00920 CDS open 107324-108373 _na     349_aa lepB signal peptidase I
1743 MPJK01000015.1 GCA001949885_00921 CDS open 108321-109058 _na     245_aa rnc ribonuclease III
1744 MPJK01000015.1 GCA001949885_00922 CDS open 109055-109969 _na     304_aa era GTPase Era
1745 MPJK01000015.1 GCA001949885_00923 CDS open 110048-110302 _na     84_aa CDP-alcohol phosphatidyltransferase family protein
1746 MPJK01000015.1 GCA001949885_00924 CDS open 110700-111053 _na     117_aa Transcriptional regulator
1747 MPJK01000015.1 GCA001949885_00925 CDS open 111129-112343 _na     404_aa alanine transaminase
1748 MPJK01000015.1 GCA001949885_00926 CDS open 112498-113778 _na     426_aa menF Isochorismate synthase MenF
1749 MPJK01000015.1 GCA001949885_00927 CDS open 113784-115490 _na     568_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
1750 MPJK01000015.1 GCA001949885_00928 CDS open 115527-116270 _na     247_aa menH 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase
1751 MPJK01000015.1 GCA001949885_00929 CDS open 116324-117640 _na     438_aa Transporter
1752 MPJK01000015.1 GCA001949885_00930 CDS open 117781-118875 _na     364_aa 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
1753 MPJK01000015.1 GCA001949885_00931 CDS open 118986-120188 _na     400_aa BaiN-like insert domain-containing protein
1754 MPJK01000015.1 GCA001949885_00932 CDS open 120192-121247 _na     351_aa nrfF heme lyase NrfEFG subunit NrfF
1755 MPJK01000015.1 GCA001949885_00933 CDS open 121249-121779 _na     176_aa dsbE Periplasmic protein thiol:disulfide oxidoreductase%2C DsbE subfamily
1756 MPJK01000015.1 GCA001949885_00934 CDS open 121772-123676 _na     634_aa nrfE Heme lyase NrfEFG subunit NrfE
1757 MPJK01000015.1 GCA001949885_00935 CDS open 123824-124789 _na     321_aa nrfD cytochrome c nitrite reductase subunit NrfD
1758 MPJK01000015.1 GCA001949885_00936 CDS open 124786-125463 _na     225_aa nrfC cytochrome c nitrite reductase Fe-S protein
1759 MPJK01000015.1 GCA001949885_00937 CDS open 125463-126128 _na     221_aa nrfB cytochrome c nitrite reductase pentaheme subunit
1760 MPJK01000015.1 GCA001949885_00938 CDS open 126201-127724 _na     507_aa nrfA ammonia-forming nitrite reductase cytochrome c552 subunit
1761 MPJK01000015.1 GCA001949885_00939 CDS open 128027-128746 _na     239_aa DUF554 domain-containing protein
1762 MPJK01000015.1 GCA001949885_00940 CDS open 128768-129583 _na     271_aa mutM DNA-formamidopyrimidine glycosylase
1763 MPJK01000015.1 GCA001949885_00941 CDS open 129656-129826 _na     56_aa rpmG 50S ribosomal protein L33
1764 MPJK01000015.1 GCA001949885_00942 CDS open 129838-130074 _na     78_aa rpmB 50S ribosomal protein L28
1765 MPJK01000015.1 GCA001949885_00943 CDS open 130293-131012 _na     239_aa radC DNA repair protein RadC
1766 MPJK01000015.1 GCA001949885_00944 CDS open 131160-132362 _na     400_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
1767 MPJK01000015.1 GCA001949885_00945 CDS open 132436-132891 _na     151_aa dut dUTP diphosphatase
1768 MPJK01000015.1 GCA001949885_00946 CDS open 132895-133548 _na     217_aa slmA nucleoid occlusion factor SlmA
1769 MPJK01000015.1 GCA001949885_00947 CDS open 133570-133788 _na     72_aa yheU YheU family protein
1770 MPJK01000015.1 GCA001949885_00948 CDS open 133805-134473 _na     222_aa crp cAMP-activated global transcriptional regulator CRP
1771 MPJK01000015.1 GCA001949885_00949 CDS open 134983-136449 _na     488_aa PTS system%2C N-acetylglucosamine-specific IIBC component
1772 MPJK01000015.1 GCA001949885_00950 CDS open 136668-137357 _na     229_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
1773 MPJK01000015.1 GCA001949885_00951 CDS open 137369-138244 _na     291_aa N-acetylmannosamine kinase
1774 MPJK01000015.1 GCA001949885_00952 CDS open 138288-139091 _na     267_aa Putative HTH-type transcriptional regulator
1775 MPJK01000015.1 GCA001949885_00953 CDS open 139228-140043 _na     271_aa nanA N-acetylneuraminate lyase
1776 MPJK01000015.1 GCA001949885_00954 CDS open 140136-140939 _na     267_aa nagB glucosamine-6-phosphate deaminase
1777 MPJK01000015.1 GCA001949885_00955 CDS open 140976-142121 _na     381_aa nagA N-acetylglucosamine-6-phosphate deacetylase
1778 MPJK01000015.1 GCA001949885_00956 CDS open 142185-143267 _na     360_aa recF DNA replication/repair protein RecF
1779 MPJK01000015.1 GCA001949885_00957 CDS open 143273-144373 _na     366_aa dnaN DNA polymerase III subunit beta
1780 MPJK01000015.1 GCA001949885_00958 CDS open 144384-145751 _na     455_aa dnaA chromosomal replication initiator protein DnaA
1781 MPJK01000015.1 GCA001949885_00959 CDS open 146070-146204 _na     44_aa rpmH 50S ribosomal protein L34
1782 MPJK01000015.1 GCA001949885_00960 CDS open 146250-146585 _na     111_aa rnpA ribonuclease P protein component
1783 MPJK01000015.1 GCA001949885_00961 CDS open 146540-146803 _na     87_aa yidD membrane protein insertion efficiency factor YidD
1784 MPJK01000015.1 GCA001949885_00962 CDS open 146803-148431 _na     542_aa yidC membrane protein insertase YidC
1785 MPJK01000015.1 GCA001949885_00963 CDS open 148559-149917 _na     452_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1786 MPJK01000015.1 GCA001949885_00964 CDS open 149970-150344 _na     124_aa mntP Putative manganese efflux pump MntP
1787 MPJK01000015.1 GCA001949885_00965 CDS open 150552-152429 _na     625_aa ppiD peptidylprolyl isomerase
1788 MPJK01000015.1 GCA001949885_00966 CDS open 152530-152880 _na     116_aa hinT purine nucleoside phosphoramidase
1789 MPJK01000015.1 GCA001949885_00967 CDS open 152880-153227 _na     115_aa DUF1425 domain-containing protein
1790 MPJK01000015.1 GCA001949885_00968 CDS open 153231-154274 _na     347_aa nagZ beta-N-acetylhexosaminidase
1791 MPJK01000015.1 GCA001949885_00969 CDS open 154271-155443 _na     390_aa rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC
1792 MPJK01000015.1 GCA001949885_00970 CDS open 155476-156309 _na     277_aa Putative ABC-type chelated iron transport system%2C permease component
1793 MPJK01000015.1 GCA001949885_00971 CDS open 156302-157153 _na     283_aa Iron ABC transporter permease
1794 MPJK01000015.1 GCA001949885_00972 CDS open 157157-158053 _na     298_aa Iron ABC transporter permease
1795 MPJK01000015.1 GCA001949885_00973 CDS open 158053-158934 _na     293_aa ABC transporter%2C substrate-binding protein
1796 MPJK01000015.1 GCA001949885_00974 CDS open 159090-159965 _na     291_aa D-alanyl-D-alanine endopeptidase
1797 MPJK01000015.1 GCA001949885_00975 CDS open 160267-161415 _na     382_aa rlmN bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN
1798 MPJK01000015.1 GCA001949885_00976 CDS open 161485-162027 _na     180_aa pilW type IV pilus biogenesis/stability protein PilW
1799 MPJK01000015.1 GCA001949885_00977 CDS open 162095-163090 _na     331_aa HTH cro/C1-type domain-containing protein
1800 MPJK01000015.1 GCA001949885_00978 CDS open 163109-164215 _na     368_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
1801 MPJK01000015.1 GCA001949885_00979 CDS open 164225-165496 _na     423_aa hisS histidine--tRNA ligase
1802 MPJK01000015.1 GCA001949885_00980 CDS open 165515-166129 _na     204_aa Ancillary SecYEG translocon subunit
1803 MPJK01000015.1 GCA001949885_00981 CDS open 166181-166624 _na     147_aa Isoprenylcysteine carboxylmethyltransferase family protein
1804 MPJK01000015.1 GCA001949885_00982 CDS open 166680-167327 _na     215_aa sodA superoxide dismutase [Mn]
1805 MPJK01000015.1 GCA001949885_00983 CDS open 167611-168252 _na     213_aa ccmA cytochrome c biogenesis heme-transporting ATPase CcmA
1806 MPJK01000015.1 GCA001949885_00984 CDS open 168259-168924 _na     221_aa ccmB heme exporter protein CcmB
1807 MPJK01000015.1 GCA001949885_00985 CDS open 168993-169733 _na     246_aa Heme exporter protein C
1808 MPJK01000015.1 GCA001949885_00986 CDS open 169763-169966 _na     67_aa ccmD heme exporter protein CcmD
1809 MPJK01000015.1 GCA001949885_00987 CDS open 169963-170493 _na     176_aa ccmE cytochrome c maturation protein CcmE
1810 MPJK01000015.1 GCA001949885_00988 CDS open 170493-172442 _na     649_aa ccmF Heme lyase%2C CcmF subunit
1811 MPJK01000015.1 GCA001949885_00989 CDS open 172495-173040 _na     181_aa Periplasmic thioredoxin of cytochrome c-type biogenesis
1812 MPJK01000015.1 GCA001949885_00990 CDS open 173040-173504 _na     154_aa Cytochrome c-type biogenesis protein
1813 MPJK01000015.1 GCA001949885_00991 CDS open 173504-174421 _na     305_aa ccmH2 Cytochrome c maturation heme lyase subunit CcmH2
1814 MPJK01000015.1 GCA001949885_00992 CDS open 174421-174819 _na     132_aa VOC family protein
1815 MPJK01000015.1 GCA001949885_00993 CDS open 174839-175432 _na     197_aa hypothetical protein
1816 MPJK01000015.1 GCA001949885_00994 CDS open 175438-175734 _na     98_aa Lipoprotein
1817 MPJK01000015.1 GCA001949885_00995 CDS open 175789-176484 _na     231_aa hda DnaA regulatory inactivator Hda
1818 MPJK01000015.1 GCA001949885_00996 CDS open 176556-177803 _na     415_aa uraA putative uracil permease
1819 MPJK01000015.1 GCA001949885_00997 CDS open 177924-178550 _na     208_aa upp uracil phosphoribosyltransferase
1820 MPJK01000015.1 GCA001949885_00998 CDS open 178671-179009 _na     112_aa hypothetical protein
1821 MPJK01000015.1 GCA001949885_00999 CDS open 179192-181435 _na     747_aa Nitric oxide reductase
1822 MPJK01000015.1 GCA001949885_01000 CDS open 181780-183963 _na     727_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
1823 MPJK01000015.1 GCA001949885_01001 CDS open 183973-184362 _na     129_aa CRISPR system Cms protein Csm2
1824 MPJK01000015.1 GCA001949885_01002 CDS open 184378-185076 _na     232_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
1825 MPJK01000015.1 GCA001949885_01003 CDS open 185086-186069 _na     327_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
1826 MPJK01000015.1 GCA001949885_01004 CDS open 186066-187619 _na     517_aa CRISPR system Cms protein Csm5
1827 MPJK01000015.1 GCA001949885_01005 CDS open 187619-188539 _na     306_aa CRISPR-associated protein Cas6
1828 MPJK01000015.1 GCA001949885_01006 CDS open 188597-188887 _na     96_aa CRISPR-associated protein Csx16
1829 MPJK01000015.1 GCA001949885_01007 CDS open 188897-190069 _na     390_aa Card1 endonuclease domain-containing protein
1830 MPJK01000015.1 GCA001949885_01008 CDS open 190078-191253 _na     391_aa csm6 CRISPR-associated ring nuclease Csm6
1831 MPJK01000015.1 GCA001949885_01009 CDS open 191599-191712 _na     37_aa hypothetical protein
1832 MPJK01000015.1 GCA001949885_01010 CDS open 191786-191899 _na     37_aa hypothetical protein
1833 MPJK01000015.1 GCA001949885_01011 CDS open 191973-192086 _na     37_aa hypothetical protein
1834 MPJK01000015.1 GCA001949885_01012 CDS open 192160-192273 _na     37_aa hypothetical protein
1835 MPJK01000015.1 GCA001949885_01013 CDS open 192463-192747 _na     94_aa cas2 CRISPR-associated endonuclease Cas2
1836 MPJK01000015.1 GCA001949885_01014 CDS open 192756-193826 _na     356_aa cas1 CRISPR-associated endonuclease Cas1
1837 MPJK01000015.1 GCA001949885_01015 CDS open 193837-194127 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
1838 MPJK01000015.1 GCA001949885_01016 CDS open 195009-196400 _na     463_aa ffh signal recognition particle protein
1839 MPJK01000015.1 GCA001949885_01017 CDS open 196540-197325 _na     261_aa Cytochrome c assembly protein
1840 MPJK01000015.1 GCA001949885_01018 CDS open 197404-198672 _na     422_aa corB UPF0053 protein HI_0107
1841 MPJK01000015.1 GCA001949885_01019 CDS open 198804-199772 _na     322_aa selD selenide%2C water dikinase SelD
1842 MPJK01000015.1 GCA001949885_01020 CDS open 199819-201645 _na     608_aa AMP-binding enzyme
1843 MPJK01000015.1 GCA001949885_01021 CDS open 201871-202890 _na     339_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1844 MPJK01000015.1 GCA001949885_01022 CDS open 203110-203736 _na     208_aa gmk guanylate kinase
1845 MPJK01000015.1 GCA001949885_01023 CDS open 203797-204063 _na     88_aa rpoZ DNA-directed RNA polymerase subunit omega
1846 MPJK01000015.1 GCA001949885_01024 CDS open 204139-206259 _na     706_aa spoT bifunctional GTP diphosphokinase/guanosine-3'%2C5'-bis pyrophosphate 3'-pyrophosphohydrolase
1847 MPJK01000015.1 GCA001949885_01025 CDS open 206259-208340 _na     693_aa recG ATP-dependent DNA helicase RecG
1848 MPJK01000015.1 GCA001949885_01026 CDS open 208371-209162 _na     263_aa murI glutamate racemase
1849 MPJK01000015.1 GCA001949885_00812 gene open 54-794 trmD
1850 MPJK01000015.1 GCA001949885_00813 gene open 831-1181 rplS
1851 MPJK01000015.1 GCA001949885_00814 gene open 1242-2594 rho
1852 MPJK01000015.1 GCA001949885_00815 gene open 2735-4108 argH
1853 MPJK01000015.1 GCA001949885_00816 gene open 4269-4760 yajQ
1854 MPJK01000015.1 GCA001949885_00817 gene open 4781-5725 serB
1855 MPJK01000015.1 GCA001949885_00818 gene open 5794-6471 ahpA
1856 MPJK01000015.1 GCA001949885_00819 gene open 6557-8554 tkt
1857 MPJK01000015.1 GCA001949885_00820 gene open 9070-10440
1858 MPJK01000015.1 GCA001949885_00821 gene open 10682-11005 hpf
1859 MPJK01000015.1 GCA001949885_00822 gene open 11050-11193
1860 MPJK01000015.1 GCA001949885_00823 gene open 11249-12643 mltF
1861 MPJK01000015.1 GCA001949885_00824 gene open 12739-14589 deaD
1862 MPJK01000015.1 GCA001949885_00825 gene open 14665-15606 nlpI
1863 MPJK01000015.1 GCA001949885_00826 gene open 15671-17809 pnp
1864 MPJK01000015.1 GCA001949885_00827 gene open 18053-18520 nanQ
1865 MPJK01000015.1 GCA001949885_00828 gene open 18573-18794 tusA
1866 MPJK01000015.1 GCA001949885_00829 gene open 18804-19847
1867 MPJK01000015.1 GCA001949885_00830 gene open 20016-21392
1868 MPJK01000015.1 GCA001949885_00831 gene open 21407-22393
1869 MPJK01000015.1 GCA001949885_00832 gene open 22521-23825
1870 MPJK01000015.1 GCA001949885_00833 gene open 23844-24158
1871 MPJK01000015.1 GCA001949885_00834 gene open 24170-26968 polA
1872 MPJK01000015.1 GCA001949885_00835 gene open 27129-27434 zapA
1873 MPJK01000015.1 GCA001949885_00836 gene open 27483-28223 queH
1874 MPJK01000015.1 GCA001949885_00837 gene open 28225-29220 ispB
1875 MPJK01000015.1 GCA001949885_00838 gene open 29443-29754 rplU
1876 MPJK01000015.1 GCA001949885_00839 gene open 29775-30032 rpmA
1877 MPJK01000015.1 GCA001949885_00840 gene open 30209-31126 eamA
1878 MPJK01000015.1 GCA001949885_00841 gene open 31154-32326 cgtA
1879 MPJK01000015.1 GCA001949885_00842 gene open 32377-32514 ykgO
1880 MPJK01000015.1 GCA001949885_00843 gene open 32524-32790 rpmE2
1881 MPJK01000015.1 GCA001949885_00844 gene open 32951-33433 smpB
1882 MPJK01000015.1 GCA001949885_00845 gene open 33548-34258 arcA
1883 MPJK01000015.1 GCA001949885_00846 gene open 34436-36205 dsbD
1884 MPJK01000015.1 GCA001949885_00847 gene open 36323-36721
1885 MPJK01000015.1 GCA001949885_00848 gene open 36903-38501 purH
1886 MPJK01000015.1 GCA001949885_00849 gene open 38597-39886 purD
1887 MPJK01000015.1 GCA001949885_00850 gene open 39911-41134
1888 MPJK01000015.1 GCA001949885_00851 gene open 41198-41767
1889 MPJK01000015.1 GCA001949885_00852 gene open 41883-43145 glyA
1890 MPJK01000015.1 GCA001949885_00853 gene open 43145-43420
1891 MPJK01000015.1 GCA001949885_00854 gene open 43495-44028 dsbB
1892 MPJK01000015.1 GCA001949885_00855 gene open 44047-45585 nhaB
1893 MPJK01000015.1 GCA001949885_00856 gene open 45719-46447 fadR
1894 MPJK01000015.1 GCA001949885_00857 gene open 46506-47240 rsmE
1895 MPJK01000015.1 GCA001949885_00858 gene open 47240-47800
1896 MPJK01000015.1 GCA001949885_00859 gene open 47800-48219 ruvX
1897 MPJK01000015.1 GCA001949885_00860 gene open 48268-49005 pgeF
1898 MPJK01000015.1 GCA001949885_00861 gene open 49007-49981 rluD
1899 MPJK01000015.1 GCA001949885_00862 gene open 50091-50882 bamD
1900 MPJK01000015.1 GCA001949885_00864 gene open 51101-51769
1901 MPJK01000015.1 GCA001949885_00865 gene open 51905-54475 clpB
1902 MPJK01000015.1 GCA001949885_00866 gene open 54588-55181 mog
1903 MPJK01000015.1 GCA001949885_00867 gene open 55183-55521 glnB
1904 MPJK01000015.1 GCA001949885_00868 gene open 55521-56561 tqsA
1905 MPJK01000015.1 GCA001949885_00869 gene open 56644-57618 secF
1906 MPJK01000015.1 GCA001949885_00870 gene open 57629-59479 secD
1907 MPJK01000015.1 GCA001949885_00871 gene open 59503-59793 yajC
1908 MPJK01000015.1 GCA001949885_00872 gene open 59896-60123
1909 MPJK01000015.1 GCA001949885_00873 gene open 60127-60639
1910 MPJK01000015.1 GCA001949885_00874 gene open 60704-61852 tgt
1911 MPJK01000015.1 GCA001949885_00875 gene open 61965-63056 queA
1912 MPJK01000015.1 GCA001949885_00876 gene open 63249-64628 yegQ
1913 MPJK01000015.1 GCA001949885_00877 gene open 64808-66124 nCS2
1914 MPJK01000015.1 GCA001949885_00878 gene open 66324-66854 ppa
1915 MPJK01000015.1 GCA001949885_00879 gene open 67013-67201
1916 MPJK01000015.1 GCA001949885_00880 gene open 67402-67743
1917 MPJK01000015.1 GCA001949885_00881 gene open 67964-68611
1918 MPJK01000015.1 GCA001949885_00882 gene open 69040-69285
1919 MPJK01000015.1 GCA001949885_00883 gene open 69484-72708
1920 MPJK01000015.1 GCA001949885_00884 gene open 72913-73929 galE
1921 MPJK01000015.1 GCA001949885_00885 gene open 74010-75284
1922 MPJK01000015.1 GCA001949885_00886 gene open 75383-76027 adk
1923 MPJK01000015.1 GCA001949885_00887 gene open 76125-78149
1924 MPJK01000015.1 GCA001949885_00888 gene open 78173-78265
1925 MPJK01000015.1 GCA001949885_00889 gene open 78223-79185 lipA
1926 MPJK01000015.1 GCA001949885_00890 gene open 79248-79889 lipB
1927 MPJK01000015.1 GCA001949885_00891 gene open 79891-80169 ybeD
1928 MPJK01000015.1 GCA001949885_00892 gene open 80277-81464
1929 MPJK01000015.1 GCA001949885_00893 gene open 81483-82343
1930 MPJK01000015.1 GCA001949885_00894 gene open 82398-83513 rodA
1931 MPJK01000015.1 GCA001949885_00895 gene open 83513-85489 mrdA
1932 MPJK01000015.1 GCA001949885_00896 gene open 85505-85972 rlmH
1933 MPJK01000015.1 GCA001949885_00897 gene open 86012-86320 rsfS
1934 MPJK01000015.1 GCA001949885_00898 gene open 86473-88122
1935 MPJK01000015.1 GCA001949885_00899 gene open 88289-90079
1936 MPJK01000015.1 GCA001949885_00900 gene open 90251-91306 mreB
1937 MPJK01000015.1 GCA001949885_00901 gene open 91393-92457 mreC
1938 MPJK01000015.1 GCA001949885_00902 gene open 92457-92945 mreD
1939 MPJK01000015.1 GCA001949885_00903 gene open 92987-94246 rhlB
1940 MPJK01000015.1 GCA001949885_00904 gene open 94357-94617
1941 MPJK01000015.1 GCA001949885_00905 gene open 94614-94820 yacG
1942 MPJK01000015.1 GCA001949885_00906 gene open 94813-95433 coaE
1943 MPJK01000015.1 GCA001949885_00907 gene open 95520-96197
1944 MPJK01000015.1 GCA001949885_00908 gene open 96194-97417
1945 MPJK01000015.1 GCA001949885_00909 gene open 97426-98805
1946 MPJK01000015.1 GCA001949885_00910 gene open 98812-99255 ppdD
1947 MPJK01000015.1 GCA001949885_00911 gene open 99398-99949 ampD
1948 MPJK01000015.1 GCA001949885_00912 gene open 100446-101039 rppH
1949 MPJK01000015.1 GCA001949885_00913 gene open 101039-101833
1950 MPJK01000015.1 GCA001949885_00914 gene open 101842-102651 lgt
1951 MPJK01000015.1 GCA001949885_00915 gene open 102662-103513 thyA
1952 MPJK01000015.1 GCA001949885_00916 gene open 103550-104041 tadA
1953 MPJK01000015.1 GCA001949885_00917 gene open 104038-104697 ung
1954 MPJK01000015.1 GCA001949885_00918 gene open 104963-105346 grcA
1955 MPJK01000015.1 GCA001949885_00919 gene open 105488-107311 lepA
1956 MPJK01000015.1 GCA001949885_00920 gene open 107324-108373 lepB
1957 MPJK01000015.1 GCA001949885_00921 gene open 108321-109058 rnc
1958 MPJK01000015.1 GCA001949885_00922 gene open 109055-109969 era
1959 MPJK01000015.1 GCA001949885_00923 gene open 110048-110302
1960 MPJK01000015.1 GCA001949885_00924 gene open 110700-111053
1961 MPJK01000015.1 GCA001949885_00925 gene open 111129-112343
1962 MPJK01000015.1 GCA001949885_00926 gene open 112498-113778 menF
1963 MPJK01000015.1 GCA001949885_00927 gene open 113784-115490 menD
1964 MPJK01000015.1 GCA001949885_00928 gene open 115527-116270 menH
1965 MPJK01000015.1 GCA001949885_00929 gene open 116324-117640
1966 MPJK01000015.1 GCA001949885_00930 gene open 117781-118875
1967 MPJK01000015.1 GCA001949885_00931 gene open 118986-120188
1968 MPJK01000015.1 GCA001949885_00932 gene open 120192-121247 nrfF
1969 MPJK01000015.1 GCA001949885_00933 gene open 121249-121779 dsbE
1970 MPJK01000015.1 GCA001949885_00934 gene open 121772-123676 nrfE
1971 MPJK01000015.1 GCA001949885_00935 gene open 123824-124789 nrfD
1972 MPJK01000015.1 GCA001949885_00936 gene open 124786-125463 nrfC
1973 MPJK01000015.1 GCA001949885_00937 gene open 125463-126128 nrfB
1974 MPJK01000015.1 GCA001949885_00938 gene open 126201-127724 nrfA
1975 MPJK01000015.1 GCA001949885_00939 gene open 128027-128746
1976 MPJK01000015.1 GCA001949885_00940 gene open 128768-129583 mutM
1977 MPJK01000015.1 GCA001949885_00941 gene open 129656-129826 rpmG
1978 MPJK01000015.1 GCA001949885_00942 gene open 129838-130074 rpmB
1979 MPJK01000015.1 GCA001949885_00943 gene open 130293-131012 radC
1980 MPJK01000015.1 GCA001949885_00944 gene open 131160-132362 coaBC
1981 MPJK01000015.1 GCA001949885_00945 gene open 132436-132891 dut
1982 MPJK01000015.1 GCA001949885_00946 gene open 132895-133548 slmA
1983 MPJK01000015.1 GCA001949885_00947 gene open 133570-133788 yheU
1984 MPJK01000015.1 GCA001949885_00948 gene open 133805-134473 crp
1985 MPJK01000015.1 GCA001949885_00949 gene open 134983-136449
1986 MPJK01000015.1 GCA001949885_00950 gene open 136668-137357
1987 MPJK01000015.1 GCA001949885_00951 gene open 137369-138244
1988 MPJK01000015.1 GCA001949885_00952 gene open 138288-139091
1989 MPJK01000015.1 GCA001949885_00953 gene open 139228-140043 nanA
1990 MPJK01000015.1 GCA001949885_00954 gene open 140136-140939 nagB
1991 MPJK01000015.1 GCA001949885_00955 gene open 140976-142121 nagA
1992 MPJK01000015.1 GCA001949885_00956 gene open 142185-143267 recF
1993 MPJK01000015.1 GCA001949885_00957 gene open 143273-144373 dnaN
1994 MPJK01000015.1 GCA001949885_00958 gene open 144384-145751 dnaA
1995 MPJK01000015.1 GCA001949885_00959 gene open 146070-146204 rpmH
1996 MPJK01000015.1 GCA001949885_00960 gene open 146250-146585 rnpA
1997 MPJK01000015.1 GCA001949885_00961 gene open 146540-146803 yidD
1998 MPJK01000015.1 GCA001949885_00962 gene open 146803-148431 yidC
1999 MPJK01000015.1 GCA001949885_00963 gene open 148559-149917 mnmE
2000 MPJK01000015.1 GCA001949885_00964 gene open 149970-150344 mntP