HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Haemophilus paraphrohaemolyticus (GCA_002015045.1)

Select a Genome:
BAKTA Annotations for GCA_002015045.1
Genome Selected: Haemophilus paraphrohaemolyticus
ContigsBases CDSrRNA tmRNAtRNA
29 2057591 1999 4 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4150 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4150 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 MUXX01000017.1 GCA002015045_01741 gene open 29214-30287 wecA
3502 MUXX01000017.1 GCA002015045_01742 gene open 30455-31735 hemL
3503 MUXX01000017.1 GCA002015045_01743 gene open 31788-33515 dsbD
3504 MUXX01000017.1 GCA002015045_01744 gene open 33517-34473
3505 MUXX01000017.1 GCA002015045_01745 gene open 34600-35478 sulA
3506 MUXX01000017.1 GCA002015045_01746 gene open 35478-35930 argR
3507 MUXX01000017.1 GCA002015045_01747 gene open 36156-37112 mdh
3508 MUXX01000017.1 GCA002015045_01748 gene open 37186-37518
3509 MUXX01000017.1 GCA002015045_01749 gene open 37679-38413 artP
3510 MUXX01000017.1 GCA002015045_01750 gene open 38443-39165
3511 MUXX01000017.1 GCA002015045_01751 gene open 39169-39840 artQ
3512 MUXX01000017.1 GCA002015045_01752 gene open 39840-40505 artM
3513 MUXX01000017.1 GCA002015045_01753 gene open 40634-41299
3514 MUXX01000017.1 GCA002015045_01754 gene open 41808-42590
3515 MUXX01000017.1 GCA002015045_01755 gene open 42664-43101 aroQ
3516 MUXX01000017.1 GCA002015045_01734 gene open 26189-26275 trnL
3517 MUXX01000017.1 GCA002015045_01735 gene open 26294-26369 trnG
3518 MUXX01000017.1 GCA002015045_01736 gene open 26381-26467 trnL
3519 MUXX01000017.1 GCA002015045_01737 gene open 26488-26563 trnG
3520 MUXX01000017.1 GCA002015045_01734 tRNA open 26189-26275 trnL tRNA-Leu(taa)
3521 MUXX01000017.1 GCA002015045_01735 tRNA open 26294-26369 trnG tRNA-Gly(gcc)
3522 MUXX01000017.1 GCA002015045_01736 tRNA open 26381-26467 trnL tRNA-Leu(taa)
3523 MUXX01000017.1 GCA002015045_01737 tRNA open 26488-26563 trnG tRNA-Gly(gcc)
3524 MUXX01000018.1 GCA002015045_01756 CDS open 317-3130 _na     937_aa sucA 2-oxoglutarate dehydrogenase E1 component
3525 MUXX01000018.1 GCA002015045_01757 CDS open 3161-4390 _na     409_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
3526 MUXX01000018.1 GCA002015045_01758 CDS open 4597-7182 _na     861_aa leuS leucine--tRNA ligase
3527 MUXX01000018.1 GCA002015045_01759 CDS open 7276-7782 _na     168_aa lptE LPS-assembly lipoprotein LptE
3528 MUXX01000018.1 GCA002015045_01760 CDS open 7854-8876 _na     340_aa holA DNA polymerase III subunit delta
3529 MUXX01000018.1 GCA002015045_01761 CDS open 8918-9961 _na     347_aa Ferric transporter ATP-binding subunit
3530 MUXX01000018.1 GCA002015045_01762 CDS open 9963-11948 _na     661_aa Fe3+ ABC transporter permease
3531 MUXX01000018.1 GCA002015045_01763 CDS open 12047-13096 _na     349_aa ABC transporter%2C solute-binding protein
3532 MUXX01000018.1 GCA002015045_01766 CDS open 13631-14275 _na     214_aa Putative lipoprotein
3533 MUXX01000018.1 GCA002015045_01767 CDS open 14340-14963 _na     207_aa Lipoprotein Hlp
3534 MUXX01000018.1 GCA002015045_01768 CDS open 15080-15937 _na     285_aa rapZ RNase adapter RapZ
3535 MUXX01000018.1 GCA002015045_01769 CDS open 15952-16491 _na     179_aa PTS system%2C nitrogen regulatory IIA-like protein
3536 MUXX01000018.1 GCA002015045_01770 CDS open 16507-17232 _na     241_aa lptB LPS export ABC transporter ATP-binding protein
3537 MUXX01000018.1 GCA002015045_01771 CDS open 17240-17743 _na     167_aa lptA lipopolysaccharide transport periplasmic protein LptA
3538 MUXX01000018.1 GCA002015045_01772 CDS open 17740-18342 _na     200_aa lptC LPS export ABC transporter periplasmic protein LptC
3539 MUXX01000018.1 GCA002015045_01773 CDS open 18502-21138 _na     878_aa ppc phosphoenolpyruvate carboxylase
3540 MUXX01000018.1 GCA002015045_01774 CDS open 21338-21847 _na     169_aa ppiB Peptidyl-prolyl cis-trans isomerase
3541 MUXX01000018.1 GCA002015045_01775 CDS open 21938-23176 _na     412_aa multifunctional CCA addition/repair protein
3542 MUXX01000018.1 GCA002015045_01776 CDS open 23250-25187 _na     645_aa ABC transporter ATP-binding protein
3543 MUXX01000018.1 GCA002015045_01777 CDS open 25410-25997 _na     195_aa Lipoprotein
3544 MUXX01000018.1 GCA002015045_01778 CDS open 26115-26846 _na     243_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
3545 MUXX01000018.1 GCA002015045_01779 CDS open 26859-27422 _na     187_aa YqgE/AlgH family protein
3546 MUXX01000018.1 GCA002015045_01780 CDS open 27539-29125 _na     528_aa Adhesin
3547 MUXX01000018.1 GCA002015045_01756 gene open 317-3130 sucA
3548 MUXX01000018.1 GCA002015045_01757 gene open 3161-4390 odhB
3549 MUXX01000018.1 GCA002015045_01758 gene open 4597-7182 leuS
3550 MUXX01000018.1 GCA002015045_01759 gene open 7276-7782 lptE
3551 MUXX01000018.1 GCA002015045_01760 gene open 7854-8876 holA
3552 MUXX01000018.1 GCA002015045_01761 gene open 8918-9961
3553 MUXX01000018.1 GCA002015045_01762 gene open 9963-11948
3554 MUXX01000018.1 GCA002015045_01763 gene open 12047-13096
3555 MUXX01000018.1 GCA002015045_01766 gene open 13631-14275
3556 MUXX01000018.1 GCA002015045_01767 gene open 14340-14963
3557 MUXX01000018.1 GCA002015045_01768 gene open 15080-15937 rapZ
3558 MUXX01000018.1 GCA002015045_01769 gene open 15952-16491
3559 MUXX01000018.1 GCA002015045_01770 gene open 16507-17232 lptB
3560 MUXX01000018.1 GCA002015045_01771 gene open 17240-17743 lptA
3561 MUXX01000018.1 GCA002015045_01772 gene open 17740-18342 lptC
3562 MUXX01000018.1 GCA002015045_01773 gene open 18502-21138 ppc
3563 MUXX01000018.1 GCA002015045_01774 gene open 21338-21847 ppiB
3564 MUXX01000018.1 GCA002015045_01775 gene open 21938-23176
3565 MUXX01000018.1 GCA002015045_01776 gene open 23250-25187
3566 MUXX01000018.1 GCA002015045_01777 gene open 25410-25997
3567 MUXX01000018.1 GCA002015045_01778 gene open 26115-26846 rsmE
3568 MUXX01000018.1 GCA002015045_01779 gene open 26859-27422
3569 MUXX01000018.1 GCA002015045_01780 gene open 27539-29125
3570 MUXX01000018.1 GCA002015045_01764 gene open 13327-13402 trnG
3571 MUXX01000018.1 GCA002015045_01765 gene open 13418-13491 trnC
3572 MUXX01000018.1 GCA002015045_01764 tRNA open 13327-13402 trnG tRNA-Gly(gcc)
3573 MUXX01000018.1 GCA002015045_01765 tRNA open 13418-13491 trnC tRNA-Cys(gca)
3574 MUXX01000019.1 GCA002015045_01857 gene open 69279-69685 RNaseP_bact_a
3575 MUXX01000019.1 GCA002015045_01857 ncRNA open 69279-69685 Bacterial RNase P class A
3576 MUXX01000019.1 regulatory_region open 67375-67419 PreQ1 (pre queuosine) riboswitch aptamer
3577 MUXX01000019.1 regulatory_region open 76349-76532 Lysine riboswitch aptamer
3578 MUXX01000019.1 GCA002015045_01781 CDS open 51-1238 _na     395_aa Acetylornithine aminotransferase
3579 MUXX01000019.1 GCA002015045_01782 CDS open 1333-1815 _na     160_aa 5'-nucleotidase%2C C-terminal domain protein
3580 MUXX01000019.1 GCA002015045_01783 CDS open 2121-2342 _na     73_aa Bifunctional UDP-sugar hydrolase/5'-nucleotidase periplasmic domain protein
3581 MUXX01000019.1 GCA002015045_01784 CDS open 2453-2815 _na     120_aa Diacylglycerol kinase
3582 MUXX01000019.1 GCA002015045_01785 CDS open 3046-4263 _na     405_aa sstT serine/threonine transporter SstT
3583 MUXX01000019.1 GCA002015045_01786 CDS open 4427-5080 _na     217_aa purN phosphoribosylglycinamide formyltransferase
3584 MUXX01000019.1 GCA002015045_01787 CDS open 5227-6261 _na     344_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
3585 MUXX01000019.1 GCA002015045_01788 CDS open 6441-7202 _na     253_aa KR domain protein
3586 MUXX01000019.1 GCA002015045_01789 CDS open 7195-7632 _na     145_aa Yip1 domain-containing protein
3587 MUXX01000019.1 GCA002015045_01790 CDS open 7650-8843 _na     397_aa trpB tryptophan synthase subunit beta
3588 MUXX01000019.1 GCA002015045_01791 CDS open 8843-9652 _na     269_aa trpA tryptophan synthase subunit alpha
3589 MUXX01000019.1 GCA002015045_01792 CDS open 9789-12641 _na     950_aa polA DNA polymerase I
3590 MUXX01000019.1 GCA002015045_01793 CDS open 12721-13347 _na     208_aa lolA outer membrane lipoprotein chaperone LolA
3591 MUXX01000019.1 GCA002015045_01794 CDS open 13416-13724 _na     102_aa trpR trp operon repressor
3592 MUXX01000019.1 GCA002015045_01795 CDS open 13711-14517 _na     268_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
3593 MUXX01000019.1 GCA002015045_01796 CDS open 14706-15710 _na     334_aa fbp class 1 fructose-bisphosphatase
3594 MUXX01000019.1 GCA002015045_01797 CDS open 16103-17371 _na     422_aa Nramp family divalent metal transporter
3595 MUXX01000019.1 GCA002015045_01798 CDS open 17667-18008 _na     113_aa yurZ Alkylhydroperoxidase AhpD family core domain protein
3596 MUXX01000019.1 GCA002015045_01799 CDS open 18135-19022 _na     295_aa araC Transcriptional regulator%2C AraC family
3597 MUXX01000019.1 GCA002015045_01800 CDS open 19045-19596 _na     183_aa UPF0114 protein HMPREF1054_0913
3598 MUXX01000019.1 GCA002015045_01801 CDS open 19774-20658 _na     294_aa ygfZ tRNA-modifying protein YgfZ
3599 MUXX01000019.1 GCA002015045_01802 CDS open 20684-21547 _na     287_aa TIGR00255 family protein
3600 MUXX01000019.1 GCA002015045_01803 CDS open 21630-22346 _na     238_aa rph ribonuclease PH
3601 MUXX01000019.1 GCA002015045_01804 CDS open 22437-24044 _na     535_aa DNA recombination protein RmuC-like protein
3602 MUXX01000019.1 GCA002015045_01805 CDS open 24157-25020 _na     287_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
3603 MUXX01000019.1 GCA002015045_01806 CDS open 25049-25915 _na     288_aa sirB1 Protein SirB1 N-terminal domain-containing protein
3604 MUXX01000019.1 GCA002015045_01807 CDS open 25938-26792 _na     284_aa kdsA 3-deoxy-8-phosphooctulonate synthase
3605 MUXX01000019.1 GCA002015045_01808 CDS open 26845-27708 _na     287_aa ABC transporter%2C substrate-binding protein%2C family 3
3606 MUXX01000019.1 GCA002015045_01809 CDS open 27692-28456 _na     254_aa ABC transporter%2C ATP-binding protein
3607 MUXX01000019.1 GCA002015045_01810 CDS open 28459-29124 _na     221_aa ABC transporter%2C permease protein
3608 MUXX01000019.1 GCA002015045_01811 CDS open 29114-29773 _na     219_aa ABC transporter%2C permease protein
3609 MUXX01000019.1 GCA002015045_01812 CDS open 30209-30715 _na     168_aa hypothetical protein
3610 MUXX01000019.1 GCA002015045_01813 CDS open 30727-31239 _na     170_aa Hemerythrin HHE cation-binding domain protein
3611 MUXX01000019.1 GCA002015045_01814 CDS open 31338-32477 _na     379_aa tgt tRNA guanosine(34) transglycosylase Tgt
3612 MUXX01000019.1 GCA002015045_01815 CDS open 32556-32690 _na     44_aa Lipoprotein
3613 MUXX01000019.1 GCA002015045_01816 CDS open 32794-33369 _na     191_aa yceB putative lipoprotein yceB
3614 MUXX01000019.1 GCA002015045_01817 CDS open 33391-34137 _na     248_aa can carbonate dehydratase
3615 MUXX01000019.1 GCA002015045_01818 CDS open 34268-35575 _na     435_aa serS serine--tRNA ligase
3616 MUXX01000019.1 GCA002015045_01819 CDS open 35600-36079 _na     159_aa smpB SsrA-binding protein SmpB
3617 MUXX01000019.1 GCA002015045_01820 CDS open 36116-37519 _na     467_aa Nucleoside triphosphate hydrolase domain
3618 MUXX01000019.1 GCA002015045_01821 CDS open 37577-38419 _na     280_aa Adenylate cyclase
3619 MUXX01000019.1 GCA002015045_01822 CDS open 38492-39535 _na     347_aa prfB peptide chain release factor 2
3620 MUXX01000019.1 GCA002015045_01823 CDS open 39791-40765 _na     324_aa pfkA 6-phosphofructokinase
3621 MUXX01000019.1 GCA002015045_01824 CDS open 40861-42057 _na     398_aa cysteine desulfurase
3622 MUXX01000019.1 GCA002015045_01825 CDS open 42069-42770 _na     233_aa Nuclease-like protein
3623 MUXX01000019.1 GCA002015045_01826 CDS open 42774-43907 _na     377_aa argE acetylornithine deacetylase
3624 MUXX01000019.1 GCA002015045_01827 CDS open 43894-44691 _na     265_aa DUF998 domain-containing protein
3625 MUXX01000019.1 GCA002015045_01828 CDS open 44706-46100 _na     464_aa Arginine/ornithine antiporter protein
3626 MUXX01000019.1 GCA002015045_01829 CDS open 46286-46747 _na     153_aa pal peptidoglycan-associated lipoprotein Pal
3627 MUXX01000019.1 GCA002015045_01830 CDS open 46768-48048 _na     426_aa tolB Tol-Pal system beta propeller repeat protein TolB
3628 MUXX01000019.1 GCA002015045_01831 CDS open 48067-49365 _na     432_aa tolA cell envelope integrity protein TolA
3629 MUXX01000019.1 GCA002015045_01832 CDS open 49382-49819 _na     145_aa tolR colicin uptake protein TolR
3630 MUXX01000019.1 GCA002015045_01833 CDS open 49928-50611 _na     227_aa tolQ protein TolQ
3631 MUXX01000019.1 GCA002015045_01834 CDS open 50637-51029 _na     130_aa ybgC tol-pal system-associated acyl-CoA thioesterase
3632 MUXX01000019.1 GCA002015045_01835 CDS open 51180-51461 _na     93_aa Cytochrome bd biosynthesis protein
3633 MUXX01000019.1 GCA002015045_01836 CDS open 51465-51563 _na     32_aa Cytochrome bd oxidase small subunit%2C CydX/CbdX family
3634 MUXX01000019.1 GCA002015045_01837 CDS open 51573-52709 _na     378_aa cydB cytochrome d ubiquinol oxidase subunit II
3635 MUXX01000019.1 GCA002015045_01838 CDS open 52720-54273 _na     517_aa Cytochrome D ubiquinol oxidase subunit I
3636 MUXX01000019.1 GCA002015045_01839 CDS open 54693-55022 _na     109_aa ABC transporter ATPase
3637 MUXX01000019.1 GCA002015045_01840 CDS open 55097-55921 _na     274_aa 5'-nucleotidase%2C lipoprotein e(P4) family
3638 MUXX01000019.1 GCA002015045_01841 CDS open 56169-56780 _na     203_aa grpE nucleotide exchange factor GrpE
3639 MUXX01000019.1 GCA002015045_01842 CDS open 57013-58092 _na     359_aa Putrescine-binding periplasmic protein
3640 MUXX01000019.1 GCA002015045_01843 CDS open 58132-59040 _na     302_aa Glutathione synthetase%2C ATP-binding domain protein
3641 MUXX01000019.1 GCA002015045_01844 CDS open 59040-60419 _na     459_aa radA DNA repair protein RadA
3642 MUXX01000019.1 GCA002015045_01845 CDS open 60611-61078 _na     155_aa pilA Tfp pilus assembly protein%2C major pilin PilA
3643 MUXX01000019.1 GCA002015045_01846 CDS open 61147-62532 _na     461_aa pilB Tfp pilus assembly pathway%2C ATPase PilB
3644 MUXX01000019.1 GCA002015045_01847 CDS open 62525-63721 _na     398_aa Type II secretion system F domain protein
3645 MUXX01000019.1 GCA002015045_01848 CDS open 63723-64367 _na     214_aa Peptidase%2C A24 type IV prepilin peptidase family protein
3646 MUXX01000019.1 GCA002015045_01849 CDS open 64388-65014 _na     208_aa coaE dephospho-CoA kinase
3647 MUXX01000019.1 GCA002015045_01850 CDS open 65002-65190 _na     62_aa yacG DNA gyrase inhibitor YacG
3648 MUXX01000019.1 GCA002015045_01851 CDS open 65254-65514 _na     86_aa DinI-like family protein
3649 MUXX01000019.1 GCA002015045_01852 CDS open 65618-66259 _na     213_aa 7-carboxy-7-deazaguanine synthase
3650 MUXX01000019.1 GCA002015045_01853 CDS open 66249-66704 _na     151_aa queD 6-carboxytetrahydropterin synthase QueD
3651 MUXX01000019.1 GCA002015045_01854 CDS open 66697-67371 _na     224_aa queC 7-cyano-7-deazaguanine synthase QueC
3652 MUXX01000019.1 GCA002015045_01855 CDS open 67510-68487 _na     325_aa Nickel/cobalt efflux system
3653 MUXX01000019.1 GCA002015045_01856 CDS open 68469-69095 _na     208_aa PF06226 family protein
3654 MUXX01000019.1 GCA002015045_01858 CDS open 69785-71005 _na     406_aa rhlB ATP-dependent RNA helicase RhlB
3655 MUXX01000019.1 GCA002015045_01859 CDS open 71008-71430 _na     140_aa Lipoprotein
3656 MUXX01000019.1 GCA002015045_01860 CDS open 71449-72939 _na     496_aa PF05872 family protein
3657 MUXX01000019.1 GCA002015045_01861 CDS open 72980-74170 _na     396_aa ispC 1-deoxy-D-xylulose-5-phosphate reductoisomerase
3658 MUXX01000019.1 GCA002015045_01862 CDS open 74218-74478 _na     86_aa Lipoprotein
3659 MUXX01000019.1 GCA002015045_01863 CDS open 74702-76240 _na     512_aa Na(+)/H(+) antiporter
3660 MUXX01000019.1 GCA002015045_01864 CDS open 76701-77096 _na     131_aa DNA-binding protein
3661 MUXX01000019.1 GCA002015045_01865 CDS open 77390-77944 _na     184_aa Methylated-DNA--protein-cysteine methyltransferase
3662 MUXX01000019.1 GCA002015045_01866 CDS open 78016-79464 _na     482_aa Transporter
3663 MUXX01000019.1 GCA002015045_01867 CDS open 79804-80256 _na     150_aa iscR Fe-S cluster assembly transcriptional regulator IscR
3664 MUXX01000019.1 GCA002015045_01868 CDS open 80312-81538 _na     408_aa iscS IscS subfamily cysteine desulfurase
3665 MUXX01000019.1 GCA002015045_01869 CDS open 81594-81977 _na     127_aa iscU Iron-sulfur cluster assembly scaffold protein IscU
3666 MUXX01000019.1 GCA002015045_01870 CDS open 82145-82468 _na     107_aa iscA iron-sulfur cluster assembly protein IscA
3667 MUXX01000019.1 GCA002015045_01871 CDS open 82480-83001 _na     173_aa hscB Fe-S protein assembly co-chaperone HscB
3668 MUXX01000019.1 GCA002015045_01872 CDS open 83080-83712 _na     210_aa PF10946 family protein
3669 MUXX01000019.1 GCA002015045_01873 CDS open 83748-85601 _na     617_aa hscA Fe-S protein assembly chaperone HscA
3670 MUXX01000019.1 GCA002015045_01874 CDS open 85613-85954 _na     113_aa fdx ISC system 2Fe-2S type ferredoxin
3671 MUXX01000019.1 GCA002015045_01875 CDS open 85954-86148 _na     64_aa iscX Fe-S cluster assembly protein IscX
3672 MUXX01000019.1 GCA002015045_01876 CDS open 86275-87777 _na     500_aa lysS lysine--tRNA ligase
3673 MUXX01000019.1 GCA002015045_01877 CDS open 87912-89387 _na     491_aa rng ribonuclease G
3674 MUXX01000019.1 GCA002015045_01878 CDS open 89509-90369 _na     286_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
3675 MUXX01000019.1 GCA002015045_01881 CDS open 90821-91696 _na     291_aa Putative prophage DLP12 integrase
3676 MUXX01000019.1 GCA002015045_01882 CDS open 91738-92028 _na     96_aa helix-turn-helix domain-containing protein
3677 MUXX01000019.1 GCA002015045_01883 CDS open 92274-93134 _na     286_aa phage antirepressor N-terminal domain-containing protein
3678 MUXX01000019.1 GCA002015045_01781 gene open 51-1238
3679 MUXX01000019.1 GCA002015045_01782 gene open 1333-1815
3680 MUXX01000019.1 GCA002015045_01783 gene open 2121-2342
3681 MUXX01000019.1 GCA002015045_01784 gene open 2453-2815
3682 MUXX01000019.1 GCA002015045_01785 gene open 3046-4263 sstT
3683 MUXX01000019.1 GCA002015045_01786 gene open 4427-5080 purN
3684 MUXX01000019.1 GCA002015045_01787 gene open 5227-6261 purM
3685 MUXX01000019.1 GCA002015045_01788 gene open 6441-7202
3686 MUXX01000019.1 GCA002015045_01789 gene open 7195-7632
3687 MUXX01000019.1 GCA002015045_01790 gene open 7650-8843 trpB
3688 MUXX01000019.1 GCA002015045_01791 gene open 8843-9652 trpA
3689 MUXX01000019.1 GCA002015045_01792 gene open 9789-12641 polA
3690 MUXX01000019.1 GCA002015045_01793 gene open 12721-13347 lolA
3691 MUXX01000019.1 GCA002015045_01794 gene open 13416-13724 trpR
3692 MUXX01000019.1 GCA002015045_01795 gene open 13711-14517 mtgA
3693 MUXX01000019.1 GCA002015045_01796 gene open 14706-15710 fbp
3694 MUXX01000019.1 GCA002015045_01797 gene open 16103-17371
3695 MUXX01000019.1 GCA002015045_01798 gene open 17667-18008 yurZ
3696 MUXX01000019.1 GCA002015045_01799 gene open 18135-19022 araC
3697 MUXX01000019.1 GCA002015045_01800 gene open 19045-19596
3698 MUXX01000019.1 GCA002015045_01801 gene open 19774-20658 ygfZ
3699 MUXX01000019.1 GCA002015045_01802 gene open 20684-21547
3700 MUXX01000019.1 GCA002015045_01803 gene open 21630-22346 rph
3701 MUXX01000019.1 GCA002015045_01804 gene open 22437-24044
3702 MUXX01000019.1 GCA002015045_01805 gene open 24157-25020 prmC
3703 MUXX01000019.1 GCA002015045_01806 gene open 25049-25915 sirB1
3704 MUXX01000019.1 GCA002015045_01807 gene open 25938-26792 kdsA
3705 MUXX01000019.1 GCA002015045_01808 gene open 26845-27708
3706 MUXX01000019.1 GCA002015045_01809 gene open 27692-28456
3707 MUXX01000019.1 GCA002015045_01810 gene open 28459-29124
3708 MUXX01000019.1 GCA002015045_01811 gene open 29114-29773
3709 MUXX01000019.1 GCA002015045_01812 gene open 30209-30715
3710 MUXX01000019.1 GCA002015045_01813 gene open 30727-31239
3711 MUXX01000019.1 GCA002015045_01814 gene open 31338-32477 tgt
3712 MUXX01000019.1 GCA002015045_01815 gene open 32556-32690
3713 MUXX01000019.1 GCA002015045_01816 gene open 32794-33369 yceB
3714 MUXX01000019.1 GCA002015045_01817 gene open 33391-34137 can
3715 MUXX01000019.1 GCA002015045_01818 gene open 34268-35575 serS
3716 MUXX01000019.1 GCA002015045_01819 gene open 35600-36079 smpB
3717 MUXX01000019.1 GCA002015045_01820 gene open 36116-37519
3718 MUXX01000019.1 GCA002015045_01821 gene open 37577-38419
3719 MUXX01000019.1 GCA002015045_01822 gene open 38492-39535 prfB
3720 MUXX01000019.1 GCA002015045_01823 gene open 39791-40765 pfkA
3721 MUXX01000019.1 GCA002015045_01824 gene open 40861-42057
3722 MUXX01000019.1 GCA002015045_01825 gene open 42069-42770
3723 MUXX01000019.1 GCA002015045_01826 gene open 42774-43907 argE
3724 MUXX01000019.1 GCA002015045_01827 gene open 43894-44691
3725 MUXX01000019.1 GCA002015045_01828 gene open 44706-46100
3726 MUXX01000019.1 GCA002015045_01829 gene open 46286-46747 pal
3727 MUXX01000019.1 GCA002015045_01830 gene open 46768-48048 tolB
3728 MUXX01000019.1 GCA002015045_01831 gene open 48067-49365 tolA
3729 MUXX01000019.1 GCA002015045_01832 gene open 49382-49819 tolR
3730 MUXX01000019.1 GCA002015045_01833 gene open 49928-50611 tolQ
3731 MUXX01000019.1 GCA002015045_01834 gene open 50637-51029 ybgC
3732 MUXX01000019.1 GCA002015045_01835 gene open 51180-51461
3733 MUXX01000019.1 GCA002015045_01836 gene open 51465-51563
3734 MUXX01000019.1 GCA002015045_01837 gene open 51573-52709 cydB
3735 MUXX01000019.1 GCA002015045_01838 gene open 52720-54273
3736 MUXX01000019.1 GCA002015045_01839 gene open 54693-55022
3737 MUXX01000019.1 GCA002015045_01840 gene open 55097-55921
3738 MUXX01000019.1 GCA002015045_01841 gene open 56169-56780 grpE
3739 MUXX01000019.1 GCA002015045_01842 gene open 57013-58092
3740 MUXX01000019.1 GCA002015045_01843 gene open 58132-59040
3741 MUXX01000019.1 GCA002015045_01844 gene open 59040-60419 radA
3742 MUXX01000019.1 GCA002015045_01845 gene open 60611-61078 pilA
3743 MUXX01000019.1 GCA002015045_01846 gene open 61147-62532 pilB
3744 MUXX01000019.1 GCA002015045_01847 gene open 62525-63721
3745 MUXX01000019.1 GCA002015045_01848 gene open 63723-64367
3746 MUXX01000019.1 GCA002015045_01849 gene open 64388-65014 coaE
3747 MUXX01000019.1 GCA002015045_01850 gene open 65002-65190 yacG
3748 MUXX01000019.1 GCA002015045_01851 gene open 65254-65514
3749 MUXX01000019.1 GCA002015045_01852 gene open 65618-66259
3750 MUXX01000019.1 GCA002015045_01853 gene open 66249-66704 queD
3751 MUXX01000019.1 GCA002015045_01854 gene open 66697-67371 queC
3752 MUXX01000019.1 GCA002015045_01855 gene open 67510-68487
3753 MUXX01000019.1 GCA002015045_01856 gene open 68469-69095
3754 MUXX01000019.1 GCA002015045_01858 gene open 69785-71005 rhlB
3755 MUXX01000019.1 GCA002015045_01859 gene open 71008-71430
3756 MUXX01000019.1 GCA002015045_01860 gene open 71449-72939
3757 MUXX01000019.1 GCA002015045_01861 gene open 72980-74170 ispC
3758 MUXX01000019.1 GCA002015045_01862 gene open 74218-74478
3759 MUXX01000019.1 GCA002015045_01863 gene open 74702-76240
3760 MUXX01000019.1 GCA002015045_01864 gene open 76701-77096
3761 MUXX01000019.1 GCA002015045_01865 gene open 77390-77944
3762 MUXX01000019.1 GCA002015045_01866 gene open 78016-79464
3763 MUXX01000019.1 GCA002015045_01867 gene open 79804-80256 iscR
3764 MUXX01000019.1 GCA002015045_01868 gene open 80312-81538 iscS
3765 MUXX01000019.1 GCA002015045_01869 gene open 81594-81977 iscU
3766 MUXX01000019.1 GCA002015045_01870 gene open 82145-82468 iscA
3767 MUXX01000019.1 GCA002015045_01871 gene open 82480-83001 hscB
3768 MUXX01000019.1 GCA002015045_01872 gene open 83080-83712
3769 MUXX01000019.1 GCA002015045_01873 gene open 83748-85601 hscA
3770 MUXX01000019.1 GCA002015045_01874 gene open 85613-85954 fdx
3771 MUXX01000019.1 GCA002015045_01875 gene open 85954-86148 iscX
3772 MUXX01000019.1 GCA002015045_01876 gene open 86275-87777 lysS
3773 MUXX01000019.1 GCA002015045_01877 gene open 87912-89387 rng
3774 MUXX01000019.1 GCA002015045_01878 gene open 89509-90369 folD
3775 MUXX01000019.1 GCA002015045_01881 gene open 90821-91696
3776 MUXX01000019.1 GCA002015045_01882 gene open 91738-92028
3777 MUXX01000019.1 GCA002015045_01883 gene open 92274-93134
3778 MUXX01000019.1 GCA002015045_01879 gene open 90545-90621 trnP
3779 MUXX01000019.1 GCA002015045_01880 gene open 90670-90746 trnR
3780 MUXX01000019.1 GCA002015045_01879 tRNA open 90545-90621 trnP tRNA-Pro(tgg)
3781 MUXX01000019.1 GCA002015045_01880 tRNA open 90670-90746 trnR tRNA-Arg(tct)
3782 MUXX01000020.1 repeat_region open 4721-4985 CRISPR array with 4 repeats of length 38%2C consensus sequence GTCTCAATCCCTTTGGAACAGGGCAATGTCTTTCGACT and spacer length 34
3783 MUXX01000020.1 GCA002015045_01884 CDS open 49-633 _na     194_aa pth aminoacyl-tRNA hydrolase
3784 MUXX01000020.1 GCA002015045_01885 CDS open 756-1313 _na     185_aa Integral membrane protein
3785 MUXX01000020.1 GCA002015045_01886 CDS open 1356-1664 _na     102_aa rsaL DNA-binding protein%2C virulence gene repressor RsaL
3786 MUXX01000020.1 GCA002015045_01887 CDS open 1661-2008 _na     115_aa PF06296 family protein
3787 MUXX01000020.1 GCA002015045_01888 CDS open 2115-3452 _na     445_aa srmB ATP-dependent RNA helicase SrmB
3788 MUXX01000020.1 GCA002015045_01889 CDS open 3539-3679 _na     46_aa hypothetical protein
3789 MUXX01000020.1 GCA002015045_01890 CDS open 3690-4550 _na     286_aa tesB acyl-CoA thioesterase II
3790 MUXX01000020.1 GCA002015045_01891 CDS open 5351-6139 _na     262_aa site-specific DNA-methyltransferase (adenine-specific)
3791 MUXX01000020.1 GCA002015045_01892 CDS open 6277-6957 _na     226_aa DUF4185 domain-containing protein
3792 MUXX01000020.1 GCA002015045_01893 CDS open 6957-7283 _na     108_aa HPt domain-containing protein
3793 MUXX01000020.1 GCA002015045_01894 CDS open 7280-7462 _na     60_aa hypothetical protein
3794 MUXX01000020.1 GCA002015045_01895 CDS open 7467-7826 _na     119_aa hypothetical protein
3795 MUXX01000020.1 GCA002015045_01896 CDS open 7816-8301 _na     161_aa Enoyl-CoA hydratase
3796 MUXX01000020.1 GCA002015045_01897 CDS open 8294-9049 _na     251_aa Tail fiber assembly protein
3797 MUXX01000020.1 GCA002015045_01898 CDS open 9060-9935 _na     291_aa Phage tail collar domain protein
3798 MUXX01000020.1 GCA002015045_01899 CDS open 9953-10531 _na     192_aa Phage tail protein
3799 MUXX01000020.1 GCA002015045_01900 CDS open 10524-11624 _na     366_aa Baseplate J-like protein
3800 MUXX01000020.1 GCA002015045_01901 CDS open 11621-11980 _na     119_aa Putative lysozyme
3801 MUXX01000020.1 GCA002015045_01902 CDS open 12035-12541 _na     168_aa Phage-like baseplate assembly protein
3802 MUXX01000020.1 GCA002015045_01903 CDS open 12528-13592 _na     354_aa Cro/Cl family transcriptional regulator
3803 MUXX01000020.1 GCA002015045_01904 CDS open 13585-13818 _na     77_aa Phage tail protein
3804 MUXX01000020.1 GCA002015045_01905 CDS open 13799-14734 _na     311_aa Phage tail protein
3805 MUXX01000020.1 GCA002015045_01906 CDS open 14747-17326 _na     859_aa Phage tail tape measure protein%2C TP901 family
3806 MUXX01000020.1 GCA002015045_01907 CDS open 17364-17633 _na     89_aa hypothetical protein
3807 MUXX01000020.1 GCA002015045_01908 CDS open 17792-18046 _na     84_aa Phage tail protein E
3808 MUXX01000020.1 GCA002015045_01909 CDS open 18135-18653 _na     172_aa phage major tail tube protein
3809 MUXX01000020.1 GCA002015045_01910 CDS open 18666-20051 _na     461_aa Phage tail sheath protein
3810 MUXX01000020.1 GCA002015045_01911 CDS open 20062-20529 _na     155_aa Gp37 protein
3811 MUXX01000020.1 GCA002015045_01912 CDS open 20540-20974 _na     144_aa PF07030 family protein
3812 MUXX01000020.1 GCA002015045_01913 CDS open 20974-21234 _na     86_aa Erp22-like protein
3813 MUXX01000020.1 GCA002015045_01914 CDS open 21308-22234 _na     308_aa Inorganic pyrophosphatase
3814 MUXX01000020.1 GCA002015045_01915 CDS open 22246-23205 _na     319_aa Mu-like prophage I protein
3815 MUXX01000020.1 GCA002015045_01916 CDS open 23443-23901 _na     152_aa phage virion morphogenesis protein
3816 MUXX01000020.1 GCA002015045_01917 CDS open 23904-24155 _na     83_aa Phage protein (N4 Gp49/phage Sf6 gene 66) family protein
3817 MUXX01000020.1 GCA002015045_01918 CDS open 24284-25552 _na     422_aa Phage Mu protein F-like protein
3818 MUXX01000020.1 GCA002015045_01919 CDS open 25566-27035 _na     489_aa DUF935 domain-containing protein
3819 MUXX01000020.1 GCA002015045_01920 CDS open 27045-27155 _na     36_aa Phosphatidate cytidylyltransferase
3820 MUXX01000020.1 GCA002015045_01921 CDS open 27158-28654 _na     498_aa Terminase-like family protein
3821 MUXX01000020.1 GCA002015045_01922 CDS open 28654-29196 _na     180_aa PF11985 family protein
3822 MUXX01000020.1 GCA002015045_01923 CDS open 29206-29508 _na     100_aa Phage protein
3823 MUXX01000020.1 GCA002015045_01924 CDS open 29505-29813 _na     102_aa Lipoprotein
3824 MUXX01000020.1 GCA002015045_01925 CDS open 29930-30187 _na     85_aa PF10883 family protein
3825 MUXX01000020.1 GCA002015045_01926 CDS open 30184-30408 _na     74_aa DUF2644 domain-containing protein
3826 MUXX01000020.1 GCA002015045_01927 CDS open 30611-31153 _na     180_aa N-acetylmuramoyl-L-alanine amidase
3827 MUXX01000020.1 GCA002015045_01928 CDS open 31225-31551 _na     108_aa hypothetical protein
3828 MUXX01000020.1 GCA002015045_01929 CDS open 31577-31819 _na     80_aa hypothetical protein
3829 MUXX01000020.1 GCA002015045_01930 CDS open 31856-32743 _na     295_aa hypothetical protein
3830 MUXX01000020.1 GCA002015045_01931 CDS open 32765-32986 _na     73_aa Excalibur calcium-binding domain-containing protein
3831 MUXX01000020.1 GCA002015045_01932 CDS open 32996-33361 _na     121_aa Lipoprotein
3832 MUXX01000020.1 GCA002015045_01933 CDS open 33365-33874 _na     169_aa DUF4231 domain-containing protein
3833 MUXX01000020.1 GCA002015045_01934 CDS open 33874-34320 _na     148_aa Bacteriophage CI repressor N-terminal domain-containing protein
3834 MUXX01000020.1 GCA002015045_01935 CDS open 34412-34603 _na     63_aa DNA-binding protein
3835 MUXX01000020.1 GCA002015045_01936 CDS open 34688-34840 _na     50_aa hypothetical protein
3836 MUXX01000020.1 GCA002015045_01937 CDS open 34837-35136 _na     99_aa HTH iclR-type domain-containing protein
3837 MUXX01000020.1 GCA002015045_01938 CDS open 35146-36072 _na     308_aa Phage protein
3838 MUXX01000020.1 GCA002015045_01939 CDS open 36083-37903 _na     606_aa Integrase core domain protein
3839 MUXX01000020.1 GCA002015045_01940 CDS open 37965-39137 _na     390_aa AAA+ ATPase domain-containing protein
3840 MUXX01000020.1 GCA002015045_01941 CDS open 39144-39347 _na     67_aa Lipoprotein
3841 MUXX01000020.1 GCA002015045_01942 CDS open 39325-39558 _na     77_aa hypothetical protein
3842 MUXX01000020.1 GCA002015045_01943 CDS open 39551-40075 _na     174_aa Gam-like protein
3843 MUXX01000020.1 GCA002015045_01944 CDS open 40072-40293 _na     73_aa ANR family transcriptional regulator
3844 MUXX01000020.1 GCA002015045_01945 CDS open 40290-40448 _na     52_aa hypothetical protein
3845 MUXX01000020.1 GCA002015045_01946 CDS open 40499-40978 _na     159_aa DUF2752 domain-containing protein
3846 MUXX01000020.1 GCA002015045_01947 CDS open 40954-41328 _na     124_aa hypothetical protein
3847 MUXX01000020.1 GCA002015045_01948 CDS open 41325-41711 _na     128_aa PF06252 family protein
3848 MUXX01000020.1 GCA002015045_01949 CDS open 41711-42088 _na     125_aa rdgB DNA-binding protein RdgB
3849 MUXX01000020.1 GCA002015045_01884 gene open 49-633 pth
3850 MUXX01000020.1 GCA002015045_01885 gene open 756-1313
3851 MUXX01000020.1 GCA002015045_01886 gene open 1356-1664 rsaL
3852 MUXX01000020.1 GCA002015045_01887 gene open 1661-2008
3853 MUXX01000020.1 GCA002015045_01888 gene open 2115-3452 srmB
3854 MUXX01000020.1 GCA002015045_01889 gene open 3539-3679
3855 MUXX01000020.1 GCA002015045_01890 gene open 3690-4550 tesB
3856 MUXX01000020.1 GCA002015045_01891 gene open 5351-6139
3857 MUXX01000020.1 GCA002015045_01892 gene open 6277-6957
3858 MUXX01000020.1 GCA002015045_01893 gene open 6957-7283
3859 MUXX01000020.1 GCA002015045_01894 gene open 7280-7462
3860 MUXX01000020.1 GCA002015045_01895 gene open 7467-7826
3861 MUXX01000020.1 GCA002015045_01896 gene open 7816-8301
3862 MUXX01000020.1 GCA002015045_01897 gene open 8294-9049
3863 MUXX01000020.1 GCA002015045_01898 gene open 9060-9935
3864 MUXX01000020.1 GCA002015045_01899 gene open 9953-10531
3865 MUXX01000020.1 GCA002015045_01900 gene open 10524-11624
3866 MUXX01000020.1 GCA002015045_01901 gene open 11621-11980
3867 MUXX01000020.1 GCA002015045_01902 gene open 12035-12541
3868 MUXX01000020.1 GCA002015045_01903 gene open 12528-13592
3869 MUXX01000020.1 GCA002015045_01904 gene open 13585-13818
3870 MUXX01000020.1 GCA002015045_01905 gene open 13799-14734
3871 MUXX01000020.1 GCA002015045_01906 gene open 14747-17326
3872 MUXX01000020.1 GCA002015045_01907 gene open 17364-17633
3873 MUXX01000020.1 GCA002015045_01908 gene open 17792-18046
3874 MUXX01000020.1 GCA002015045_01909 gene open 18135-18653
3875 MUXX01000020.1 GCA002015045_01910 gene open 18666-20051
3876 MUXX01000020.1 GCA002015045_01911 gene open 20062-20529
3877 MUXX01000020.1 GCA002015045_01912 gene open 20540-20974
3878 MUXX01000020.1 GCA002015045_01913 gene open 20974-21234
3879 MUXX01000020.1 GCA002015045_01914 gene open 21308-22234
3880 MUXX01000020.1 GCA002015045_01915 gene open 22246-23205
3881 MUXX01000020.1 GCA002015045_01916 gene open 23443-23901
3882 MUXX01000020.1 GCA002015045_01917 gene open 23904-24155
3883 MUXX01000020.1 GCA002015045_01918 gene open 24284-25552
3884 MUXX01000020.1 GCA002015045_01919 gene open 25566-27035
3885 MUXX01000020.1 GCA002015045_01920 gene open 27045-27155
3886 MUXX01000020.1 GCA002015045_01921 gene open 27158-28654
3887 MUXX01000020.1 GCA002015045_01922 gene open 28654-29196
3888 MUXX01000020.1 GCA002015045_01923 gene open 29206-29508
3889 MUXX01000020.1 GCA002015045_01924 gene open 29505-29813
3890 MUXX01000020.1 GCA002015045_01925 gene open 29930-30187
3891 MUXX01000020.1 GCA002015045_01926 gene open 30184-30408
3892 MUXX01000020.1 GCA002015045_01927 gene open 30611-31153
3893 MUXX01000020.1 GCA002015045_01928 gene open 31225-31551
3894 MUXX01000020.1 GCA002015045_01929 gene open 31577-31819
3895 MUXX01000020.1 GCA002015045_01930 gene open 31856-32743
3896 MUXX01000020.1 GCA002015045_01931 gene open 32765-32986
3897 MUXX01000020.1 GCA002015045_01932 gene open 32996-33361
3898 MUXX01000020.1 GCA002015045_01933 gene open 33365-33874
3899 MUXX01000020.1 GCA002015045_01934 gene open 33874-34320
3900 MUXX01000020.1 GCA002015045_01935 gene open 34412-34603
3901 MUXX01000020.1 GCA002015045_01936 gene open 34688-34840
3902 MUXX01000020.1 GCA002015045_01937 gene open 34837-35136
3903 MUXX01000020.1 GCA002015045_01938 gene open 35146-36072
3904 MUXX01000020.1 GCA002015045_01939 gene open 36083-37903
3905 MUXX01000020.1 GCA002015045_01940 gene open 37965-39137
3906 MUXX01000020.1 GCA002015045_01941 gene open 39144-39347
3907 MUXX01000020.1 GCA002015045_01942 gene open 39325-39558
3908 MUXX01000020.1 GCA002015045_01943 gene open 39551-40075
3909 MUXX01000020.1 GCA002015045_01944 gene open 40072-40293
3910 MUXX01000020.1 GCA002015045_01945 gene open 40290-40448
3911 MUXX01000020.1 GCA002015045_01946 gene open 40499-40978
3912 MUXX01000020.1 GCA002015045_01947 gene open 40954-41328
3913 MUXX01000020.1 GCA002015045_01948 gene open 41325-41711
3914 MUXX01000020.1 GCA002015045_01949 gene open 41711-42088 rdgB
3915 MUXX01000021.1 GCA002015045_01950 CDS open 451-732 _na     93_aa vapD Endoribonuclease VapD
3916 MUXX01000021.1 GCA002015045_01951 CDS open 910-1806 _na     298_aa Heavy metal-associated domain protein
3917 MUXX01000021.1 GCA002015045_01952 CDS open 2366-3352 _na     328_aa repB Initiator RepB protein
3918 MUXX01000021.1 GCA002015045_01950 gene open 451-732 vapD
3919 MUXX01000021.1 GCA002015045_01951 gene open 910-1806
3920 MUXX01000021.1 GCA002015045_01952 gene open 2366-3352 repB
3921 MUXX01000022.1 GCA002015045_01982 gene open 23108-23192 sRNA-Xcc1
3922 MUXX01000022.1 GCA002015045_01982 ncRNA open 23108-23192 sRNA-Xcc1
3923 MUXX01000022.1 GCA002015045_01953 CDS open 3612-4199 _na     195_aa Phage-related protein%2C tail component
3924 MUXX01000022.1 GCA002015045_01954 CDS open 4142-4876 _na     244_aa NlpC/P60 family protein
3925 MUXX01000022.1 GCA002015045_01955 CDS open 4879-5592 _na     237_aa phage minor tail protein L
3926 MUXX01000022.1 GCA002015045_01956 CDS open 5668-6189 _na     173_aa DUF4236 domain-containing protein
3927 MUXX01000022.1 GCA002015045_01957 CDS open 6272-6616 _na     114_aa Phage-related protein
3928 MUXX01000022.1 GCA002015045_01958 CDS open 6621-8996 _na     791_aa Bacteriophage tail tape measure N-terminal domain-containing protein
3929 MUXX01000022.1 GCA002015045_01959 CDS open 8983-9243 _na     86_aa Minor tail protein T
3930 MUXX01000022.1 GCA002015045_01960 CDS open 9306-9695 _na     129_aa Phage protein
3931 MUXX01000022.1 GCA002015045_01961 CDS open 9698-10201 _na     167_aa Phage tail protein
3932 MUXX01000022.1 GCA002015045_01962 CDS open 10194-10598 _na     134_aa Phage minor tail protein U
3933 MUXX01000022.1 GCA002015045_01963 CDS open 10595-11140 _na     181_aa Prophage minor tail protein Z
3934 MUXX01000022.1 GCA002015045_01964 CDS open 11140-11445 _na     101_aa Phage protein
3935 MUXX01000022.1 GCA002015045_01965 CDS open 11426-11749 _na     107_aa DUF2190 domain-containing protein
3936 MUXX01000022.1 GCA002015045_01966 CDS open 11828-13834 _na     668_aa ClpP-like prohead protease/major capsid protein fusion protein
3937 MUXX01000022.1 GCA002015045_01967 CDS open 13806-15329 _na     507_aa phage portal protein
3938 MUXX01000022.1 GCA002015045_01968 CDS open 15333-15551 _na     72_aa Phage protein
3939 MUXX01000022.1 GCA002015045_01969 CDS open 15548-17671 _na     707_aa Phage terminase large subunit GpA
3940 MUXX01000022.1 GCA002015045_01970 CDS open 17671-18132 _na     153_aa PF07278 family protein
3941 MUXX01000022.1 GCA002015045_01971 CDS open 18575-18907 _na     110_aa PF10828 family protein
3942 MUXX01000022.1 GCA002015045_01972 CDS open 18880-19437 _na     185_aa Lysozyme
3943 MUXX01000022.1 GCA002015045_01973 CDS open 19421-19666 _na     81_aa Holin
3944 MUXX01000022.1 GCA002015045_01974 CDS open 19779-20258 _na     159_aa hypothetical protein
3945 MUXX01000022.1 GCA002015045_01975 CDS open 20236-20442 _na     68_aa hypothetical protein
3946 MUXX01000022.1 GCA002015045_01976 CDS open 20573-20938 _na     121_aa Phage antitermination protein Q
3947 MUXX01000022.1 GCA002015045_01977 CDS open 20938-21300 _na     120_aa rusA Crossover junction endodeoxyribonuclease rusA
3948 MUXX01000022.1 GCA002015045_01978 CDS open 21297-21911 _na     204_aa HNH nuclease domain-containing protein
3949 MUXX01000022.1 GCA002015045_01979 CDS open 21905-22198 _na     97_aa PF07102 family protein
3950 MUXX01000022.1 GCA002015045_01980 CDS open 22274-22579 _na     101_aa Plasmid maintenance system killer protein
3951 MUXX01000022.1 GCA002015045_01981 CDS open 22589-22918 _na     109_aa higA HigA family addiction module antitoxin
3952 MUXX01000022.1 GCA002015045_01983 CDS open 23225-23860 _na     211_aa BRO family%2C N-terminal domain protein
3953 MUXX01000022.1 GCA002015045_01984 CDS open 23889-24359 _na     156_aa PF07105 domain protein
3954 MUXX01000022.1 GCA002015045_01985 CDS open 24359-25201 _na     280_aa IstB-like ATP-binding domain protein
3955 MUXX01000022.1 GCA002015045_01986 CDS open 25198-25974 _na     258_aa Putative phage DNA replication protein O
3956 MUXX01000022.1 GCA002015045_01987 CDS open 25971-26663 _na     230_aa Phage antirepressor protein KilAC domain protein
3957 MUXX01000022.1 GCA002015045_01988 CDS open 26710-26985 _na     91_aa Bacteriophage CII protein
3958 MUXX01000022.1 GCA002015045_01989 CDS open 27001-27210 _na     69_aa helix-turn-helix transcriptional regulator
3959 MUXX01000022.1 GCA002015045_01990 CDS open 27342-28010 _na     222_aa Peptidase S24-like protein
3960 MUXX01000022.1 GCA002015045_01991 CDS open 28038-28781 _na     247_aa hipA Toxin-antitoxin system%2C toxin component%2C HipA family
3961 MUXX01000022.1 GCA002015045_01992 CDS open 28778-29593 _na     271_aa PF11236 family protein
3962 MUXX01000022.1 GCA002015045_01993 CDS open 29879-30415 _na     178_aa hypothetical protein
3963 MUXX01000022.1 GCA002015045_01994 CDS open 30748-30912 _na     54_aa TMhelix containing protein
3964 MUXX01000022.1 GCA002015045_01995 CDS open 31323-31928 _na     201_aa Erf family protein
3965 MUXX01000022.1 GCA002015045_01996 CDS open 31929-32600 _na     223_aa tolB Translocation protein TolB
3966 MUXX01000022.1 GCA002015045_01997 CDS open 32604-33077 _na     157_aa Single-stranded DNA-binding protein
3967 MUXX01000022.1 GCA002015045_01998 CDS open 33146-33526 _na     126_aa hypothetical protein
3968 MUXX01000022.1 GCA002015045_01999 CDS open 33557-34327 _na     256_aa Polymer-forming cytoskeletal
3969 MUXX01000022.1 GCA002015045_02000 CDS open 34311-34616 _na     101_aa Transposase
3970 MUXX01000022.1 GCA002015045_02001 CDS open 34683-34853 _na     56_aa Lipoprotein
3971 MUXX01000022.1 GCA002015045_01953 gene open 3612-4199
3972 MUXX01000022.1 GCA002015045_01954 gene open 4142-4876
3973 MUXX01000022.1 GCA002015045_01955 gene open 4879-5592
3974 MUXX01000022.1 GCA002015045_01956 gene open 5668-6189
3975 MUXX01000022.1 GCA002015045_01957 gene open 6272-6616
3976 MUXX01000022.1 GCA002015045_01958 gene open 6621-8996
3977 MUXX01000022.1 GCA002015045_01959 gene open 8983-9243
3978 MUXX01000022.1 GCA002015045_01960 gene open 9306-9695
3979 MUXX01000022.1 GCA002015045_01961 gene open 9698-10201
3980 MUXX01000022.1 GCA002015045_01962 gene open 10194-10598
3981 MUXX01000022.1 GCA002015045_01963 gene open 10595-11140
3982 MUXX01000022.1 GCA002015045_01964 gene open 11140-11445
3983 MUXX01000022.1 GCA002015045_01965 gene open 11426-11749
3984 MUXX01000022.1 GCA002015045_01966 gene open 11828-13834
3985 MUXX01000022.1 GCA002015045_01967 gene open 13806-15329
3986 MUXX01000022.1 GCA002015045_01968 gene open 15333-15551
3987 MUXX01000022.1 GCA002015045_01969 gene open 15548-17671
3988 MUXX01000022.1 GCA002015045_01970 gene open 17671-18132
3989 MUXX01000022.1 GCA002015045_01971 gene open 18575-18907
3990 MUXX01000022.1 GCA002015045_01972 gene open 18880-19437
3991 MUXX01000022.1 GCA002015045_01973 gene open 19421-19666
3992 MUXX01000022.1 GCA002015045_01974 gene open 19779-20258
3993 MUXX01000022.1 GCA002015045_01975 gene open 20236-20442
3994 MUXX01000022.1 GCA002015045_01976 gene open 20573-20938
3995 MUXX01000022.1 GCA002015045_01977 gene open 20938-21300 rusA
3996 MUXX01000022.1 GCA002015045_01978 gene open 21297-21911
3997 MUXX01000022.1 GCA002015045_01979 gene open 21905-22198
3998 MUXX01000022.1 GCA002015045_01980 gene open 22274-22579
3999 MUXX01000022.1 GCA002015045_01981 gene open 22589-22918 higA
4000 MUXX01000022.1 GCA002015045_01983 gene open 23225-23860