HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. oralis (GCA_002096275.1)

Select a Genome:
BAKTA Annotations for GCA_002096275.1
Genome Selected: Streptococcus oralis subsp. oralis
ContigsBases CDSrRNA tmRNAtRNA
18 1951470 1846 5 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3866 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3866 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 NCUG01000009.1 GCA002096275_01173 gene open 361-1909 rrs
2 NCUG01000009.1 GCA002096275_01175 gene open 2163-5065 rrl
3 NCUG01000009.1 GCA002096275_01176 gene open 5142-5257 rrf
4 NCUG01000009.1 GCA002096275_01173 rRNA open 361-1909 rrs 16S ribosomal RNA
5 NCUG01000009.1 GCA002096275_01175 rRNA open 2163-5065 rrl 23S ribosomal RNA
6 NCUG01000009.1 GCA002096275_01176 rRNA open 5142-5257 rrf 5S ribosomal RNA
7 NCUG01000009.1 GCA002096275_01172 gene open 59-130 trnE
8 NCUG01000009.1 GCA002096275_01174 gene open 1961-2033 trnA
9 NCUG01000009.1 GCA002096275_01172 tRNA open 59-130 trnE tRNA-Glu(ttc)
10 NCUG01000009.1 GCA002096275_01174 tRNA open 1961-2033 trnA tRNA-Ala(tgc)
11 NCUG01000010.1 repeat_region open 779-1616 CRISPR array with 13 repeats of length 36%2C consensus sequence GTTTTGGAACCATTCGAAACAACACAGCTCTAAAAC and spacer length 30
12 NCUG01000010.1 GCA002096275_01160 CDS open 1697-2359 _na     220_aa csn2 type II-A CRISPR-associated protein Csn2
13 NCUG01000010.1 GCA002096275_01161 CDS open 2349-2693 _na     114_aa cas2 CRISPR-associated endonuclease Cas2
14 NCUG01000010.1 GCA002096275_01162 CDS open 2690-3556 _na     288_aa cas1 type II CRISPR-associated endonuclease Cas1
15 NCUG01000010.1 GCA002096275_01163 CDS open 3556-7818 _na     1420_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
16 NCUG01000010.1 GCA002096275_01164 CDS open 8186-9085 _na     299_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
17 NCUG01000010.1 GCA002096275_01165 CDS open 9108-10124 _na     338_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
18 NCUG01000010.1 GCA002096275_01166 CDS open 10295-12037 _na     580_aa mdlB ABC transporter ATP-binding protein/permease
19 NCUG01000010.1 GCA002096275_01167 CDS open 12039-13805 _na     588_aa ABC transporter ATP-binding protein
20 NCUG01000010.1 GCA002096275_01168 CDS open 13944-14633 _na     229_aa puuD Gamma-glutamyl hydrolase
21 NCUG01000010.1 GCA002096275_01169 CDS open 14802-16151 _na     449_aa pgi glucose-6-phosphate isomerase
22 NCUG01000010.1 GCA002096275_01170 CDS open 16279-17739 _na     486_aa gltX glutamate--tRNA ligase
23 NCUG01000010.1 GCA002096275_01171 CDS open 17752-18186 _na     144_aa Cytidine/deoxycytidylate deaminase family protein
24 NCUG01000010.1 GCA002096275_01160 gene open 1697-2359 csn2
25 NCUG01000010.1 GCA002096275_01161 gene open 2349-2693 cas2
26 NCUG01000010.1 GCA002096275_01162 gene open 2690-3556 cas1
27 NCUG01000010.1 GCA002096275_01163 gene open 3556-7818 cas9
28 NCUG01000010.1 GCA002096275_01164 gene open 8186-9085 galU
29 NCUG01000010.1 GCA002096275_01165 gene open 9108-10124
30 NCUG01000010.1 GCA002096275_01166 gene open 10295-12037 mdlB
31 NCUG01000010.1 GCA002096275_01167 gene open 12039-13805
32 NCUG01000010.1 GCA002096275_01168 gene open 13944-14633 puuD
33 NCUG01000010.1 GCA002096275_01169 gene open 14802-16151 pgi
34 NCUG01000010.1 GCA002096275_01170 gene open 16279-17739 gltX
35 NCUG01000010.1 GCA002096275_01171 gene open 17752-18186
36 NCUG01000011.1 GCA002096275_01121 gene open 1588-1696 Srn266
37 NCUG01000011.1 GCA002096275_01121 ncRNA open 1588-1696 Streptococcus RNA 266
38 NCUG01000011.1 GCA002096275_01122 CDS open 1793-3070 _na     425_aa Glutamate--cysteine ligase
39 NCUG01000011.1 GCA002096275_01123 CDS open 3146-4630 _na     494_aa thrC threonine synthase
40 NCUG01000011.1 GCA002096275_01124 CDS open 4691-5971 _na     426_aa norM putative multidrug resistance protein NorM
41 NCUG01000011.1 GCA002096275_01125 CDS open 5975-6595 _na     206_aa HAD family hydrolase
42 NCUG01000011.1 GCA002096275_01126 CDS open 6761-7957 _na     398_aa lysM LysM domain-containing protein
43 NCUG01000011.1 GCA002096275_01127 CDS open 8106-8969 _na     287_aa Conserved domain protein
44 NCUG01000011.1 GCA002096275_01128 CDS open 9128-9553 _na     141_aa marR MarR family transcriptional regulator
45 NCUG01000011.1 GCA002096275_01129 CDS open 9564-9926 _na     120_aa PF06993 family protein
46 NCUG01000011.1 GCA002096275_01130 CDS open 9967-10824 _na     285_aa Beta-carotene 15%2C15'-monooxygenase
47 NCUG01000011.1 GCA002096275_01131 CDS open 10941-12083 _na     380_aa tgt tRNA guanosine(34) transglycosylase Tgt
48 NCUG01000011.1 GCA002096275_01132 CDS open 12214-14031 _na     605_aa oatA O-acetyltransferase OatA
49 NCUG01000011.1 GCA002096275_01133 CDS open 14172-15323 _na     383_aa nagA N-acetylglucosamine-6-phosphate deacetylase
50 NCUG01000011.1 GCA002096275_01134 CDS open 15480-15845 _na     121_aa Superoxide dismutase
51 NCUG01000011.1 GCA002096275_01135 CDS open 15907-16848 _na     313_aa comGA competence type IV pilus ATPase ComGA
52 NCUG01000011.1 GCA002096275_01136 CDS open 16796-17812 _na     338_aa comGB competence type IV pilus assembly protein ComGB
53 NCUG01000011.1 GCA002096275_01137 CDS open 17814-18137 _na     107_aa comGC competence type IV pilus major pilin ComGC
54 NCUG01000011.1 GCA002096275_01138 CDS open 18148-18534 _na     128_aa comGD competence type IV pilus minor pilin ComGD
55 NCUG01000011.1 GCA002096275_01139 CDS open 18497-18799 _na     100_aa comGE competence type IV pilus minor pilin ComGE
56 NCUG01000011.1 GCA002096275_01140 CDS open 18738-19223 _na     161_aa comGF competence type IV pilus minor pilin ComGF
57 NCUG01000011.1 GCA002096275_01141 CDS open 19201-19614 _na     137_aa comGG competence type IV pilus minor pilin ComGG
58 NCUG01000011.1 GCA002096275_01142 CDS open 19647-20234 _na     195_aa Ubiquinone biosynthesis O-methyltransferase
59 NCUG01000011.1 GCA002096275_01143 CDS open 20295-21248 _na     317_aa Adenine-specific methyltransferase
60 NCUG01000011.1 GCA002096275_01144 CDS open 21299-22489 _na     396_aa ackA Acetate kinase
61 NCUG01000011.1 GCA002096275_01145 CDS open 22639-23010 _na     123_aa rnpA ribonuclease P protein component
62 NCUG01000011.1 GCA002096275_01146 CDS open 22979-23812 _na     277_aa yidC Membrane protein insertase YidC
63 NCUG01000011.1 GCA002096275_01147 CDS open 23827-24813 _na     328_aa jag RNA-binding cell elongation regulator Jag/EloR
64 NCUG01000011.1 GCA002096275_01148 CDS open 24869-25513 _na     214_aa Ribonuclease P
65 NCUG01000011.1 GCA002096275_01149 CDS open 25610-27586 _na     658_aa tkt transketolase
66 NCUG01000011.1 GCA002096275_01150 CDS open 27704-28024 _na     106_aa yajC preprotein translocase subunit YajC
67 NCUG01000011.1 GCA002096275_01151 CDS open 28072-28515 _na     147_aa protein-tyrosine-phosphatase
68 NCUG01000011.1 GCA002096275_01152 CDS open 28502-28915 _na     137_aa MORN repeat protein
69 NCUG01000011.1 GCA002096275_01153 CDS open 29212-31863 _na     883_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
70 NCUG01000011.1 GCA002096275_01154 CDS open 32180-33190 _na     336_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
71 NCUG01000011.1 GCA002096275_01155 CDS open 33261-34097 _na     278_aa Pseudouridine synthase
72 NCUG01000011.1 GCA002096275_01156 CDS open 34223-36418 _na     731_aa pbp2a penicillin-binding protein PBP2A
73 NCUG01000011.1 GCA002096275_01157 CDS open 36633-36809 _na     58_aa secE preprotein translocase subunit SecE
74 NCUG01000011.1 GCA002096275_01158 CDS open 36867-37403 _na     178_aa nusG transcription termination/antitermination protein NusG
75 NCUG01000011.1 GCA002096275_01159 CDS open 37524-37997 _na     157_aa comX2 Transcriptional regulator ComX2
76 NCUG01000011.1 GCA002096275_01122 gene open 1793-3070
77 NCUG01000011.1 GCA002096275_01123 gene open 3146-4630 thrC
78 NCUG01000011.1 GCA002096275_01124 gene open 4691-5971 norM
79 NCUG01000011.1 GCA002096275_01125 gene open 5975-6595
80 NCUG01000011.1 GCA002096275_01126 gene open 6761-7957 lysM
81 NCUG01000011.1 GCA002096275_01127 gene open 8106-8969
82 NCUG01000011.1 GCA002096275_01128 gene open 9128-9553 marR
83 NCUG01000011.1 GCA002096275_01129 gene open 9564-9926
84 NCUG01000011.1 GCA002096275_01130 gene open 9967-10824
85 NCUG01000011.1 GCA002096275_01131 gene open 10941-12083 tgt
86 NCUG01000011.1 GCA002096275_01132 gene open 12214-14031 oatA
87 NCUG01000011.1 GCA002096275_01133 gene open 14172-15323 nagA
88 NCUG01000011.1 GCA002096275_01134 gene open 15480-15845
89 NCUG01000011.1 GCA002096275_01135 gene open 15907-16848 comGA
90 NCUG01000011.1 GCA002096275_01136 gene open 16796-17812 comGB
91 NCUG01000011.1 GCA002096275_01137 gene open 17814-18137 comGC
92 NCUG01000011.1 GCA002096275_01138 gene open 18148-18534 comGD
93 NCUG01000011.1 GCA002096275_01139 gene open 18497-18799 comGE
94 NCUG01000011.1 GCA002096275_01140 gene open 18738-19223 comGF
95 NCUG01000011.1 GCA002096275_01141 gene open 19201-19614 comGG
96 NCUG01000011.1 GCA002096275_01142 gene open 19647-20234
97 NCUG01000011.1 GCA002096275_01143 gene open 20295-21248
98 NCUG01000011.1 GCA002096275_01144 gene open 21299-22489 ackA
99 NCUG01000011.1 GCA002096275_01145 gene open 22639-23010 rnpA
100 NCUG01000011.1 GCA002096275_01146 gene open 22979-23812 yidC
101 NCUG01000011.1 GCA002096275_01147 gene open 23827-24813 jag
102 NCUG01000011.1 GCA002096275_01148 gene open 24869-25513
103 NCUG01000011.1 GCA002096275_01149 gene open 25610-27586 tkt
104 NCUG01000011.1 GCA002096275_01150 gene open 27704-28024 yajC
105 NCUG01000011.1 GCA002096275_01151 gene open 28072-28515
106 NCUG01000011.1 GCA002096275_01152 gene open 28502-28915
107 NCUG01000011.1 GCA002096275_01153 gene open 29212-31863 adhE
108 NCUG01000011.1 GCA002096275_01154 gene open 32180-33190 gap
109 NCUG01000011.1 GCA002096275_01155 gene open 33261-34097
110 NCUG01000011.1 GCA002096275_01156 gene open 34223-36418 pbp2a
111 NCUG01000011.1 GCA002096275_01157 gene open 36633-36809 secE
112 NCUG01000011.1 GCA002096275_01158 gene open 36867-37403 nusG
113 NCUG01000011.1 GCA002096275_01159 gene open 37524-37997 comX2
114 NCUG01000011.1 GCA002096275_01109 gene open 18-90 trnV
115 NCUG01000011.1 GCA002096275_01110 gene open 96-166 trnG
116 NCUG01000011.1 GCA002096275_01111 gene open 201-274 trnI
117 NCUG01000011.1 GCA002096275_01112 gene open 286-357 trnE
118 NCUG01000011.1 GCA002096275_01113 gene open 364-453 trnS
119 NCUG01000011.1 GCA002096275_01114 gene open 465-538 trnfM
120 NCUG01000011.1 GCA002096275_01115 gene open 542-614 trnF
121 NCUG01000011.1 GCA002096275_01116 gene open 632-712 trnY
122 NCUG01000011.1 GCA002096275_01117 gene open 724-794 trnW
123 NCUG01000011.1 GCA002096275_01118 gene open 809-881 trnH
124 NCUG01000011.1 GCA002096275_01119 gene open 895-966 trnQ
125 NCUG01000011.1 GCA002096275_01120 gene open 976-1059 trnL
126 NCUG01000011.1 GCA002096275_01109 tRNA open 18-90 trnV tRNA-Val(tac)
127 NCUG01000011.1 GCA002096275_01110 tRNA open 96-166 trnG tRNA-Gly(tcc)
128 NCUG01000011.1 GCA002096275_01111 tRNA open 201-274 trnI tRNA-Ile(gat)
129 NCUG01000011.1 GCA002096275_01112 tRNA open 286-357 trnE tRNA-Glu(ttc)
130 NCUG01000011.1 GCA002096275_01113 tRNA open 364-453 trnS tRNA-Ser(tga)
131 NCUG01000011.1 GCA002096275_01114 tRNA open 465-538 trnfM tRNA-fMet(cat)
132 NCUG01000011.1 GCA002096275_01115 tRNA open 542-614 trnF tRNA-Phe(gaa)
133 NCUG01000011.1 GCA002096275_01116 tRNA open 632-712 trnY tRNA-Tyr(gta)
134 NCUG01000011.1 GCA002096275_01117 tRNA open 724-794 trnW tRNA-Trp(cca)
135 NCUG01000011.1 GCA002096275_01118 tRNA open 809-881 trnH tRNA-His(gtg)
136 NCUG01000011.1 GCA002096275_01119 tRNA open 895-966 trnQ tRNA-Gln(ttg)
137 NCUG01000011.1 GCA002096275_01120 tRNA open 976-1059 trnL tRNA-Leu(caa)
138 NCUG01000012.1 GCA002096275_01010 gene open 1-94 rrf
139 NCUG01000012.1 regulatory_region open 29941-30036 Purine riboswitch aptamer
140 NCUG01000012.1 regulatory_region open 38425-38655 T-box leader
141 NCUG01000012.1 regulatory_region open 40096-40321 T-box leader
142 NCUG01000012.1 GCA002096275_01010 rRNA open 1-94 rrf 5S ribosomal RNA
143 NCUG01000012.1 GCA002096275_01028 CDS open 1741-2445 _na     234_aa Integral membrane protein
144 NCUG01000012.1 GCA002096275_01029 CDS open 2548-3486 _na     312_aa birA bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA
145 NCUG01000012.1 GCA002096275_01030 CDS open 3483-4343 _na     286_aa AraC-like ligand binding domain protein
146 NCUG01000012.1 GCA002096275_01031 CDS open 4451-6613 _na     720_aa Alpha-galactosidase
147 NCUG01000012.1 GCA002096275_01032 CDS open 6626-7876 _na     416_aa Multiple sugar-binding protein
148 NCUG01000012.1 GCA002096275_01033 CDS open 7895-8767 _na     290_aa lacF Lactose transport system permease protein LacF
149 NCUG01000012.1 GCA002096275_01034 CDS open 8784-9617 _na     277_aa Carbohydrate ABC transporter permease
150 NCUG01000012.1 GCA002096275_01035 CDS open 9824-11266 _na     480_aa gtfA sucrose phosphorylase
151 NCUG01000012.1 GCA002096275_01036 CDS open 11321-12592 _na     423_aa O-antigen ligase
152 NCUG01000012.1 GCA002096275_01037 CDS open 12736-13179 _na     147_aa marR Transcriptional regulator%2C MarR family
153 NCUG01000012.1 GCA002096275_01038 CDS open 13183-13947 _na     254_aa SnoaL-like domain-containing protein
154 NCUG01000012.1 GCA002096275_01039 CDS open 13962-14690 _na     242_aa egtUA putative ergothioneine transport ATP-binding protein EgtUA
155 NCUG01000012.1 GCA002096275_01040 CDS open 14683-16203 _na     506_aa egtUBC Ergothioneine transporter EgtUBC
156 NCUG01000012.1 GCA002096275_01041 CDS open 16542-17144 _na     200_aa ECF transporter S component
157 NCUG01000012.1 GCA002096275_01042 CDS open 17141-17935 _na     264_aa ecfT Cobalt transport protein
158 NCUG01000012.1 GCA002096275_01043 CDS open 17911-18747 _na     278_aa ecfA2 Cobalt/nickel transport system ATP-binding protein
159 NCUG01000012.1 GCA002096275_01044 CDS open 18734-19534 _na     266_aa ecfA2 Cobalt transport system ATP-binding protein
160 NCUG01000012.1 GCA002096275_01045 CDS open 19616-19756 _na     46_aa hypothetical protein
161 NCUG01000012.1 GCA002096275_01046 CDS open 19759-19920 _na     53_aa hsdD HsdD protein
162 NCUG01000012.1 GCA002096275_01047 CDS open 20148-20384 _na     78_aa Plasmid replication protein
163 NCUG01000012.1 GCA002096275_01048 CDS open 20377-21072 _na     231_aa IS6 family transposase
164 NCUG01000012.1 GCA002096275_01049 CDS open 21169-21618 _na     149_aa Nicotinamide mononucleotide transporter%2Cputative
165 NCUG01000012.1 GCA002096275_01050 CDS open 21653-21985 _na     110_aa Glucuronide permease
166 NCUG01000012.1 GCA002096275_01051 CDS open 22012-22602 _na     196_aa HTH tetR-type domain-containing protein
167 NCUG01000012.1 GCA002096275_01052 CDS open 22699-23589 _na     296_aa Cation efflux system protein
168 NCUG01000012.1 GCA002096275_01053 CDS open 23623-24627 _na     334_aa galR DNA-binding transcriptional regulator GalR
169 NCUG01000012.1 GCA002096275_01054 CDS open 24792-25970 _na     392_aa galK galactokinase
170 NCUG01000012.1 GCA002096275_01055 CDS open 25989-27470 _na     493_aa galT UDP-glucose--hexose-1-phosphate uridylyltransferase
171 NCUG01000012.1 GCA002096275_01056 CDS open 27540-27944 _na     134_aa paaI Thioesterase domain-containing protein
172 NCUG01000012.1 GCA002096275_01057 CDS open 27977-29239 _na     420_aa uraA Nucleobase:cation symporter for xanthine
173 NCUG01000012.1 GCA002096275_01058 CDS open 29239-29820 _na     193_aa xpt xanthine phosphoribosyltransferase
174 NCUG01000012.1 GCA002096275_01059 CDS open 30169-30555 _na     128_aa Bleomycin resistance protein
175 NCUG01000012.1 GCA002096275_01060 CDS open 30567-31394 _na     275_aa exoA exodeoxyribonuclease III
176 NCUG01000012.1 GCA002096275_01061 CDS open 31528-31983 _na     151_aa DUF3290 domain-containing protein
177 NCUG01000012.1 GCA002096275_01062 CDS open 31980-32615 _na     211_aa DUF421 domain-containing protein
178 NCUG01000012.1 GCA002096275_01063 CDS open 32776-34521 _na     581_aa mdlB ABC transporter%2C ATP-binding protein
179 NCUG01000012.1 GCA002096275_01064 CDS open 34511-36253 _na     580_aa exp8 Putative ABC transporter ATP-binding protein exp8
180 NCUG01000012.1 GCA002096275_01065 CDS open 36437-37129 _na     230_aa wcaJ Bacterial sugar transferase domain-containing protein
181 NCUG01000012.1 GCA002096275_01066 CDS open 37172-38401 _na     409_aa wecE Spore coat polysaccharide biosynthesis protein spsC
182 NCUG01000012.1 GCA002096275_01067 CDS open 38921-40099 _na     392_aa trpB tryptophan synthase subunit beta
183 NCUG01000012.1 GCA002096275_01068 CDS open 40698-42059 _na     453_aa trpE anthranilate synthase component I
184 NCUG01000012.1 GCA002096275_01069 CDS open 42056-42622 _na     188_aa pabA Amidotransferase component of Anthranilate synthase or Para-aminobenzoate synthase
185 NCUG01000012.1 GCA002096275_01070 CDS open 42633-43637 _na     334_aa trpD Anthranilate phosphoribosyltransferase
186 NCUG01000012.1 GCA002096275_01071 CDS open 43634-44401 _na     255_aa trpC indole-3-glycerol phosphate synthase TrpC
187 NCUG01000012.1 GCA002096275_01072 CDS open 44388-44987 _na     199_aa phosphoribosylanthranilate isomerase
188 NCUG01000012.1 GCA002096275_01073 CDS open 44965-46188 _na     407_aa trpB tryptophan synthase subunit beta
189 NCUG01000012.1 GCA002096275_01074 CDS open 46181-46957 _na     258_aa trpA tryptophan synthase subunit alpha
190 NCUG01000012.1 GCA002096275_01075 CDS open 46929-47588 _na     219_aa Prepilin peptidase A24 N-terminal domain-containing protein
191 NCUG01000012.1 GCA002096275_01076 CDS open 47625-48113 _na     162_aa N-acetyltransferase
192 NCUG01000012.1 GCA002096275_01077 CDS open 48193-49452 _na     419_aa TSPc%2C tail specific protease
193 NCUG01000012.1 GCA002096275_01078 CDS open 49758-49856 _na     32_aa hypothetical protein
194 NCUG01000012.1 GCA002096275_01079 CDS open 49985-51130 _na     381_aa Low temperature requirement protein A
195 NCUG01000012.1 GCA002096275_01080 CDS open 51345-51866 _na     173_aa HTH cro/C1-type domain-containing protein
196 NCUG01000012.1 GCA002096275_01081 CDS open 52317-52922 _na     201_aa DUF1269 domain-containing protein
197 NCUG01000012.1 GCA002096275_01082 CDS open 53690-54205 _na     171_aa DUF308 domain-containing protein
198 NCUG01000012.1 GCA002096275_01084 CDS open 54880-56151 _na     423_aa rarA Replication-associated recombination protein A
199 NCUG01000012.1 GCA002096275_01085 CDS open 56267-56737 _na     156_aa DUF3013 domain-containing protein
200 NCUG01000012.1 GCA002096275_01086 CDS open 56783-57313 _na     176_aa ATP-binding protein
201 NCUG01000012.1 GCA002096275_01087 CDS open 57504-58835 _na     443_aa hypothetical protein
202 NCUG01000012.1 GCA002096275_01088 CDS open 58838-59095 _na     85_aa hypothetical protein
203 NCUG01000012.1 GCA002096275_01089 CDS open 59338-59496 _na     52_aa 7%2C8-dihydro-8-oxoguanine-triphosphatase
204 NCUG01000012.1 GCA002096275_01090 CDS open 59604-60638 _na     344_aa ftsH ATP-dependent zinc metalloprotease FtsH 4
205 NCUG01000012.1 GCA002096275_01091 CDS open 60640-62883 _na     747_aa Peptidase S8/S53 domain-containing protein
206 NCUG01000012.1 GCA002096275_01092 CDS open 62934-63953 _na     339_aa Tryptophan synthase subunit beta
207 NCUG01000012.1 GCA002096275_01093 CDS open 63968-64918 _na     316_aa prmA 50S ribosomal protein L11 methyltransferase
208 NCUG01000012.1 GCA002096275_01094 CDS open 64920-65663 _na     247_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
209 NCUG01000012.1 GCA002096275_01095 CDS open 65674-67470 _na     598_aa pepF oligoendopeptidase F
210 NCUG01000012.1 GCA002096275_01096 CDS open 67499-68281 _na     260_aa Deoxyribonuclease
211 NCUG01000012.1 GCA002096275_01097 CDS open 68343-69143 _na     266_aa Aquaporin Z
212 NCUG01000012.1 GCA002096275_01098 CDS open 69253-69921 _na     222_aa glpF Aquaporin
213 NCUG01000012.1 GCA002096275_01099 CDS open 70175-70666 _na     163_aa queF preQ(1) synthase
214 NCUG01000012.1 GCA002096275_01100 CDS open 70685-71401 _na     238_aa queE 7-carboxy-7-deazaguanine synthase QueE
215 NCUG01000012.1 GCA002096275_01101 CDS open 71394-71837 _na     147_aa queD 6-carboxytetrahydropterin synthase QueD
216 NCUG01000012.1 GCA002096275_01102 CDS open 71837-72490 _na     217_aa queC 7-cyano-7-deazaguanine synthase QueC
217 NCUG01000012.1 GCA002096275_01103 CDS open 72694-73008 _na     104_aa trxA thioredoxin
218 NCUG01000012.1 GCA002096275_01104 CDS open 73024-73245 _na     73_aa 30S ribosomal protein S16
219 NCUG01000012.1 GCA002096275_01105 CDS open 73343-73723 _na     126_aa Putative transcriptional regulator
220 NCUG01000012.1 GCA002096275_01106 CDS open 73920-74294 _na     124_aa lrgA LrgA family protein
221 NCUG01000012.1 GCA002096275_01107 CDS open 74291-74986 _na     231_aa lrgB Murein hydrolase effector protein LrgB
222 NCUG01000012.1 GCA002096275_01108 CDS open 75099-75278 _na     59_aa Choline-binding protein Cbp5
223 NCUG01000012.1 GCA002096275_01028 gene open 1741-2445
224 NCUG01000012.1 GCA002096275_01029 gene open 2548-3486 birA
225 NCUG01000012.1 GCA002096275_01030 gene open 3483-4343
226 NCUG01000012.1 GCA002096275_01031 gene open 4451-6613
227 NCUG01000012.1 GCA002096275_01032 gene open 6626-7876
228 NCUG01000012.1 GCA002096275_01033 gene open 7895-8767 lacF
229 NCUG01000012.1 GCA002096275_01034 gene open 8784-9617
230 NCUG01000012.1 GCA002096275_01035 gene open 9824-11266 gtfA
231 NCUG01000012.1 GCA002096275_01036 gene open 11321-12592
232 NCUG01000012.1 GCA002096275_01037 gene open 12736-13179 marR
233 NCUG01000012.1 GCA002096275_01038 gene open 13183-13947
234 NCUG01000012.1 GCA002096275_01039 gene open 13962-14690 egtUA
235 NCUG01000012.1 GCA002096275_01040 gene open 14683-16203 egtUBC
236 NCUG01000012.1 GCA002096275_01041 gene open 16542-17144
237 NCUG01000012.1 GCA002096275_01042 gene open 17141-17935 ecfT
238 NCUG01000012.1 GCA002096275_01043 gene open 17911-18747 ecfA2
239 NCUG01000012.1 GCA002096275_01044 gene open 18734-19534 ecfA2
240 NCUG01000012.1 GCA002096275_01045 gene open 19616-19756
241 NCUG01000012.1 GCA002096275_01046 gene open 19759-19920 hsdD
242 NCUG01000012.1 GCA002096275_01047 gene open 20148-20384
243 NCUG01000012.1 GCA002096275_01048 gene open 20377-21072
244 NCUG01000012.1 GCA002096275_01049 gene open 21169-21618
245 NCUG01000012.1 GCA002096275_01050 gene open 21653-21985
246 NCUG01000012.1 GCA002096275_01051 gene open 22012-22602
247 NCUG01000012.1 GCA002096275_01052 gene open 22699-23589
248 NCUG01000012.1 GCA002096275_01053 gene open 23623-24627 galR
249 NCUG01000012.1 GCA002096275_01054 gene open 24792-25970 galK
250 NCUG01000012.1 GCA002096275_01055 gene open 25989-27470 galT
251 NCUG01000012.1 GCA002096275_01056 gene open 27540-27944 paaI
252 NCUG01000012.1 GCA002096275_01057 gene open 27977-29239 uraA
253 NCUG01000012.1 GCA002096275_01058 gene open 29239-29820 xpt
254 NCUG01000012.1 GCA002096275_01059 gene open 30169-30555
255 NCUG01000012.1 GCA002096275_01060 gene open 30567-31394 exoA
256 NCUG01000012.1 GCA002096275_01061 gene open 31528-31983
257 NCUG01000012.1 GCA002096275_01062 gene open 31980-32615
258 NCUG01000012.1 GCA002096275_01063 gene open 32776-34521 mdlB
259 NCUG01000012.1 GCA002096275_01064 gene open 34511-36253 exp8
260 NCUG01000012.1 GCA002096275_01065 gene open 36437-37129 wcaJ
261 NCUG01000012.1 GCA002096275_01066 gene open 37172-38401 wecE
262 NCUG01000012.1 GCA002096275_01067 gene open 38921-40099 trpB
263 NCUG01000012.1 GCA002096275_01068 gene open 40698-42059 trpE
264 NCUG01000012.1 GCA002096275_01069 gene open 42056-42622 pabA
265 NCUG01000012.1 GCA002096275_01070 gene open 42633-43637 trpD
266 NCUG01000012.1 GCA002096275_01071 gene open 43634-44401 trpC
267 NCUG01000012.1 GCA002096275_01072 gene open 44388-44987
268 NCUG01000012.1 GCA002096275_01073 gene open 44965-46188 trpB
269 NCUG01000012.1 GCA002096275_01074 gene open 46181-46957 trpA
270 NCUG01000012.1 GCA002096275_01075 gene open 46929-47588
271 NCUG01000012.1 GCA002096275_01076 gene open 47625-48113
272 NCUG01000012.1 GCA002096275_01077 gene open 48193-49452
273 NCUG01000012.1 GCA002096275_01078 gene open 49758-49856
274 NCUG01000012.1 GCA002096275_01079 gene open 49985-51130
275 NCUG01000012.1 GCA002096275_01080 gene open 51345-51866
276 NCUG01000012.1 GCA002096275_01081 gene open 52317-52922
277 NCUG01000012.1 GCA002096275_01082 gene open 53690-54205
278 NCUG01000012.1 GCA002096275_01084 gene open 54880-56151 rarA
279 NCUG01000012.1 GCA002096275_01085 gene open 56267-56737
280 NCUG01000012.1 GCA002096275_01086 gene open 56783-57313
281 NCUG01000012.1 GCA002096275_01087 gene open 57504-58835
282 NCUG01000012.1 GCA002096275_01088 gene open 58838-59095
283 NCUG01000012.1 GCA002096275_01089 gene open 59338-59496
284 NCUG01000012.1 GCA002096275_01090 gene open 59604-60638 ftsH
285 NCUG01000012.1 GCA002096275_01091 gene open 60640-62883
286 NCUG01000012.1 GCA002096275_01092 gene open 62934-63953
287 NCUG01000012.1 GCA002096275_01093 gene open 63968-64918 prmA
288 NCUG01000012.1 GCA002096275_01094 gene open 64920-65663 rsmE
289 NCUG01000012.1 GCA002096275_01095 gene open 65674-67470 pepF
290 NCUG01000012.1 GCA002096275_01096 gene open 67499-68281
291 NCUG01000012.1 GCA002096275_01097 gene open 68343-69143
292 NCUG01000012.1 GCA002096275_01098 gene open 69253-69921 glpF
293 NCUG01000012.1 GCA002096275_01099 gene open 70175-70666 queF
294 NCUG01000012.1 GCA002096275_01100 gene open 70685-71401 queE
295 NCUG01000012.1 GCA002096275_01101 gene open 71394-71837 queD
296 NCUG01000012.1 GCA002096275_01102 gene open 71837-72490 queC
297 NCUG01000012.1 GCA002096275_01103 gene open 72694-73008 trxA
298 NCUG01000012.1 GCA002096275_01104 gene open 73024-73245
299 NCUG01000012.1 GCA002096275_01105 gene open 73343-73723
300 NCUG01000012.1 GCA002096275_01106 gene open 73920-74294 lrgA
301 NCUG01000012.1 GCA002096275_01107 gene open 74291-74986 lrgB
302 NCUG01000012.1 GCA002096275_01108 gene open 75099-75278
303 NCUG01000012.1 GCA002096275_01011 gene open 99-171 trnV
304 NCUG01000012.1 GCA002096275_01012 gene open 176-248 trnD
305 NCUG01000012.1 GCA002096275_01013 gene open 273-345 trnK
306 NCUG01000012.1 GCA002096275_01014 gene open 351-432 trnL
307 NCUG01000012.1 GCA002096275_01015 gene open 445-517 trnT
308 NCUG01000012.1 GCA002096275_01016 gene open 545-616 trnG
309 NCUG01000012.1 GCA002096275_01017 gene open 624-709 trnL
310 NCUG01000012.1 GCA002096275_01018 gene open 721-794 trnR
311 NCUG01000012.1 GCA002096275_01019 gene open 810-883 trnP
312 NCUG01000012.1 GCA002096275_01020 gene open 889-962 trnM
313 NCUG01000012.1 GCA002096275_01021 gene open 976-1049 trnI
314 NCUG01000012.1 GCA002096275_01022 gene open 1061-1150 trnS
315 NCUG01000012.1 GCA002096275_01023 gene open 1162-1235 trnfM
316 NCUG01000012.1 GCA002096275_01024 gene open 1239-1311 trnF
317 NCUG01000012.1 GCA002096275_01025 gene open 1328-1398 trnG
318 NCUG01000012.1 GCA002096275_01026 gene open 1432-1505 trnI
319 NCUG01000012.1 GCA002096275_01027 gene open 1512-1599 trnS
320 NCUG01000012.1 GCA002096275_01083 gene open 54544-54616 trnK
321 NCUG01000012.1 GCA002096275_01011 tRNA open 99-171 trnV tRNA-Val(tac)
322 NCUG01000012.1 GCA002096275_01012 tRNA open 176-248 trnD tRNA-Asp(gtc)
323 NCUG01000012.1 GCA002096275_01013 tRNA open 273-345 trnK tRNA-Lys(ttt)
324 NCUG01000012.1 GCA002096275_01014 tRNA open 351-432 trnL tRNA-Leu(tag)
325 NCUG01000012.1 GCA002096275_01015 tRNA open 445-517 trnT tRNA-Thr(tgt)
326 NCUG01000012.1 GCA002096275_01016 tRNA open 545-616 trnG tRNA-Gly(gcc)
327 NCUG01000012.1 GCA002096275_01017 tRNA open 624-709 trnL tRNA-Leu(taa)
328 NCUG01000012.1 GCA002096275_01018 tRNA open 721-794 trnR tRNA-Arg(acg)
329 NCUG01000012.1 GCA002096275_01019 tRNA open 810-883 trnP tRNA-Pro(tgg)
330 NCUG01000012.1 GCA002096275_01020 tRNA open 889-962 trnM tRNA-Met(cat)
331 NCUG01000012.1 GCA002096275_01021 tRNA open 976-1049 trnI tRNA-Ile2(cat)
332 NCUG01000012.1 GCA002096275_01022 tRNA open 1061-1150 trnS tRNA-Ser(tga)
333 NCUG01000012.1 GCA002096275_01023 tRNA open 1162-1235 trnfM tRNA-fMet(cat)
334 NCUG01000012.1 GCA002096275_01024 tRNA open 1239-1311 trnF tRNA-Phe(gaa)
335 NCUG01000012.1 GCA002096275_01025 tRNA open 1328-1398 trnG tRNA-Gly(tcc)
336 NCUG01000012.1 GCA002096275_01026 tRNA open 1432-1505 trnI tRNA-Ile(gat)
337 NCUG01000012.1 GCA002096275_01027 tRNA open 1512-1599 trnS tRNA-Ser(gct)
338 NCUG01000012.1 GCA002096275_01083 tRNA open 54544-54616 trnK tRNA-Lys(ctt)
339 NCUG01000013.1 regulatory_region open 23505-23640 Ribosomal protein L10 leader
340 NCUG01000013.1 GCA002096275_00912 CDS open 2642-3199 _na     185_aa acrR DNA-binding transcriptional repressor AcrR
341 NCUG01000013.1 GCA002096275_00913 CDS open 3233-3451 _na     72_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
342 NCUG01000013.1 GCA002096275_00914 CDS open 3549-3869 _na     106_aa YolD-like protein
343 NCUG01000013.1 GCA002096275_00915 CDS open 3897-4235 _na     112_aa ATP cone domain protein
344 NCUG01000013.1 GCA002096275_00916 CDS open 4247-4966 _na     239_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
345 NCUG01000013.1 GCA002096275_00917 CDS open 4956-5474 _na     172_aa rimM ribosome maturation factor RimM
346 NCUG01000013.1 GCA002096275_00918 CDS open 5505-6293 _na     262_aa Alpha/beta hydrolase
347 NCUG01000013.1 GCA002096275_00919 CDS open 6396-6725 _na     109_aa NTP pyrophosphohydrolase MazG-like domain-containing protein
348 NCUG01000013.1 GCA002096275_00920 CDS open 6769-7008 _na     79_aa khpA RNA-binding protein KhpA
349 NCUG01000013.1 GCA002096275_00921 CDS open 7028-7300 _na     90_aa rpsP 30S ribosomal protein S16
350 NCUG01000013.1 GCA002096275_00922 CDS open 7536-8279 _na     247_aa Lactose phosphotransferase system repressor 2
351 NCUG01000013.1 GCA002096275_00923 CDS open 8293-9105 _na     270_aa Haloacid dehalogenase
352 NCUG01000013.1 GCA002096275_00924 CDS open 9178-9981 _na     267_aa ppiB Peptidyl-prolyl cis-trans isomerase
353 NCUG01000013.1 GCA002096275_00925 CDS open 10037-11578 _na     513_aa abc-f ribosomal protection-like ABC-F family protein
354 NCUG01000013.1 GCA002096275_00926 CDS open 11578-12063 _na     161_aa VanZ-like protein
355 NCUG01000013.1 GCA002096275_00927 CDS open 12065-13150 _na     361_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
356 NCUG01000013.1 GCA002096275_00928 CDS open 13171-13701 _na     176_aa Transcriptional regulator
357 NCUG01000013.1 GCA002096275_00929 CDS open 13857-14462 _na     201_aa sodA Superoxide dismutase [Mn]
358 NCUG01000013.1 GCA002096275_00930 CDS open 14535-15569 _na     344_aa holA DNA polymerase III subunit delta
359 NCUG01000013.1 GCA002096275_00931 CDS open 15602-16537 _na     311_aa pyrDA dihydroorotate oxidase
360 NCUG01000013.1 GCA002096275_00932 CDS open 16769-18115 _na     448_aa gdhA NADP-specific glutamate dehydrogenase
361 NCUG01000013.1 GCA002096275_00933 CDS open 18212-18856 _na     214_aa HTH-type transcriptional repressor Bm3R1
362 NCUG01000013.1 GCA002096275_00934 CDS open 18873-19877 _na     334_aa Zinc-binding oxidoreductase
363 NCUG01000013.1 GCA002096275_00935 CDS open 20091-20459 _na     122_aa EXLDI protein
364 NCUG01000013.1 GCA002096275_00936 CDS open 20522-21424 _na     300_aa DUF2268 domain-containing protein
365 NCUG01000013.1 GCA002096275_00937 CDS open 21587-22153 _na     188_aa DUF304 domain-containing protein
366 NCUG01000013.1 GCA002096275_00938 CDS open 22525-22893 _na     122_aa rplL 50S ribosomal protein L7/L12
367 NCUG01000013.1 GCA002096275_00939 CDS open 22966-23466 _na     166_aa rplJ 50S ribosomal protein L10
368 NCUG01000013.1 GCA002096275_00940 CDS open 23703-24962 _na     419_aa TRZ/ATZ family protein
369 NCUG01000013.1 GCA002096275_00941 CDS open 25062-26810 _na     582_aa mdlB ABC transporter ATP-binding protein/permease
370 NCUG01000013.1 GCA002096275_00942 CDS open 26812-28536 _na     574_aa mdlB Putative multidrug resistance ABC transporter ATP-binding/permease protein YheI
371 NCUG01000013.1 GCA002096275_00943 CDS open 28701-29639 _na     312_aa msrAB1 Peptide methionine sulfoxide reductase MsrA/MsrB 1
372 NCUG01000013.1 GCA002096275_00944 CDS open 29934-30803 _na     289_aa thrB homoserine kinase
373 NCUG01000013.1 GCA002096275_00945 CDS open 30805-32091 _na     428_aa thrA Homoserine dehydrogenase
374 NCUG01000013.1 GCA002096275_00946 CDS open 32239-32979 _na     246_aa mecA adaptor protein MecA
375 NCUG01000013.1 GCA002096275_00947 CDS open 33165-35858 _na     897_aa MBL fold metallo-hydrolase
376 NCUG01000013.1 GCA002096275_00948 CDS open 35995-36810 _na     271_aa LICD family protein
377 NCUG01000013.1 GCA002096275_00949 CDS open 36811-37614 _na     267_aa LICD family protein
378 NCUG01000013.1 GCA002096275_00950 CDS open 37627-39111 _na     494_aa Polysaccharide biosynthesis protein
379 NCUG01000013.1 GCA002096275_00951 CDS open 39339-40376 _na     345_aa Prephenate dehydratase
380 NCUG01000013.1 GCA002096275_00952 CDS open 40380-41837 _na     485_aa O-antigen polysaccharide polymerase Wzy
381 NCUG01000013.1 GCA002096275_00953 CDS open 41853-42839 _na     328_aa epsJ Putative glycosyltransferase EpsJ
382 NCUG01000013.1 GCA002096275_00954 CDS open 42841-43944 _na     367_aa rfaB N-acetylgalactosamine-N%2C N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase
383 NCUG01000013.1 GCA002096275_00955 CDS open 43934-44770 _na     278_aa licD LicD/FKTN/FKRP nucleotidyltransferase domain-containing protein
384 NCUG01000013.1 GCA002096275_00956 CDS open 44916-46211 _na     431_aa msrR Regulatory protein MsrR
385 NCUG01000013.1 GCA002096275_00957 CDS open 46208-47056 _na     282_aa pheA prephenate dehydratase
386 NCUG01000013.1 GCA002096275_00958 CDS open 47053-47529 _na     158_aa aroK Shikimate kinase
387 NCUG01000013.1 GCA002096275_00959 CDS open 47522-48805 _na     427_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
388 NCUG01000013.1 GCA002096275_00960 CDS open 48895-49233 _na     112_aa YlbF/YmcA family competence regulator
389 NCUG01000013.1 GCA002096275_00961 CDS open 49244-50347 _na     367_aa tyrA prephenate dehydrogenase
390 NCUG01000013.1 GCA002096275_00962 CDS open 50357-51523 _na     388_aa aroC chorismate synthase
391 NCUG01000013.1 GCA002096275_00963 CDS open 51533-52600 _na     355_aa aroB 3-dehydroquinate synthase
392 NCUG01000013.1 GCA002096275_00964 CDS open 52618-53472 _na     284_aa aroE shikimate dehydrogenase
393 NCUG01000013.1 GCA002096275_00965 CDS open 53462-54139 _na     225_aa 3-dehydroquinate dehydratase
394 NCUG01000013.1 GCA002096275_00966 CDS open 54136-55299 _na     387_aa 23S rRNA methyltransferase
395 NCUG01000013.1 GCA002096275_00967 CDS open 55570-57018 _na     482_aa amyA alpha-amylase
396 NCUG01000013.1 GCA002096275_00968 CDS open 57106-59724 _na     872_aa alaS alanine--tRNA ligase
397 NCUG01000013.1 GCA002096275_00969 CDS open 59745-60230 _na     161_aa UDP-N-acetylenolpyruvoylglucosamine reductase
398 NCUG01000013.1 GCA002096275_00970 CDS open 60473-60838 _na     121_aa DUF3021 domain-containing protein
399 NCUG01000013.1 GCA002096275_00971 CDS open 61025-62095 _na     356_aa potD Putrescine-binding periplasmic protein
400 NCUG01000013.1 GCA002096275_00972 CDS open 62092-62865 _na     257_aa potC ABC transmembrane type-1 domain-containing protein
401 NCUG01000013.1 GCA002096275_00973 CDS open 62862-63668 _na     268_aa potB Spermidine/putrescine ABC transporter permease
402 NCUG01000013.1 GCA002096275_00974 CDS open 63649-64806 _na     385_aa potA Spermidine/putrescine import ATP-binding protein PotA
403 NCUG01000013.1 GCA002096275_00975 CDS open 64965-65870 _na     301_aa murB UDP-N-acetylmuramate dehydrogenase
404 NCUG01000013.1 GCA002096275_00976 CDS open 65981-66736 _na     251_aa Membrane peptidase
405 NCUG01000013.1 GCA002096275_00977 CDS open 66746-67477 _na     243_aa budA acetolactate decarboxylase
406 NCUG01000013.1 GCA002096275_00978 CDS open 67623-68894 _na     423_aa gntR Transcriptional regulator%2C GntR family
407 NCUG01000013.1 GCA002096275_00979 CDS open 68914-69729 _na     271_aa Solute-binding protein family 3/N-terminal domain-containing protein
408 NCUG01000013.1 GCA002096275_00980 CDS open 69887-70540 _na     217_aa phoU phosphate signaling complex protein PhoU
409 NCUG01000013.1 GCA002096275_00981 CDS open 70552-71310 _na     252_aa pstB phosphate ABC transporter ATP-binding protein PstB
410 NCUG01000013.1 GCA002096275_00982 CDS open 71323-72126 _na     267_aa pstB phosphate ABC transporter ATP-binding protein PstB
411 NCUG01000013.1 GCA002096275_00983 CDS open 72137-73021 _na     294_aa pstA phosphate ABC transporter permease PstA
412 NCUG01000013.1 GCA002096275_00984 CDS open 73011-73928 _na     305_aa pstC phosphate ABC transporter permease subunit PstC
413 NCUG01000013.1 GCA002096275_00985 CDS open 73928-74806 _na     292_aa Phosphate-binding protein
414 NCUG01000013.1 GCA002096275_00986 CDS open 75015-76319 _na     434_aa Ribosomal RNA small subunit methyltransferase F
415 NCUG01000013.1 GCA002096275_00987 CDS open 76320-77093 _na     257_aa Inositol monophosphatase family protein
416 NCUG01000013.1 GCA002096275_00988 CDS open 77083-77361 _na     92_aa yktA UPF0223 protein SPH_1535
417 NCUG01000013.1 GCA002096275_00989 CDS open 77362-77763 _na     133_aa spx Global transcriptional regulator Spx
418 NCUG01000013.1 GCA002096275_00990 CDS open 77984-78601 _na     205_aa TIGR01906 family membrane protein
419 NCUG01000013.1 GCA002096275_00991 CDS open 78591-79364 _na     257_aa nagD Acid sugar phosphatase
420 NCUG01000013.1 GCA002096275_00992 CDS open 79375-80112 _na     245_aa Acyl-ACP thioesterase%2C putative
421 NCUG01000013.1 GCA002096275_00993 CDS open 80117-81247 _na     376_aa hemW radical SAM family heme chaperone HemW
422 NCUG01000013.1 GCA002096275_00994 CDS open 81320-81718 _na     132_aa Late embryogeneis abundant protein
423 NCUG01000013.1 GCA002096275_00995 CDS open 81734-82117 _na     127_aa Methyl-accepting chemotaxis family domain protein
424 NCUG01000013.1 GCA002096275_00996 CDS open 82118-82906 _na     262_aa lgt prolipoprotein diacylglyceryl transferase
425 NCUG01000013.1 GCA002096275_00997 CDS open 82899-83834 _na     311_aa hprK HPr(Ser) kinase/phosphatase
426 NCUG01000013.1 GCA002096275_00998 CDS open 83966-84142 _na     58_aa rpsU 30S ribosomal protein S21
427 NCUG01000013.1 GCA002096275_00999 CDS open 84236-84793 _na     185_aa O-antigen polymerase
428 NCUG01000013.1 GCA002096275_01000 CDS open 84911-85531 _na     206_aa Alpha-aspartyl dipeptidase Peptidase E
429 NCUG01000013.1 GCA002096275_01001 CDS open 85545-86162 _na     205_aa ycgJ Putative methyltransferase YcgJ
430 NCUG01000013.1 GCA002096275_01002 CDS open 86265-86972 _na     235_aa nagB Glucosamine-6-phosphate deaminase
431 NCUG01000013.1 GCA002096275_01003 CDS open 87122-88150 _na     342_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
432 NCUG01000013.1 GCA002096275_01004 CDS open 88220-89080 _na     286_aa yihY YihY family protein
433 NCUG01000013.1 GCA002096275_01005 CDS open 89110-91164 _na     684_aa Sodium/hydrogen exchanger family protein
434 NCUG01000013.1 GCA002096275_01006 CDS open 91176-91430 _na     84_aa Phage protein
435 NCUG01000013.1 GCA002096275_01007 CDS open 91423-91980 _na     185_aa 16S rRNA (Cytosine(1402)-N(4))-methyltransferase
436 NCUG01000013.1 GCA002096275_01008 CDS open 91964-92920 _na     318_aa TIGR01212 family radical SAM protein
437 NCUG01000013.1 GCA002096275_01009 CDS open 93505-94233 _na     242_aa hypothetical protein
438 NCUG01000013.1 GCA002096275_00912 gene open 2642-3199 acrR
439 NCUG01000013.1 GCA002096275_00913 gene open 3233-3451
440 NCUG01000013.1 GCA002096275_00914 gene open 3549-3869
441 NCUG01000013.1 GCA002096275_00915 gene open 3897-4235
442 NCUG01000013.1 GCA002096275_00916 gene open 4247-4966 trmD
443 NCUG01000013.1 GCA002096275_00917 gene open 4956-5474 rimM
444 NCUG01000013.1 GCA002096275_00918 gene open 5505-6293
445 NCUG01000013.1 GCA002096275_00919 gene open 6396-6725
446 NCUG01000013.1 GCA002096275_00920 gene open 6769-7008 khpA
447 NCUG01000013.1 GCA002096275_00921 gene open 7028-7300 rpsP
448 NCUG01000013.1 GCA002096275_00922 gene open 7536-8279
449 NCUG01000013.1 GCA002096275_00923 gene open 8293-9105
450 NCUG01000013.1 GCA002096275_00924 gene open 9178-9981 ppiB
451 NCUG01000013.1 GCA002096275_00925 gene open 10037-11578 abc-f
452 NCUG01000013.1 GCA002096275_00926 gene open 11578-12063
453 NCUG01000013.1 GCA002096275_00927 gene open 12065-13150 rlmN
454 NCUG01000013.1 GCA002096275_00928 gene open 13171-13701
455 NCUG01000013.1 GCA002096275_00929 gene open 13857-14462 sodA
456 NCUG01000013.1 GCA002096275_00930 gene open 14535-15569 holA
457 NCUG01000013.1 GCA002096275_00931 gene open 15602-16537 pyrDA
458 NCUG01000013.1 GCA002096275_00932 gene open 16769-18115 gdhA
459 NCUG01000013.1 GCA002096275_00933 gene open 18212-18856
460 NCUG01000013.1 GCA002096275_00934 gene open 18873-19877
461 NCUG01000013.1 GCA002096275_00935 gene open 20091-20459
462 NCUG01000013.1 GCA002096275_00936 gene open 20522-21424
463 NCUG01000013.1 GCA002096275_00937 gene open 21587-22153
464 NCUG01000013.1 GCA002096275_00938 gene open 22525-22893 rplL
465 NCUG01000013.1 GCA002096275_00939 gene open 22966-23466 rplJ
466 NCUG01000013.1 GCA002096275_00940 gene open 23703-24962
467 NCUG01000013.1 GCA002096275_00941 gene open 25062-26810 mdlB
468 NCUG01000013.1 GCA002096275_00942 gene open 26812-28536 mdlB
469 NCUG01000013.1 GCA002096275_00943 gene open 28701-29639 msrAB1
470 NCUG01000013.1 GCA002096275_00944 gene open 29934-30803 thrB
471 NCUG01000013.1 GCA002096275_00945 gene open 30805-32091 thrA
472 NCUG01000013.1 GCA002096275_00946 gene open 32239-32979 mecA
473 NCUG01000013.1 GCA002096275_00947 gene open 33165-35858
474 NCUG01000013.1 GCA002096275_00948 gene open 35995-36810
475 NCUG01000013.1 GCA002096275_00949 gene open 36811-37614
476 NCUG01000013.1 GCA002096275_00950 gene open 37627-39111
477 NCUG01000013.1 GCA002096275_00951 gene open 39339-40376
478 NCUG01000013.1 GCA002096275_00952 gene open 40380-41837
479 NCUG01000013.1 GCA002096275_00953 gene open 41853-42839 epsJ
480 NCUG01000013.1 GCA002096275_00954 gene open 42841-43944 rfaB
481 NCUG01000013.1 GCA002096275_00955 gene open 43934-44770 licD
482 NCUG01000013.1 GCA002096275_00956 gene open 44916-46211 msrR
483 NCUG01000013.1 GCA002096275_00957 gene open 46208-47056 pheA
484 NCUG01000013.1 GCA002096275_00958 gene open 47053-47529 aroK
485 NCUG01000013.1 GCA002096275_00959 gene open 47522-48805 aroA
486 NCUG01000013.1 GCA002096275_00960 gene open 48895-49233
487 NCUG01000013.1 GCA002096275_00961 gene open 49244-50347 tyrA
488 NCUG01000013.1 GCA002096275_00962 gene open 50357-51523 aroC
489 NCUG01000013.1 GCA002096275_00963 gene open 51533-52600 aroB
490 NCUG01000013.1 GCA002096275_00964 gene open 52618-53472 aroE
491 NCUG01000013.1 GCA002096275_00965 gene open 53462-54139
492 NCUG01000013.1 GCA002096275_00966 gene open 54136-55299
493 NCUG01000013.1 GCA002096275_00967 gene open 55570-57018 amyA
494 NCUG01000013.1 GCA002096275_00968 gene open 57106-59724 alaS
495 NCUG01000013.1 GCA002096275_00969 gene open 59745-60230
496 NCUG01000013.1 GCA002096275_00970 gene open 60473-60838
497 NCUG01000013.1 GCA002096275_00971 gene open 61025-62095 potD
498 NCUG01000013.1 GCA002096275_00972 gene open 62092-62865 potC
499 NCUG01000013.1 GCA002096275_00973 gene open 62862-63668 potB
500 NCUG01000013.1 GCA002096275_00974 gene open 63649-64806 potA