HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium animalis (GCA_002762015.1)

Select a Genome:
BAKTA Annotations for GCA_002762015.1
Genome Selected: Fusobacterium animalis
ContigsBases CDSrRNA tmRNAtRNA
150 2346246 2216 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4553 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4553 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 NPNC01000116.1 GCA002762015_00083 gene open 93-1611 rrs
4502 NPNC01000116.1 GCA002762015_00083 rRNA open 93-1611 rrs 16S ribosomal RNA
4503 NPNC01000118.1 GCA002762015_00084 CDS open 121-1290 _na     389_aa IS110 family transposase
4504 NPNC01000118.1 GCA002762015_00084 gene open 121-1290
4505 NPNC01000119.1 GCA002762015_00085 CDS open 20-112 _na     30_aa hypothetical protein
4506 NPNC01000119.1 GCA002762015_00086 CDS open 248-610 _na     120_aa hypothetical protein
4507 NPNC01000119.1 GCA002762015_00085 gene open 20-112
4508 NPNC01000119.1 GCA002762015_00086 gene open 248-610
4509 NPNC01000120.1 GCA002762015_00132 CDS open 111-467 _na     118_aa tnpB RNA-guided endonuclease TnpB family protein
4510 NPNC01000120.1 GCA002762015_00133 CDS open 629-1240 _na     203_aa N-terminal cleavage protein
4511 NPNC01000120.1 GCA002762015_00132 gene open 111-467 tnpB
4512 NPNC01000120.1 GCA002762015_00133 gene open 629-1240
4513 NPNC01000121.1 GCA002762015_00134 CDS open 147-911 _na     254_aa hypothetical protein
4514 NPNC01000121.1 GCA002762015_00134 gene open 147-911
4515 NPNC01000122.1 GCA002762015_00135 CDS open 43-1176 _na     377_aa hypothetical protein
4516 NPNC01000122.1 GCA002762015_00135 gene open 43-1176
4517 NPNC01000126.1 GCA002762015_00136 CDS open 16-216 _na     66_aa hypothetical protein
4518 NPNC01000126.1 GCA002762015_00137 CDS open 228-839 _na     203_aa ShlB/FhaC/HecB family hemolysin secretion/activation protein
4519 NPNC01000126.1 GCA002762015_00136 gene open 16-216
4520 NPNC01000126.1 GCA002762015_00137 gene open 228-839
4521 NPNC01000128.1 repeat_region open 20-876 CRISPR array with 12 repeats of length 36%2C consensus sequence GTTTCCGTCTCCTCTCGGAGTTATATTCTCTCTTAT and spacer length 38
4522 NPNC01000129.1 GCA002762015_00138 CDS open 73-579 _na     168_aa hypothetical protein
4523 NPNC01000129.1 GCA002762015_00138 gene open 73-579
4524 NPNC01000130.1 GCA002762015_00183 gene open 4-79 trnV
4525 NPNC01000130.1 GCA002762015_00184 gene open 90-167 trnD
4526 NPNC01000130.1 GCA002762015_00185 gene open 184-259 trnF
4527 NPNC01000130.1 GCA002762015_00186 gene open 274-347 trnC
4528 NPNC01000130.1 GCA002762015_00187 gene open 400-475 trnG
4529 NPNC01000130.1 GCA002762015_00188 gene open 485-560 trnK
4530 NPNC01000130.1 GCA002762015_00189 gene open 568-642 trnE
4531 NPNC01000130.1 GCA002762015_00190 gene open 647-722 trnV
4532 NPNC01000130.1 GCA002762015_00191 gene open 733-810 trnD
4533 NPNC01000130.1 GCA002762015_00183 tRNA open 4-79 trnV tRNA-Val(tac)
4534 NPNC01000130.1 GCA002762015_00184 tRNA open 90-167 trnD tRNA-Asp(gtc)
4535 NPNC01000130.1 GCA002762015_00185 tRNA open 184-259 trnF tRNA-Phe(gaa)
4536 NPNC01000130.1 GCA002762015_00186 tRNA open 274-347 trnC tRNA-Cys(gca)
4537 NPNC01000130.1 GCA002762015_00187 tRNA open 400-475 trnG tRNA-Gly(tcc)
4538 NPNC01000130.1 GCA002762015_00188 tRNA open 485-560 trnK tRNA-Lys(ctt)
4539 NPNC01000130.1 GCA002762015_00189 tRNA open 568-642 trnE tRNA-Glu(ttc)
4540 NPNC01000130.1 GCA002762015_00190 tRNA open 647-722 trnV tRNA-Val(tac)
4541 NPNC01000130.1 GCA002762015_00191 tRNA open 733-810 trnD tRNA-Asp(gtc)
4542 NPNC01000132.1 GCA002762015_00192 gene open 3-119 rrf
4543 NPNC01000132.1 GCA002762015_00192 rRNA open 3-119 rrf 5S ribosomal RNA
4544 NPNC01000133.1 GCA002762015_00193 CDS open 142-792 _na     216_aa tnpB RNA-guided endonuclease TnpB family protein
4545 NPNC01000133.1 GCA002762015_00193 gene open 142-792 tnpB
4546 NPNC01000137.1 GCA002762015_00194 CDS open 73-459 _na     128_aa hypothetical protein
4547 NPNC01000137.1 GCA002762015_00194 gene open 73-459
4548 NPNC01000145.1 GCA002762015_00236 CDS open 61-549 _na     162_aa Transposase
4549 NPNC01000145.1 GCA002762015_00236 gene open 61-549
4550 NPNC01000146.1 GCA002762015_00237 CDS open 229-489 _na     86_aa POTRA domain protein%2C ShlB-type
4551 NPNC01000146.1 GCA002762015_00237 gene open 229-489
4552 NPNC01000150.1 GCA002762015_00278 CDS open 40-486 _na     148_aa Pyruvate ferredoxin/flavodoxin oxidoreductase family protein
4553 NPNC01000150.1 GCA002762015_00278 gene open 40-486