HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium aurimucosum clade-445 (GCA_002861385.2)

Select a Genome:
BAKTA Annotations for GCA_002861385.2
Genome Selected: Corynebacterium aurimucosum clade-445
ContigsBases CDSrRNA tmRNAtRNA
22 2645301 2442 4 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5009 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 5009 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 PKHR02000011.1 GCA002861385_00635 gene open 431239-431829
1502 PKHR02000011.1 GCA002861385_00636 gene open 431910-433580 ettA
1503 PKHR02000011.1 GCA002861385_00637 gene open 433629-434087
1504 PKHR02000011.1 GCA002861385_00638 gene open 434103-434762
1505 PKHR02000011.1 GCA002861385_00639 gene open 434916-435998 ald
1506 PKHR02000011.1 GCA002861385_00640 gene open 435995-436384
1507 PKHR02000011.1 GCA002861385_00641 gene open 436387-437388 mscS
1508 PKHR02000011.1 GCA002861385_00642 gene open 437429-438664
1509 PKHR02000011.1 GCA002861385_00643 gene open 438694-439905
1510 PKHR02000011.1 GCA002861385_00644 gene open 439944-441824
1511 PKHR02000011.1 GCA002861385_00645 gene open 441881-443584
1512 PKHR02000011.1 GCA002861385_00646 gene open 443585-444595
1513 PKHR02000011.1 GCA002861385_00647 gene open 444592-445446
1514 PKHR02000011.1 GCA002861385_00648 gene open 445448-447115 nikD
1515 PKHR02000011.1 GCA002861385_00649 gene open 447145-448332
1516 PKHR02000011.1 GCA002861385_00650 gene open 448351-449025
1517 PKHR02000011.1 GCA002861385_00651 gene open 449082-449828
1518 PKHR02000011.1 GCA002861385_00652 gene open 450094-451299
1519 PKHR02000011.1 GCA002861385_00653 gene open 451373-453913 pepN
1520 PKHR02000011.1 GCA002861385_00654 gene open 454015-454629 dsbA
1521 PKHR02000011.1 GCA002861385_00655 gene open 454626-455003
1522 PKHR02000011.1 GCA002861385_00656 gene open 455107-455580
1523 PKHR02000011.1 GCA002861385_00657 gene open 455577-456404
1524 PKHR02000011.1 GCA002861385_00659 gene open 456787-457605
1525 PKHR02000011.1 GCA002861385_00661 gene open 457891-459246 tig
1526 PKHR02000011.1 GCA002861385_00662 gene open 459420-460001
1527 PKHR02000011.1 GCA002861385_00663 gene open 460041-460346
1528 PKHR02000011.1 GCA002861385_00664 gene open 460297-461322 nrdF
1529 PKHR02000011.1 GCA002861385_00665 gene open 461374-463569 nrdE
1530 PKHR02000011.1 GCA002861385_00666 gene open 463620-464057 nrdI
1531 PKHR02000011.1 GCA002861385_00667 gene open 464203-464883
1532 PKHR02000011.1 GCA002861385_00668 gene open 465022-465621
1533 PKHR02000011.1 GCA002861385_00669 gene open 465643-466266
1534 PKHR02000011.1 GCA002861385_00670 gene open 466320-467090 fabG
1535 PKHR02000011.1 GCA002861385_00671 gene open 467132-468436
1536 PKHR02000011.1 GCA002861385_00672 gene open 468635-469930 clpX
1537 PKHR02000011.1 GCA002861385_00673 gene open 470170-470913
1538 PKHR02000011.1 GCA002861385_00674 gene open 471089-472051
1539 PKHR02000011.1 GCA002861385_00675 gene open 472048-472869 panC
1540 PKHR02000011.1 GCA002861385_00676 gene open 472881-473702 panB
1541 PKHR02000011.1 GCA002861385_00677 gene open 473760-476498
1542 PKHR02000011.1 GCA002861385_00678 gene open 476498-478027 folC
1543 PKHR02000011.1 GCA002861385_00679 gene open 478024-478470
1544 PKHR02000011.1 GCA002861385_00680 gene open 478480-479364
1545 PKHR02000011.1 GCA002861385_00681 gene open 479370-479681
1546 PKHR02000011.1 GCA002861385_00682 gene open 479732-480151 ndk
1547 PKHR02000011.1 GCA002861385_00683 gene open 480289-480711 arsR
1548 PKHR02000011.1 GCA002861385_00684 gene open 480753-481817 arsB
1549 PKHR02000011.1 GCA002861385_00685 gene open 481814-482617
1550 PKHR02000011.1 GCA002861385_00686 gene open 482774-485926
1551 PKHR02000011.1 GCA002861385_00687 gene open 486128-486433 rplU
1552 PKHR02000011.1 GCA002861385_00688 gene open 486477-486755 rpmA
1553 PKHR02000011.1 GCA002861385_00689 gene open 486884-488440 obgE
1554 PKHR02000011.1 GCA002861385_00690 gene open 488460-489692
1555 PKHR02000011.1 GCA002861385_00691 gene open 489692-490621
1556 PKHR02000011.1 GCA002861385_00692 gene open 490637-491542
1557 PKHR02000011.1 GCA002861385_00693 gene open 491542-492048
1558 PKHR02000011.1 GCA002861385_00694 gene open 492123-493391
1559 PKHR02000011.1 GCA002861385_00695 gene open 493471-494376
1560 PKHR02000011.1 GCA002861385_00696 gene open 494387-495244
1561 PKHR02000011.1 GCA002861385_00697 gene open 495237-495854 nadD
1562 PKHR02000011.1 GCA002861385_00698 gene open 495962-496429 rsfS
1563 PKHR02000011.1 GCA002861385_00699 gene open 496426-497124
1564 PKHR02000011.1 GCA002861385_00700 gene open 497124-497912 degV
1565 PKHR02000011.1 GCA002861385_00701 gene open 497990-498619
1566 PKHR02000011.1 GCA002861385_00702 gene open 498616-499866
1567 PKHR02000011.1 GCA002861385_00703 gene open 499863-500810 holA
1568 PKHR02000011.1 GCA002861385_00704 gene open 500822-501190
1569 PKHR02000011.1 GCA002861385_00705 gene open 501187-501828
1570 PKHR02000011.1 GCA002861385_00706 gene open 501825-503003
1571 PKHR02000011.1 GCA002861385_00707 gene open 502996-503805
1572 PKHR02000011.1 GCA002861385_00708 gene open 503806-504069 rpsT
1573 PKHR02000011.1 GCA002861385_00709 gene open 504188-504709
1574 PKHR02000011.1 GCA002861385_00710 gene open 504728-506575 lepA
1575 PKHR02000011.1 GCA002861385_00711 gene open 506701-506910
1576 PKHR02000011.1 GCA002861385_00712 gene open 507172-508506
1577 PKHR02000011.1 GCA002861385_00713 gene open 508595-509962
1578 PKHR02000011.1 GCA002861385_00714 gene open 509898-510668 prsW
1579 PKHR02000011.1 GCA002861385_00715 gene open 510665-511087
1580 PKHR02000011.1 GCA002861385_00716 gene open 511084-511992 prsW
1581 PKHR02000011.1 GCA002861385_00717 gene open 511994-513130
1582 PKHR02000011.1 GCA002861385_00718 gene open 513130-513777
1583 PKHR02000011.1 GCA002861385_00719 gene open 513774-514154
1584 PKHR02000011.1 GCA002861385_00720 gene open 514155-514946
1585 PKHR02000011.1 GCA002861385_00721 gene open 514940-516016
1586 PKHR02000011.1 GCA002861385_00722 gene open 516090-516203
1587 PKHR02000011.1 GCA002861385_00723 gene open 516257-517894
1588 PKHR02000011.1 GCA002861385_00724 gene open 517866-519086
1589 PKHR02000011.1 GCA002861385_00725 gene open 519070-519828
1590 PKHR02000011.1 GCA002861385_00726 gene open 519825-520730
1591 PKHR02000011.1 GCA002861385_00727 gene open 520727-522145
1592 PKHR02000011.1 GCA002861385_00728 gene open 522142-522897
1593 PKHR02000011.1 GCA002861385_00729 gene open 522975-523955
1594 PKHR02000011.1 GCA002861385_00730 gene open 523959-525320 brnQ
1595 PKHR02000011.1 GCA002861385_00731 gene open 525338-526435
1596 PKHR02000011.1 GCA002861385_00732 gene open 526446-528278
1597 PKHR02000011.1 GCA002861385_00733 gene open 528369-528905
1598 PKHR02000011.1 GCA002861385_00734 gene open 528902-529426 idi
1599 PKHR02000011.1 GCA002861385_00735 gene open 529437-530708
1600 PKHR02000011.1 GCA002861385_00736 gene open 530732-530890
1601 PKHR02000011.1 GCA002861385_00737 gene open 530883-531038
1602 PKHR02000011.1 GCA002861385_00738 gene open 531035-533089 malQ
1603 PKHR02000011.1 GCA002861385_00739 gene open 533093-535069
1604 PKHR02000011.1 GCA002861385_00740 gene open 535195-535875
1605 PKHR02000011.1 GCA002861385_00741 gene open 536035-537102
1606 PKHR02000011.1 GCA002861385_00742 gene open 537102-538475
1607 PKHR02000011.1 GCA002861385_00743 gene open 538620-539768 hemW
1608 PKHR02000011.1 GCA002861385_00744 gene open 540420-541454 hrcA
1609 PKHR02000011.1 GCA002861385_00745 gene open 541509-542651 dnaJ
1610 PKHR02000011.1 GCA002861385_00746 gene open 542651-543391
1611 PKHR02000011.1 GCA002861385_00747 gene open 543402-544367
1612 PKHR02000011.1 GCA002861385_00748 gene open 544364-544939 ybeY
1613 PKHR02000011.1 GCA002861385_00749 gene open 544990-545838 pdxY
1614 PKHR02000011.1 GCA002861385_00750 gene open 546368-547363 era
1615 PKHR02000011.1 GCA002861385_00751 gene open 547364-548080 recO
1616 PKHR02000011.1 GCA002861385_00752 gene open 548091-548843
1617 PKHR02000011.1 GCA002861385_00753 gene open 548852-549271
1618 PKHR02000011.1 GCA002861385_00754 gene open 549300-549599
1619 PKHR02000011.1 GCA002861385_00755 gene open 549790-551169
1620 PKHR02000011.1 GCA002861385_00756 gene open 551169-551687
1621 PKHR02000011.1 GCA002861385_00757 gene open 551687-552106
1622 PKHR02000011.1 GCA002861385_00758 gene open 552985-555024 parA
1623 PKHR02000011.1 GCA002861385_00759 gene open 555069-555653
1624 PKHR02000011.1 GCA002861385_00760 gene open 555665-556939
1625 PKHR02000011.1 GCA002861385_00761 gene open 557189-560491
1626 PKHR02000011.1 GCA002861385_00762 gene open 560531-560764
1627 PKHR02000011.1 GCA002861385_00763 gene open 560768-561307
1628 PKHR02000011.1 GCA002861385_00764 gene open 561453-563381
1629 PKHR02000011.1 GCA002861385_00765 gene open 563431-563706 ytxH
1630 PKHR02000011.1 GCA002861385_00766 gene open 564148-565305 wecB
1631 PKHR02000011.1 GCA002861385_00767 gene open 565912-567120
1632 PKHR02000011.1 GCA002861385_00768 gene open 567435-567587
1633 PKHR02000011.1 GCA002861385_00769 gene open 568524-569558
1634 PKHR02000011.1 GCA002861385_00771 gene open 570112-571512
1635 PKHR02000011.1 GCA002861385_00772 gene open 571522-572409
1636 PKHR02000011.1 GCA002861385_00773 gene open 572583-573848 wecC
1637 PKHR02000011.1 GCA002861385_00774 gene open 573860-575224
1638 PKHR02000011.1 GCA002861385_00775 gene open 575242-575826
1639 PKHR02000011.1 GCA002861385_00776 gene open 575823-577901
1640 PKHR02000011.1 GCA002861385_00777 gene open 577985-578920
1641 PKHR02000011.1 GCA002861385_00778 gene open 578975-579847
1642 PKHR02000011.1 GCA002861385_00779 gene open 579948-580862
1643 PKHR02000011.1 GCA002861385_00780 gene open 580859-583051
1644 PKHR02000011.1 GCA002861385_00781 gene open 583186-585687
1645 PKHR02000011.1 GCA002861385_00782 gene open 585701-587653
1646 PKHR02000011.1 GCA002861385_00783 gene open 588278-589183
1647 PKHR02000011.1 GCA002861385_00784 gene open 589505-590383
1648 PKHR02000011.1 GCA002861385_00785 gene open 590393-590896
1649 PKHR02000011.1 GCA002861385_00786 gene open 591130-592011
1650 PKHR02000011.1 GCA002861385_00787 gene open 592265-595267 trlF
1651 PKHR02000011.1 GCA002861385_00788 gene open 595577-596722 jetD
1652 PKHR02000011.1 GCA002861385_00789 gene open 596709-600098
1653 PKHR02000011.1 GCA002861385_00790 gene open 600091-600771
1654 PKHR02000011.1 GCA002861385_00791 gene open 600768-602240
1655 PKHR02000011.1 GCA002861385_00792 gene open 602377-602610
1656 PKHR02000011.1 GCA002861385_00793 gene open 602699-604963
1657 PKHR02000011.1 GCA002861385_00794 gene open 605479-605568
1658 PKHR02000011.1 GCA002861385_00795 gene open 606283-607617
1659 PKHR02000011.1 GCA002861385_00796 gene open 607770-608195
1660 PKHR02000011.1 GCA002861385_00798 gene open 608591-609040
1661 PKHR02000011.1 GCA002861385_00799 gene open 609208-609471
1662 PKHR02000011.1 GCA002861385_00800 gene open 609563-610645
1663 PKHR02000011.1 GCA002861385_00801 gene open 610711-611382
1664 PKHR02000011.1 GCA002861385_00802 gene open 611396-612280
1665 PKHR02000011.1 GCA002861385_00803 gene open 612324-613904 mscS
1666 PKHR02000011.1 GCA002861385_00804 gene open 614161-614781
1667 PKHR02000011.1 GCA002861385_00805 gene open 614792-615595
1668 PKHR02000011.1 GCA002861385_00806 gene open 615995-616429
1669 PKHR02000011.1 GCA002861385_00807 gene open 616433-617212
1670 PKHR02000011.1 GCA002861385_00808 gene open 617209-617511
1671 PKHR02000011.1 GCA002861385_00809 gene open 617538-618551
1672 PKHR02000011.1 GCA002861385_00810 gene open 618733-621489 aceE
1673 PKHR02000011.1 GCA002861385_00811 gene open 621699-622100
1674 PKHR02000011.1 GCA002861385_00813 gene open 622612-622875
1675 PKHR02000011.1 GCA002861385_00814 gene open 623457-624446
1676 PKHR02000011.1 GCA002861385_00815 gene open 624478-624969
1677 PKHR02000011.1 GCA002861385_00816 gene open 625072-625920
1678 PKHR02000011.1 GCA002861385_00817 gene open 625921-626637
1679 PKHR02000011.1 GCA002861385_00818 gene open 626634-627815
1680 PKHR02000011.1 GCA002861385_00820 gene open 628301-629704
1681 PKHR02000011.1 GCA002861385_00821 gene open 629701-630972
1682 PKHR02000011.1 GCA002861385_00822 gene open 631119-631307
1683 PKHR02000011.1 GCA002861385_00823 gene open 631443-633224
1684 PKHR02000011.1 GCA002861385_00824 gene open 633278-634354
1685 PKHR02000011.1 GCA002861385_00825 gene open 634554-635891 glnA
1686 PKHR02000011.1 GCA002861385_00826 gene open 635899-638958
1687 PKHR02000011.1 GCA002861385_00827 gene open 639135-639452
1688 PKHR02000011.1 GCA002861385_00828 gene open 639487-639918
1689 PKHR02000011.1 GCA002861385_00829 gene open 640082-640213
1690 PKHR02000011.1 GCA002861385_00830 gene open 640229-641482
1691 PKHR02000011.1 GCA002861385_00831 gene open 641560-643014 thrC
1692 PKHR02000011.1 GCA002861385_00832 gene open 643019-643171
1693 PKHR02000011.1 GCA002861385_00833 gene open 643227-644012
1694 PKHR02000011.1 GCA002861385_00834 gene open 644030-644560 mutT
1695 PKHR02000011.1 GCA002861385_00835 gene open 644655-645269
1696 PKHR02000011.1 GCA002861385_00836 gene open 645305-646288
1697 PKHR02000011.1 GCA002861385_00837 gene open 646413-646877
1698 PKHR02000011.1 GCA002861385_00838 gene open 646992-648845
1699 PKHR02000011.1 GCA002861385_00839 gene open 648856-649902
1700 PKHR02000011.1 GCA002861385_00840 gene open 649883-650926
1701 PKHR02000011.1 GCA002861385_00841 gene open 650926-651720
1702 PKHR02000011.1 GCA002861385_00842 gene open 651713-652651
1703 PKHR02000011.1 GCA002861385_00843 gene open 652819-653460
1704 PKHR02000011.1 GCA002861385_00844 gene open 653649-655082 glnA
1705 PKHR02000011.1 GCA002861385_00845 gene open 655211-655645
1706 PKHR02000011.1 GCA002861385_00846 gene open 655774-656559
1707 PKHR02000011.1 GCA002861385_00847 gene open 656602-657675 lipA
1708 PKHR02000011.1 GCA002861385_00848 gene open 657764-658591 lipB
1709 PKHR02000011.1 GCA002861385_00849 gene open 658662-659054 gcvH
1710 PKHR02000011.1 GCA002861385_00850 gene open 659097-660209 gcvT
1711 PKHR02000011.1 GCA002861385_00851 gene open 660213-663080 gcvP
1712 PKHR02000011.1 GCA002861385_00852 gene open 663153-664307
1713 PKHR02000011.1 GCA002861385_00853 gene open 664568-666613 sucB
1714 PKHR02000011.1 GCA002861385_00854 gene open 666762-667160
1715 PKHR02000011.1 GCA002861385_00855 gene open 667157-667699
1716 PKHR02000011.1 GCA002861385_00856 gene open 667728-669002
1717 PKHR02000011.1 GCA002861385_00857 gene open 669051-670550
1718 PKHR02000011.1 GCA002861385_00858 gene open 670706-671806
1719 PKHR02000011.1 GCA002861385_00859 gene open 671819-672733
1720 PKHR02000011.1 GCA002861385_00860 gene open 672746-673513
1721 PKHR02000011.1 GCA002861385_00861 gene open 673606-673950
1722 PKHR02000011.1 GCA002861385_00862 gene open 674084-676006 asnB
1723 PKHR02000011.1 GCA002861385_00863 gene open 676361-677440
1724 PKHR02000011.1 GCA002861385_00864 gene open 677460-677891
1725 PKHR02000011.1 GCA002861385_00865 gene open 678410-679057
1726 PKHR02000011.1 GCA002861385_00866 gene open 679128-680012
1727 PKHR02000011.1 GCA002861385_00867 gene open 680009-681229
1728 PKHR02000011.1 GCA002861385_00868 gene open 681229-682851
1729 PKHR02000011.1 GCA002861385_00869 gene open 683739-684368
1730 PKHR02000011.1 GCA002861385_00870 gene open 684526-685602
1731 PKHR02000011.1 GCA002861385_00871 gene open 685606-686769
1732 PKHR02000011.1 GCA002861385_00872 gene open 686726-687718
1733 PKHR02000011.1 GCA002861385_00873 gene open 687785-688531
1734 PKHR02000011.1 GCA002861385_00874 gene open 688535-689728
1735 PKHR02000011.1 GCA002861385_00875 gene open 689554-690816
1736 PKHR02000011.1 GCA002861385_00876 gene open 690877-691389
1737 PKHR02000011.1 GCA002861385_00877 gene open 691486-692844
1738 PKHR02000011.1 GCA002861385_00878 gene open 692857-694107
1739 PKHR02000011.1 GCA002861385_00879 gene open 694158-694556
1740 PKHR02000011.1 GCA002861385_00880 gene open 694525-696063
1741 PKHR02000011.1 GCA002861385_00881 gene open 696065-697156
1742 PKHR02000011.1 GCA002861385_00882 gene open 697200-697847
1743 PKHR02000011.1 GCA002861385_00883 gene open 698026-698469
1744 PKHR02000011.1 GCA002861385_00884 gene open 698622-699029
1745 PKHR02000011.1 GCA002861385_00885 gene open 699108-699674 tetR
1746 PKHR02000011.1 GCA002861385_00886 gene open 699710-700399
1747 PKHR02000011.1 GCA002861385_00887 gene open 700396-701544
1748 PKHR02000011.1 GCA002861385_00888 gene open 702069-702503 mraZ
1749 PKHR02000011.1 GCA002861385_00889 gene open 702678-703721 rsmH
1750 PKHR02000011.1 GCA002861385_00890 gene open 703718-704554 ftsL
1751 PKHR02000011.1 GCA002861385_00891 gene open 704703-706748
1752 PKHR02000011.1 GCA002861385_00892 gene open 706807-708360
1753 PKHR02000011.1 GCA002861385_00893 gene open 708357-709892
1754 PKHR02000011.1 GCA002861385_00894 gene open 710078-710848
1755 PKHR02000011.1 GCA002861385_00453 gene open 249486-249560 trnV
1756 PKHR02000011.1 GCA002861385_00454 gene open 249917-249992 trnG
1757 PKHR02000011.1 GCA002861385_00455 gene open 250048-250119 trnV
1758 PKHR02000011.1 GCA002861385_00456 gene open 250158-250233 trnG
1759 PKHR02000011.1 GCA002861385_00457 gene open 250265-250335 trnC
1760 PKHR02000011.1 GCA002861385_00458 gene open 250368-250439 trnV
1761 PKHR02000011.1 GCA002861385_00459 gene open 250483-250558 trnG
1762 PKHR02000011.1 GCA002861385_00518 gene open 308948-309021 trnL
1763 PKHR02000011.1 GCA002861385_00571 gene open 367695-367767 trnA
1764 PKHR02000011.1 GCA002861385_00595 gene open 389949-390030 trnL
1765 PKHR02000011.1 GCA002861385_00622 gene open 420179-420251 trnK
1766 PKHR02000011.1 GCA002861385_00626 gene open 423370-423442 trnH
1767 PKHR02000011.1 GCA002861385_00632 gene open 427839-427912 trnR
1768 PKHR02000011.1 GCA002861385_00658 gene open 456498-456572 trnG
1769 PKHR02000011.1 GCA002861385_00660 gene open 457744-457817 trnP
1770 PKHR02000011.1 GCA002861385_00770 gene open 569846-569918 trnN
1771 PKHR02000011.1 GCA002861385_00797 gene open 608385-608458 trnI
1772 PKHR02000011.1 GCA002861385_00812 gene open 622211-622283 trnV
1773 PKHR02000011.1 GCA002861385_00453 tRNA open 249486-249560 trnV tRNA-Val(cac)
1774 PKHR02000011.1 GCA002861385_00454 tRNA open 249917-249992 trnG tRNA-Gly(gcc)
1775 PKHR02000011.1 GCA002861385_00455 tRNA open 250048-250119 trnV tRNA-Val(gac)
1776 PKHR02000011.1 GCA002861385_00456 tRNA open 250158-250233 trnG tRNA-Gly(gcc)
1777 PKHR02000011.1 GCA002861385_00457 tRNA open 250265-250335 trnC tRNA-Cys(gca)
1778 PKHR02000011.1 GCA002861385_00458 tRNA open 250368-250439 trnV tRNA-Val(gac)
1779 PKHR02000011.1 GCA002861385_00459 tRNA open 250483-250558 trnG tRNA-Gly(gcc)
1780 PKHR02000011.1 GCA002861385_00518 tRNA open 308948-309021 trnL tRNA-Leu(caa)
1781 PKHR02000011.1 GCA002861385_00571 tRNA open 367695-367767 trnA tRNA-Ala(ggc)
1782 PKHR02000011.1 GCA002861385_00595 tRNA open 389949-390030 trnL tRNA-Leu(tag)
1783 PKHR02000011.1 GCA002861385_00622 tRNA open 420179-420251 trnK tRNA-Lys(ctt)
1784 PKHR02000011.1 GCA002861385_00626 tRNA open 423370-423442 trnH tRNA-His(gtg)
1785 PKHR02000011.1 GCA002861385_00632 tRNA open 427839-427912 trnR tRNA-Arg(tct)
1786 PKHR02000011.1 GCA002861385_00658 tRNA open 456498-456572 trnG tRNA-Gly(tcc)
1787 PKHR02000011.1 GCA002861385_00660 tRNA open 457744-457817 trnP tRNA-Pro(tgg)
1788 PKHR02000011.1 GCA002861385_00770 tRNA open 569846-569918 trnN tRNA-Asn(gtt)
1789 PKHR02000011.1 GCA002861385_00797 tRNA open 608385-608458 trnI tRNA-Ile2(cat)
1790 PKHR02000011.1 GCA002861385_00812 tRNA open 622211-622283 trnV tRNA-Val(tac)
1791 PKHR02000012.1 GCA002861385_00895 CDS open 1-1635 _na     544_aa istA IS21 family transposase
1792 PKHR02000012.1 GCA002861385_00896 CDS open 1642-2409 _na     255_aa Putative transposase
1793 PKHR02000012.1 GCA002861385_00895 gene open 1-1635 istA
1794 PKHR02000012.1 GCA002861385_00896 gene open 1642-2409
1795 PKHR02000013.1 GCA002861385_00897 CDS open 1-528 _na     175_aa CAAX protease
1796 PKHR02000013.1 GCA002861385_00898 CDS open 655-1398 _na     247_aa magnesium transporter
1797 PKHR02000013.1 GCA002861385_00897 gene open 1-528
1798 PKHR02000013.1 GCA002861385_00898 gene open 655-1398
1799 PKHR02000014.1 GCA002861385_00899 CDS open 1-900 _na     299_aa IS3 family transposase
1800 PKHR02000014.1 GCA002861385_00899 gene open 1-900
1801 PKHR02000015.1 regulatory_region open 171236-171306 Guanidine-III riboswitch aptamer (yKKC-III)
1802 PKHR02000015.1 repeat_region open 150508-150937 CRISPR array with 7 repeats of length 36%2C consensus sequence GAAGTCTATCAGGGGTAATGAGAACTGAACCCCAGC and spacer length 28
1803 PKHR02000015.1 GCA002861385_00900 CDS open 1-1053 _na     350_aa pspC Phage shock protein PspC N-terminal domain-containing protein
1804 PKHR02000015.1 GCA002861385_00901 CDS open 1065-2186 _na     373_aa low specificity L-threonine aldolase
1805 PKHR02000015.1 GCA002861385_00902 CDS open 2220-3413 _na     397_aa HNH nuclease domain-containing protein
1806 PKHR02000015.1 GCA002861385_00903 CDS open 3805-5373 _na     522_aa guaA glutamine-hydrolyzing GMP synthase
1807 PKHR02000015.1 GCA002861385_00904 CDS open 5398-6324 _na     308_aa HTH-type transcriptional regulator
1808 PKHR02000015.1 GCA002861385_00905 CDS open 6399-7379 _na     326_aa Multidrug DMT transporter permease
1809 PKHR02000015.1 GCA002861385_00906 CDS open 7427-8587 _na     386_aa guaB3 GuaB3 family IMP dehydrogenase-related protein
1810 PKHR02000015.1 GCA002861385_00907 CDS open 8597-10111 _na     504_aa guaB IMP dehydrogenase
1811 PKHR02000015.1 GCA002861385_00908 CDS open 10261-10635 _na     124_aa DUF5319 domain-containing protein
1812 PKHR02000015.1 GCA002861385_00909 CDS open 10721-11560 _na     279_aa rsdA Anti-sigma-D factor RsdA sigma factor binding region domain-containing protein
1813 PKHR02000015.1 GCA002861385_00910 CDS open 11679-12290 _na     203_aa ECF-family sigma factor D
1814 PKHR02000015.1 GCA002861385_00911 CDS open 12645-12944 _na     99_aa whiB Transcriptional regulator WhiB
1815 PKHR02000015.1 GCA002861385_00912 CDS open 13166-15235 _na     689_aa UvrABC system protein A
1816 PKHR02000015.1 GCA002861385_00913 CDS open 15365-16981 _na     538_aa groL chaperonin GroEL
1817 PKHR02000015.1 GCA002861385_00914 CDS open 17000-17293 _na     97_aa groES co-chaperone GroES
1818 PKHR02000015.1 GCA002861385_00915 CDS open 17440-18714 _na     424_aa FtsX-like permease family protein
1819 PKHR02000015.1 GCA002861385_00916 CDS open 18698-19303 _na     201_aa ABC transporter domain-containing protein
1820 PKHR02000015.1 GCA002861385_00917 CDS open 19416-20498 _na     360_aa histidine kinase
1821 PKHR02000015.1 GCA002861385_00918 CDS open 20544-21179 _na     211_aa Response regulator receiver domain protein
1822 PKHR02000015.1 GCA002861385_00919 CDS open 21214-21642 _na     142_aa DUF3846 domain-containing protein
1823 PKHR02000015.1 GCA002861385_00920 CDS open 21721-22773 _na     350_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1824 PKHR02000015.1 GCA002861385_00921 CDS open 22767-23261 _na     164_aa Ribosomal-protein-alanine N-acetyltransferase
1825 PKHR02000015.1 GCA002861385_00922 CDS open 23258-23950 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1826 PKHR02000015.1 GCA002861385_00923 CDS open 23950-24519 _na     189_aa Secreted protein
1827 PKHR02000015.1 GCA002861385_00924 CDS open 24589-26181 _na     530_aa Putative membrane protein
1828 PKHR02000015.1 GCA002861385_00925 CDS open 26183-26647 _na     154_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1829 PKHR02000015.1 GCA002861385_00926 CDS open 26637-27746 _na     369_aa alr alanine racemase
1830 PKHR02000015.1 GCA002861385_00927 CDS open 27769-29640 _na     623_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1831 PKHR02000015.1 GCA002861385_00928 CDS open 29747-30568 _na     273_aa Dienelactone hydrolase domain-containing protein
1832 PKHR02000015.1 GCA002861385_00929 CDS open 30639-30857 _na     72_aa Cardiolipin synthase N-terminal domain-containing protein
1833 PKHR02000015.1 GCA002861385_00930 CDS open 30958-31215 _na     85_aa hypothetical protein
1834 PKHR02000015.1 GCA002861385_00931 CDS open 31215-32906 _na     563_aa Zinc metalloprotease
1835 PKHR02000015.1 GCA002861385_00932 CDS open 32906-33217 _na     103_aa Chemotaxis protein
1836 PKHR02000015.1 GCA002861385_00933 CDS open 33357-34700 _na     447_aa glmM phosphoglucosamine mutase
1837 PKHR02000015.1 GCA002861385_00934 CDS open 34864-35400 _na     178_aa rpsI 30S ribosomal protein S9
1838 PKHR02000015.1 GCA002861385_00935 CDS open 35400-35948 _na     182_aa rplM 50S ribosomal protein L13
1839 PKHR02000015.1 GCA002861385_00936 CDS open 36278-36565 _na     95_aa ESAT-6-like protein
1840 PKHR02000015.1 GCA002861385_00937 CDS open 36637-36954 _na     105_aa ESAT-6-like protein
1841 PKHR02000015.1 GCA002861385_00938 CDS open 37132-38262 _na     376_aa Type VII secretion-associated protein
1842 PKHR02000015.1 GCA002861385_00939 CDS open 38259-40583 _na     774_aa ftsK FtsK domain-containing protein
1843 PKHR02000015.1 GCA002861385_00940 CDS open 41419-41727 _na     102_aa helix-turn-helix domain-containing protein
1844 PKHR02000015.1 GCA002861385_00941 CDS open 41730-46172 _na     1480_aa DNA polymerase
1845 PKHR02000015.1 GCA002861385_00942 CDS open 46265-46546 _na     93_aa Histone
1846 PKHR02000015.1 GCA002861385_00943 CDS open 47422-49152 _na     576_aa ATP synthase F0 subunit B
1847 PKHR02000015.1 GCA002861385_00944 CDS open 49853-50092 _na     79_aa single-stranded DNA-binding protein
1848 PKHR02000015.1 GCA002861385_00945 CDS open 50401-51174 _na     257_aa ADP-ribosylglycohydrolase family protein
1849 PKHR02000015.1 GCA002861385_00946 CDS open 51214-51840 _na     208_aa DUF1643 domain-containing protein
1850 PKHR02000015.1 GCA002861385_00947 CDS open 52169-52585 _na     138_aa single-stranded DNA-binding protein
1851 PKHR02000015.1 GCA002861385_00948 CDS open 52657-52800 _na     47_aa Anti-sigma factor
1852 PKHR02000015.1 GCA002861385_00949 CDS open 52957-53541 _na     194_aa ardA antirestriction protein ArdA
1853 PKHR02000015.1 GCA002861385_00950 CDS open 53625-54647 _na     340_aa DUF4192 domain-containing protein
1854 PKHR02000015.1 GCA002861385_00951 CDS open 54824-55396 _na     190_aa DNA-invertase hin
1855 PKHR02000015.1 GCA002861385_00952 CDS open 55399-58767 _na     1122_aa N-6 DNA methylase
1856 PKHR02000015.1 GCA002861385_00953 CDS open 58771-60102 _na     443_aa eccD type VII secretion integral membrane protein EccD
1857 PKHR02000015.1 GCA002861385_00954 CDS open 60099-61343 _na     414_aa S8 family serine peptidase
1858 PKHR02000015.1 GCA002861385_00955 CDS open 61234-62493 _na     419_aa eccB type VII secretion protein EccB
1859 PKHR02000015.1 GCA002861385_00956 CDS open 62549-63406 _na     285_aa truA tRNA pseudouridine(38-40) synthase TruA
1860 PKHR02000015.1 GCA002861385_00957 CDS open 63422-64297 _na     291_aa Glycine transporter domain-containing protein
1861 PKHR02000015.1 GCA002861385_00958 CDS open 64357-64878 _na     173_aa rplQ 50S ribosomal protein L17
1862 PKHR02000015.1 GCA002861385_00959 CDS open 64957-65967 _na     336_aa DNA-directed RNA polymerase subunit alpha
1863 PKHR02000015.1 GCA002861385_00960 CDS open 66037-66642 _na     201_aa rpsD 30S ribosomal protein S4
1864 PKHR02000015.1 GCA002861385_00961 CDS open 66664-67068 _na     134_aa rpsK 30S ribosomal protein S11
1865 PKHR02000015.1 GCA002861385_00962 CDS open 67072-67440 _na     122_aa rpsM 30S ribosomal protein S13
1866 PKHR02000015.1 GCA002861385_00963 CDS open 67626-67844 _na     72_aa infA translation initiation factor IF-1
1867 PKHR02000015.1 GCA002861385_00964 CDS open 68067-68858 _na     263_aa L%2CD-TPase catalytic domain-containing protein
1868 PKHR02000015.1 GCA002861385_00965 CDS open 68910-69704 _na     264_aa map type I methionyl aminopeptidase
1869 PKHR02000015.1 GCA002861385_00966 CDS open 69719-70264 _na     181_aa adk adenylate kinase
1870 PKHR02000015.1 GCA002861385_00967 CDS open 70264-71589 _na     441_aa secY preprotein translocase subunit SecY
1871 PKHR02000015.1 GCA002861385_00968 CDS open 71970-73277 _na     435_aa Cyclopropane-fatty-acyl-phospholipid synthase
1872 PKHR02000015.1 GCA002861385_00969 CDS open 73295-74776 _na     493_aa FAD/FMN-containing dehydrogenase
1873 PKHR02000015.1 GCA002861385_00970 CDS open 74789-75127 _na     112_aa Secreted protein
1874 PKHR02000015.1 GCA002861385_00971 CDS open 75268-75714 _na     148_aa rplO 50S ribosomal protein L15
1875 PKHR02000015.1 GCA002861385_00972 CDS open 75718-75903 _na     61_aa rpmD 50S ribosomal protein L30
1876 PKHR02000015.1 GCA002861385_00973 CDS open 75907-76533 _na     208_aa rpsE 30S ribosomal protein S5
1877 PKHR02000015.1 GCA002861385_00974 CDS open 76574-76975 _na     133_aa rplR 50S ribosomal protein L18
1878 PKHR02000015.1 GCA002861385_00975 CDS open 76979-77515 _na     178_aa rplF 50S ribosomal protein L6
1879 PKHR02000015.1 GCA002861385_00976 CDS open 77530-77913 _na     127_aa rpsH 30S ribosomal protein S8
1880 PKHR02000015.1 GCA002861385_00977 CDS open 78224-78472 _na     82_aa DUF6457 domain-containing protein
1881 PKHR02000015.1 GCA002861385_00978 CDS open 78469-79320 _na     283_aa fdhD formate dehydrogenase accessory sulfurtransferase FdhD
1882 PKHR02000015.1 GCA002861385_00979 CDS open 79289-80074 _na     261_aa Transporter protein
1883 PKHR02000015.1 GCA002861385_00980 CDS open 80224-80775 _na     183_aa rplE 50S ribosomal protein L5
1884 PKHR02000015.1 GCA002861385_00981 CDS open 80777-81091 _na     104_aa rplX 50S ribosomal protein L24
1885 PKHR02000015.1 GCA002861385_00982 CDS open 81096-81464 _na     122_aa rplN 50S ribosomal protein L14
1886 PKHR02000015.1 GCA002861385_00983 CDS open 81900-83906 _na     668_aa protein-N(pi)-phosphohistidine--sucrose phosphotransferase
1887 PKHR02000015.1 GCA002861385_00984 CDS open 84019-85341 _na     440_aa beta-fructofuranosidase
1888 PKHR02000015.1 GCA002861385_00985 CDS open 85372-86232 _na     286_aa Carbohydrate kinase
1889 PKHR02000015.1 GCA002861385_00986 CDS open 86229-86621 _na     130_aa Secreted protein
1890 PKHR02000015.1 GCA002861385_00987 CDS open 86618-87340 _na     240_aa Secreted protein
1891 PKHR02000015.1 GCA002861385_00988 CDS open 87530-87811 _na     93_aa rpsQ 30S ribosomal protein S17
1892 PKHR02000015.1 GCA002861385_00989 CDS open 87814-88044 _na     76_aa rpmC 50S ribosomal protein L29
1893 PKHR02000015.1 GCA002861385_00990 CDS open 88044-88460 _na     138_aa rplP 50S ribosomal protein L16
1894 PKHR02000015.1 GCA002861385_00991 CDS open 88464-89210 _na     248_aa rpsC 30S ribosomal protein S3
1895 PKHR02000015.1 GCA002861385_00992 CDS open 89210-89572 _na     120_aa rplV 50S ribosomal protein L22
1896 PKHR02000015.1 GCA002861385_00993 CDS open 89576-89854 _na     92_aa rpsS 30S ribosomal protein S19
1897 PKHR02000015.1 GCA002861385_00994 CDS open 89868-90704 _na     278_aa rplB 50S ribosomal protein L2
1898 PKHR02000015.1 GCA002861385_00995 CDS open 90740-91042 _na     100_aa rplW 50S ribosomal protein L23
1899 PKHR02000015.1 GCA002861385_00996 CDS open 91042-91704 _na     220_aa rplD 50S ribosomal protein L4
1900 PKHR02000015.1 GCA002861385_00997 CDS open 91701-92357 _na     218_aa rplC 50S ribosomal protein L3
1901 PKHR02000015.1 GCA002861385_00998 CDS open 92393-92698 _na     101_aa rpsJ 30S ribosomal protein S10
1902 PKHR02000015.1 GCA002861385_00999 CDS open 93336-93833 _na     165_aa Asp23/Gls24 family envelope stress response protein
1903 PKHR02000015.1 GCA002861385_01000 CDS open 93835-94140 _na     101_aa Asp23/Gls24 family envelope stress response protein
1904 PKHR02000015.1 GCA002861385_01001 CDS open 94172-94366 _na     64_aa DUF2273 domain-containing protein
1905 PKHR02000015.1 GCA002861385_01002 CDS open 94366-95268 _na     300_aa Asp23/Gls24 family envelope stress response protein
1906 PKHR02000015.1 GCA002861385_01003 CDS open 95261-95836 _na     191_aa DUF6286 domain-containing protein
1907 PKHR02000015.1 GCA002861385_01004 CDS open 95829-96389 _na     186_aa amaP Alkaline shock response membrane anchor protein AmaP
1908 PKHR02000015.1 GCA002861385_01005 CDS open 96513-97664 _na     383_aa HNH nuclease domain-containing protein
1909 PKHR02000015.1 GCA002861385_01006 CDS open 97894-98697 _na     267_aa AbiEi antitoxin C-terminal domain-containing protein
1910 PKHR02000015.1 GCA002861385_01007 CDS open 98806-99996 _na     396_aa tuf elongation factor Tu
1911 PKHR02000015.1 GCA002861385_01008 CDS open 100364-102493 _na     709_aa fusA elongation factor G
1912 PKHR02000015.1 GCA002861385_01009 CDS open 102804-103271 _na     155_aa rpsG 30S ribosomal protein S7
1913 PKHR02000015.1 GCA002861385_01010 CDS open 103278-103649 _na     123_aa rpsL 30S ribosomal protein S12
1914 PKHR02000015.1 GCA002861385_01011 CDS open 103895-104497 _na     200_aa (d)CMP kinase
1915 PKHR02000015.1 GCA002861385_01012 CDS open 104553-105329 _na     258_aa Permease of the major facilitator superfamily
1916 PKHR02000015.1 GCA002861385_01013 CDS open 105322-106797 _na     491_aa ykoD Putative HMP/thiamine import ATP-binding protein YkoD
1917 PKHR02000015.1 GCA002861385_01014 CDS open 106806-107450 _na     214_aa ABC transporter permease
1918 PKHR02000015.1 GCA002861385_01015 CDS open 107908-108078 _na     56_aa hypothetical protein
1919 PKHR02000015.1 GCA002861385_01016 CDS open 108102-113210 _na     1702_aa YPDG domain-containing protein
1920 PKHR02000015.1 GCA002861385_01017 CDS open 113518-117513 _na     1331_aa rpoC DNA-directed RNA polymerase subunit beta'
1921 PKHR02000015.1 GCA002861385_01018 CDS open 117616-121095 _na     1159_aa DNA-directed RNA polymerase subunit beta
1922 PKHR02000015.1 GCA002861385_01019 CDS open 121390-122346 _na     318_aa DUF3068 domain-containing protein
1923 PKHR02000015.1 GCA002861385_01020 CDS open 123232-123618 _na     128_aa rplL 50S ribosomal protein L7/L12
1924 PKHR02000015.1 GCA002861385_01021 CDS open 123705-124226 _na     173_aa rplJ 50S ribosomal protein L10
1925 PKHR02000015.1 GCA002861385_01022 CDS open 124579-125373 _na     264_aa Iron-enterobactin transporter ATP-binding protein
1926 PKHR02000015.1 GCA002861385_01023 CDS open 125379-126431 _na     350_aa Iron ABC transporter permease
1927 PKHR02000015.1 GCA002861385_01024 CDS open 126428-127396 _na     322_aa Iron ABC transporter permease
1928 PKHR02000015.1 GCA002861385_01025 CDS open 127463-128407 _na     314_aa ABC-type Fe3+-hydroxamate transport system%2C periplasmic component
1929 PKHR02000015.1 GCA002861385_01026 CDS open 128532-129326 _na     264_aa Putative iron utilization protein
1930 PKHR02000015.1 GCA002861385_01027 CDS open 129917-130621 _na     234_aa rplA 50S ribosomal protein L1
1931 PKHR02000015.1 GCA002861385_01028 CDS open 130719-131162 _na     147_aa rplK 50S ribosomal protein L11
1932 PKHR02000015.1 GCA002861385_01029 CDS open 131328-132236 _na     302_aa nusG transcription termination/antitermination protein NusG
1933 PKHR02000015.1 GCA002861385_01030 CDS open 132376-132702 _na     108_aa secE preprotein translocase subunit SecE
1934 PKHR02000015.1 GCA002861385_01035 CDS open 133613-134617 _na     334_aa Polyprenyl diphosphate synthase
1935 PKHR02000015.1 GCA002861385_01036 CDS open 134723-135949 _na     408_aa FAD-binding domain-containing protein
1936 PKHR02000015.1 GCA002861385_01037 CDS open 135970-136659 _na     229_aa demethylmenaquinone methyltransferase
1937 PKHR02000015.1 GCA002861385_01038 CDS open 136671-137882 _na     403_aa Glycosyltransferase
1938 PKHR02000015.1 GCA002861385_01039 CDS open 137879-138322 _na     147_aa DUF3592 domain-containing protein
1939 PKHR02000015.1 GCA002861385_01040 CDS open 138323-140014 _na     563_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
1940 PKHR02000015.1 GCA002861385_01041 CDS open 140007-140621 _na     204_aa hypothetical protein
1941 PKHR02000015.1 GCA002861385_01042 CDS open 140632-143013 _na     793_aa uvrA excinuclease ABC subunit UvrA
1942 PKHR02000015.1 GCA002861385_01043 CDS open 143033-144052 _na     339_aa o-succinylbenzoate synthase
1943 PKHR02000015.1 GCA002861385_01044 CDS open 144141-145550 _na     469_aa dcuC C4-dicarboxylate transporter DcuC
1944 PKHR02000015.1 GCA002861385_01045 CDS open 145737-149036 _na     1099_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1945 PKHR02000015.1 GCA002861385_01046 CDS open 149036-149953 _na     305_aa cas1 type II CRISPR-associated endonuclease Cas1
1946 PKHR02000015.1 GCA002861385_01047 CDS open 149937-150266 _na     109_aa cas2 CRISPR-associated endonuclease Cas2
1947 PKHR02000015.1 GCA002861385_01048 CDS open 151079-151540 _na     153_aa Septicolysin
1948 PKHR02000015.1 GCA002861385_01049 CDS open 151905-152885 _na     326_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
1949 PKHR02000015.1 GCA002861385_01050 CDS open 152907-153068 _na     53_aa Secreted protein
1950 PKHR02000015.1 GCA002861385_01051 CDS open 153080-154228 _na     382_aa menE o-succinylbenzoate--CoA ligase
1951 PKHR02000015.1 GCA002861385_01052 CDS open 154225-154914 _na     229_aa Diphtheria toxin repressor
1952 PKHR02000015.1 GCA002861385_01053 CDS open 155022-155948 _na     308_aa Iron ABC transporter substrate-binding protein
1953 PKHR02000015.1 GCA002861385_01054 CDS open 155948-156658 _na     236_aa Manganese ABC transport system%2C ATP-binding protein
1954 PKHR02000015.1 GCA002861385_01055 CDS open 156655-157509 _na     284_aa Manganese ABC transport system membrane protein
1955 PKHR02000015.1 GCA002861385_01056 CDS open 157506-158360 _na     284_aa Manganese ABC transport system membrane protein
1956 PKHR02000015.1 GCA002861385_01057 CDS open 158366-159250 _na     294_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
1957 PKHR02000015.1 GCA002861385_01058 CDS open 159259-159600 _na     113_aa DUF4229 domain-containing protein
1958 PKHR02000015.1 GCA002861385_01059 CDS open 159644-159958 _na     104_aa Secreted protein
1959 PKHR02000015.1 GCA002861385_01060 CDS open 159955-160212 _na     85_aa Transcriptional regulator
1960 PKHR02000015.1 GCA002861385_01061 CDS open 160213-161229 _na     338_aa ccsB c-type cytochrome biogenesis protein CcsB
1961 PKHR02000015.1 GCA002861385_01062 CDS open 161371-163002 _na     543_aa Membrane protein required for cytochrome c biosynthesis
1962 PKHR02000015.1 GCA002861385_01063 CDS open 163015-163821 _na     268_aa Cytochrome c biogenesis protein
1963 PKHR02000015.1 GCA002861385_01064 CDS open 163818-164423 _na     201_aa Thiol-disulfide isomerase/thioredoxin
1964 PKHR02000015.1 GCA002861385_01065 CDS open 164423-165031 _na     202_aa Phosphoglycerate mutase
1965 PKHR02000015.1 GCA002861385_01066 CDS open 165063-166397 _na     444_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1966 PKHR02000015.1 GCA002861385_01067 CDS open 166585-167160 _na     191_aa hypothetical protein
1967 PKHR02000015.1 GCA002861385_01068 CDS open 167303-168913 _na     536_aa hlyD HlyD family efflux transporter periplasmic adaptor subunit
1968 PKHR02000015.1 GCA002861385_01069 CDS open 168910-169584 _na     224_aa Methionine import ATP-binding protein
1969 PKHR02000015.1 GCA002861385_01070 CDS open 169581-170876 _na     431_aa macB Macrolide export ATP-binding/permease macB
1970 PKHR02000015.1 GCA002861385_01071 CDS open 170910-171224 _na     104_aa Small multidrug resistance protein
1971 PKHR02000015.1 GCA002861385_01072 CDS open 171332-172171 _na     279_aa 6-phosphogluconate dehydrogenase
1972 PKHR02000015.1 GCA002861385_01073 CDS open 172181-172804 _na     207_aa protein adenylyltransferase
1973 PKHR02000015.1 GCA002861385_01074 CDS open 172821-173012 _na     63_aa vbhA Antitoxin VbhA domain-containing protein
1974 PKHR02000015.1 GCA002861385_01075 CDS open 173188-173766 _na     192_aa ABC transport system%2C ATP-binding protein
1975 PKHR02000015.1 GCA002861385_01076 CDS open 173766-174782 _na     338_aa ABC transporter permease
1976 PKHR02000015.1 GCA002861385_01077 CDS open 174867-176378 _na     503_aa ABC transport system%2C ATP-binding protein
1977 PKHR02000015.1 GCA002861385_01078 CDS open 176447-176704 _na     85_aa Antitoxin
1978 PKHR02000015.1 GCA002861385_01079 CDS open 176710-176964 _na     84_aa Txe/YoeB family addiction module toxin
1979 PKHR02000015.1 GCA002861385_01080 CDS open 177160-178542 _na     460_aa protoporphyrinogen oxidase
1980 PKHR02000015.1 GCA002861385_01081 CDS open 178543-179583 _na     346_aa hemE uroporphyrinogen decarboxylase
1981 PKHR02000015.1 GCA002861385_01082 CDS open 179622-180119 _na     165_aa terC Tellurium resistance protein TerC
1982 PKHR02000015.1 GCA002861385_01083 CDS open 180116-180814 _na     232_aa Transmembrane protein
1983 PKHR02000015.1 GCA002861385_01084 CDS open 180825-181802 _na     325_aa hemB porphobilinogen synthase
1984 PKHR02000015.1 GCA002861385_01085 CDS open 181865-183571 _na     568_aa uroporphyrinogen-III C-methyltransferase
1985 PKHR02000015.1 GCA002861385_01086 CDS open 183750-184640 _na     296_aa hemC hydroxymethylbilane synthase
1986 PKHR02000015.1 GCA002861385_01087 CDS open 184641-186017 _na     458_aa hemA glutamyl-tRNA reductase
1987 PKHR02000015.1 GCA002861385_01088 CDS open 186122-186361 _na     79_aa Glutaredoxin family protein
1988 PKHR02000015.1 GCA002861385_01089 CDS open 186428-187483 _na     351_aa Phosphoserine phosphatase
1989 PKHR02000015.1 GCA002861385_01090 CDS open 187480-188058 _na     192_aa Scramblase
1990 PKHR02000015.1 GCA002861385_01091 CDS open 188192-189493 _na     433_aa HNH nuclease domain-containing protein
1991 PKHR02000015.1 GCA002861385_01092 CDS open 189631-189732 _na     33_aa 30S ribosomal protein bS22
1992 PKHR02000015.1 GCA002861385_01093 CDS open 189977-190165 _na     62_aa Helix-turn-helix domain-containing protein
1993 PKHR02000015.1 GCA002861385_01094 CDS open 190366-191157 _na     263_aa proC pyrroline-5-carboxylate reductase
1994 PKHR02000015.1 GCA002861385_01095 CDS open 191360-192208 _na     282_aa hypothetical protein
1995 PKHR02000015.1 GCA002861385_01096 CDS open 192218-193063 _na     281_aa Exopolyphosphatase
1996 PKHR02000015.1 GCA002861385_01097 CDS open 193181-194062 _na     293_aa DUF3109 domain-containing protein
1997 PKHR02000015.1 GCA002861385_01098 CDS open 194059-194757 _na     232_aa regX3 Sensory transduction protein RegX3
1998 PKHR02000015.1 GCA002861385_01099 CDS open 194754-196019 _na     421_aa senX3 Sensor-like histidine kinase SenX3
1999 PKHR02000015.1 GCA002861385_01100 CDS open 196093-196854 _na     253_aa phosphoglyceromutase
2000 PKHR02000015.1 GCA002861385_01101 CDS open 196886-198151 _na     421_aa mshA D-inositol-3-phosphate glycosyltransferase