HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_002913265.1)

Select a Genome:
BAKTA Annotations for GCA_002913265.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
45 1927468 1885 3 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3867 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3867 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 PPAX01000017.1 GCA002913265_00547 CDS open 78127-78315 _na     62_aa ClpX-type ZB domain-containing protein
1002 PPAX01000017.1 GCA002913265_00548 CDS open 78312-80552 _na     746_aa EAL domain-containing protein
1003 PPAX01000017.1 GCA002913265_00549 CDS open 80756-81295 _na     179_aa ycxB YcxB family protein
1004 PPAX01000017.1 GCA002913265_00550 CDS open 81288-83615 _na     775_aa EAL domain-containing protein
1005 PPAX01000017.1 GCA002913265_00551 CDS open 83622-85454 _na     610_aa ciaB invasion protein CiaB
1006 PPAX01000017.1 GCA002913265_00552 CDS open 85545-85958 _na     137_aa Acyl-CoA thioester hydrolase
1007 PPAX01000017.1 GCA002913265_00553 CDS open 86088-86726 _na     212_aa HTH crp-type domain-containing protein
1008 PPAX01000017.1 GCA002913265_00554 CDS open 86845-87705 _na     286_aa Formate efflux transporter
1009 PPAX01000017.1 GCA002913265_00555 CDS open 87890-88336 _na     148_aa Coenzyme F420 hydrogenase maturation protease
1010 PPAX01000017.1 GCA002913265_00556 CDS open 88336-88680 _na     114_aa Formate hydrogenlyase family maturation protein
1011 PPAX01000017.1 GCA002913265_00557 CDS open 88677-89501 _na     274_aa Hydrogenase-4%2C component I
1012 PPAX01000017.1 GCA002913265_00558 CDS open 89498-90037 _na     179_aa 4Fe-4S dicluster domain-containing protein
1013 PPAX01000017.1 GCA002913265_00559 CDS open 90034-91770 _na     578_aa DNA-3-methyladenine glycosylase I
1014 PPAX01000017.1 GCA002913265_00560 CDS open 91767-93248 _na     493_aa NADH:quinone oxidoreductase/Mrp antiporter transmembrane domain-containing protein
1015 PPAX01000017.1 GCA002913265_00561 CDS open 93251-93895 _na     214_aa hyfE hydrogenase 4 membrane subunit
1016 PPAX01000017.1 GCA002913265_00562 CDS open 93897-94817 _na     306_aa Formate hydrogenlyase subunit 4
1017 PPAX01000017.1 GCA002913265_00563 CDS open 94827-96794 _na     655_aa Hydrogenase-4%2C component B
1018 PPAX01000017.1 GCA002913265_00564 CDS open 96796-97365 _na     189_aa Hydrogenase-4%2C component A
1019 PPAX01000017.1 GCA002913265_00565 CDS open 97783-98634 _na     283_aa MBL fold metallo-hydrolase
1020 PPAX01000017.1 GCA002913265_00566 CDS open 98641-98865 _na     74_aa MBL fold metallo-hydrolase
1021 PPAX01000017.1 GCA002913265_00567 CDS open 98910-99197 _na     95_aa hypothetical protein
1022 PPAX01000017.1 GCA002913265_00568 CDS open 99469-100509 _na     346_aa Ubiquinol cytochrome c oxidoreductase PetABC%2C membrane-bound cytochrome c subunit
1023 PPAX01000017.1 GCA002913265_00569 CDS open 100512-101756 _na     414_aa Ubiquinol cytochrome c oxidoreductase PetABC%2C cytochrome b subunit
1024 PPAX01000017.1 GCA002913265_00570 CDS open 101767-102270 _na     167_aa petA ubiquinol-cytochrome c reductase iron-sulfur subunit
1025 PPAX01000017.1 GCA002913265_00454 gene open 761-1126
1026 PPAX01000017.1 GCA002913265_00455 gene open 1245-2339 dapE
1027 PPAX01000017.1 GCA002913265_00456 gene open 2340-4253
1028 PPAX01000017.1 GCA002913265_00457 gene open 4333-6537 mutS2
1029 PPAX01000017.1 GCA002913265_00458 gene open 6534-6878
1030 PPAX01000017.1 GCA002913265_00459 gene open 6872-7189
1031 PPAX01000017.1 GCA002913265_00460 gene open 7189-8517 murC
1032 PPAX01000017.1 GCA002913265_00461 gene open 8788-9744
1033 PPAX01000017.1 GCA002913265_00462 gene open 9744-9950 marR
1034 PPAX01000017.1 GCA002913265_00463 gene open 9919-10371
1035 PPAX01000017.1 GCA002913265_00464 gene open 10458-11876
1036 PPAX01000017.1 GCA002913265_00465 gene open 11876-12175
1037 PPAX01000017.1 GCA002913265_00466 gene open 12187-13017
1038 PPAX01000017.1 GCA002913265_00467 gene open 13034-14236
1039 PPAX01000017.1 GCA002913265_00468 gene open 14229-14993
1040 PPAX01000017.1 GCA002913265_00469 gene open 14983-15180
1041 PPAX01000017.1 GCA002913265_00470 gene open 15180-15983
1042 PPAX01000017.1 GCA002913265_00471 gene open 15946-16305
1043 PPAX01000017.1 GCA002913265_00472 gene open 16365-16763
1044 PPAX01000017.1 GCA002913265_00473 gene open 17167-17514
1045 PPAX01000017.1 GCA002913265_00474 gene open 17525-17863
1046 PPAX01000017.1 GCA002913265_00475 gene open 17863-18249
1047 PPAX01000017.1 GCA002913265_00476 gene open 18230-18469
1048 PPAX01000017.1 GCA002913265_00477 gene open 18462-18761
1049 PPAX01000017.1 GCA002913265_00478 gene open 18766-19104
1050 PPAX01000017.1 GCA002913265_00479 gene open 19149-19502
1051 PPAX01000017.1 GCA002913265_00480 gene open 19506-20066
1052 PPAX01000017.1 GCA002913265_00481 gene open 20063-20857
1053 PPAX01000017.1 GCA002913265_00482 gene open 20850-21041 xseB
1054 PPAX01000017.1 GCA002913265_00483 gene open 21045-22151
1055 PPAX01000017.1 GCA002913265_00484 gene open 22151-23599 guaB
1056 PPAX01000017.1 GCA002913265_00485 gene open 23604-24962 gatA
1057 PPAX01000017.1 GCA002913265_00486 gene open 25062-27818 ileS
1058 PPAX01000017.1 GCA002913265_00487 gene open 27914-29011
1059 PPAX01000017.1 GCA002913265_00488 gene open 29101-30351
1060 PPAX01000017.1 GCA002913265_00489 gene open 30402-32630
1061 PPAX01000017.1 GCA002913265_00490 gene open 32627-33145 lolA
1062 PPAX01000017.1 GCA002913265_00491 gene open 33142-33570
1063 PPAX01000017.1 GCA002913265_00492 gene open 33567-35177
1064 PPAX01000017.1 GCA002913265_00493 gene open 35174-36730
1065 PPAX01000017.1 GCA002913265_00494 gene open 36720-37265
1066 PPAX01000017.1 GCA002913265_00495 gene open 37255-37500
1067 PPAX01000017.1 GCA002913265_00496 gene open 37503-37760
1068 PPAX01000017.1 GCA002913265_00497 gene open 37744-38490
1069 PPAX01000017.1 GCA002913265_00498 gene open 38480-39148
1070 PPAX01000017.1 GCA002913265_00499 gene open 39148-39564
1071 PPAX01000017.1 GCA002913265_00500 gene open 39577-40830
1072 PPAX01000017.1 GCA002913265_00501 gene open 40830-41534 fabG
1073 PPAX01000017.1 GCA002913265_00502 gene open 41542-41982
1074 PPAX01000017.1 GCA002913265_00503 gene open 41982-43148 fabV
1075 PPAX01000017.1 GCA002913265_00504 gene open 43135-43512
1076 PPAX01000017.1 GCA002913265_00505 gene open 43538-44059
1077 PPAX01000017.1 GCA002913265_00506 gene open 44040-44723
1078 PPAX01000017.1 GCA002913265_00507 gene open 45179-46630 pyk
1079 PPAX01000017.1 GCA002913265_00508 gene open 46723-47784 dctP
1080 PPAX01000017.1 GCA002913265_00509 gene open 48053-48637
1081 PPAX01000017.1 GCA002913265_00510 gene open 48669-49457
1082 PPAX01000017.1 GCA002913265_00511 gene open 49454-50347
1083 PPAX01000017.1 GCA002913265_00512 gene open 50357-50899
1084 PPAX01000017.1 GCA002913265_00513 gene open 50899-52143 glyA
1085 PPAX01000017.1 GCA002913265_00514 gene open 52140-53651 lysS
1086 PPAX01000017.1 GCA002913265_00515 gene open 53653-54120
1087 PPAX01000017.1 GCA002913265_00516 gene open 54117-54734 cvpA
1088 PPAX01000017.1 GCA002913265_00517 gene open 54734-55867 pilT
1089 PPAX01000017.1 GCA002913265_00518 gene open 55871-56158 gatC
1090 PPAX01000017.1 GCA002913265_00519 gene open 56283-56846
1091 PPAX01000017.1 GCA002913265_00520 gene open 56846-57853
1092 PPAX01000017.1 GCA002913265_00521 gene open 57850-58182
1093 PPAX01000017.1 GCA002913265_00522 gene open 58169-58801
1094 PPAX01000017.1 GCA002913265_00523 gene open 58795-59403 hisG
1095 PPAX01000017.1 GCA002913265_00524 gene open 59834-60478
1096 PPAX01000017.1 GCA002913265_00525 gene open 60478-61542 tsf
1097 PPAX01000017.1 GCA002913265_00526 gene open 61542-62330 rpsB
1098 PPAX01000017.1 GCA002913265_00527 gene open 62521-63660 iadA
1099 PPAX01000017.1 GCA002913265_00528 gene open 63671-63880
1100 PPAX01000017.1 GCA002913265_00529 gene open 63870-64589
1101 PPAX01000017.1 GCA002913265_00530 gene open 64600-65214
1102 PPAX01000017.1 GCA002913265_00531 gene open 65317-66225
1103 PPAX01000017.1 GCA002913265_00532 gene open 66450-67538
1104 PPAX01000017.1 GCA002913265_00533 gene open 67516-68664 gldA
1105 PPAX01000017.1 GCA002913265_00534 gene open 68682-69098
1106 PPAX01000017.1 GCA002913265_00535 gene open 69228-69401
1107 PPAX01000017.1 GCA002913265_00536 gene open 69937-70779
1108 PPAX01000017.1 GCA002913265_00537 gene open 70791-71645
1109 PPAX01000017.1 GCA002913265_00538 gene open 71850-72785 accA
1110 PPAX01000017.1 GCA002913265_00539 gene open 72787-73998
1111 PPAX01000017.1 GCA002913265_00540 gene open 74033-74266 acpP
1112 PPAX01000017.1 GCA002913265_00541 gene open 74353-75096 fabG
1113 PPAX01000017.1 GCA002913265_00542 gene open 75152-75571
1114 PPAX01000017.1 GCA002913265_00543 gene open 75572-75940
1115 PPAX01000017.1 GCA002913265_00544 gene open 76025-76546
1116 PPAX01000017.1 GCA002913265_00545 gene open 76565-77305
1117 PPAX01000017.1 GCA002913265_00546 gene open 77302-77997
1118 PPAX01000017.1 GCA002913265_00547 gene open 78127-78315
1119 PPAX01000017.1 GCA002913265_00548 gene open 78312-80552
1120 PPAX01000017.1 GCA002913265_00549 gene open 80756-81295 ycxB
1121 PPAX01000017.1 GCA002913265_00550 gene open 81288-83615
1122 PPAX01000017.1 GCA002913265_00551 gene open 83622-85454 ciaB
1123 PPAX01000017.1 GCA002913265_00552 gene open 85545-85958
1124 PPAX01000017.1 GCA002913265_00553 gene open 86088-86726
1125 PPAX01000017.1 GCA002913265_00554 gene open 86845-87705
1126 PPAX01000017.1 GCA002913265_00555 gene open 87890-88336
1127 PPAX01000017.1 GCA002913265_00556 gene open 88336-88680
1128 PPAX01000017.1 GCA002913265_00557 gene open 88677-89501
1129 PPAX01000017.1 GCA002913265_00558 gene open 89498-90037
1130 PPAX01000017.1 GCA002913265_00559 gene open 90034-91770
1131 PPAX01000017.1 GCA002913265_00560 gene open 91767-93248
1132 PPAX01000017.1 GCA002913265_00561 gene open 93251-93895 hyfE
1133 PPAX01000017.1 GCA002913265_00562 gene open 93897-94817
1134 PPAX01000017.1 GCA002913265_00563 gene open 94827-96794
1135 PPAX01000017.1 GCA002913265_00564 gene open 96796-97365
1136 PPAX01000017.1 GCA002913265_00565 gene open 97783-98634
1137 PPAX01000017.1 GCA002913265_00566 gene open 98641-98865
1138 PPAX01000017.1 GCA002913265_00567 gene open 98910-99197
1139 PPAX01000017.1 GCA002913265_00568 gene open 99469-100509
1140 PPAX01000017.1 GCA002913265_00569 gene open 100512-101756
1141 PPAX01000017.1 GCA002913265_00570 gene open 101767-102270 petA
1142 PPAX01000018.1 GCA002913265_00571 CDS open 271-861 _na     196_aa Methyl-accepting chemotaxis protein
1143 PPAX01000018.1 GCA002913265_00571 gene open 271-861
1144 PPAX01000020.1 GCA002913265_00572 CDS open 56-274 _na     72_aa hypothetical protein
1145 PPAX01000020.1 GCA002913265_00572 gene open 56-274
1146 PPAX01000021.1 GCA002913265_00637 gene open 65133-65459 RNaseP_bact_a
1147 PPAX01000021.1 GCA002913265_00637 ncRNA open 65133-65459 Bacterial RNase P class A
1148 PPAX01000021.1 GCA002913265_00573 CDS open 841-2697 _na     618_aa htpG molecular chaperone HtpG
1149 PPAX01000021.1 GCA002913265_00574 CDS open 2835-3692 _na     285_aa sdhE 8-methylmenaquinol:fumarate reductase membrane anchor subunit
1150 PPAX01000021.1 GCA002913265_00575 CDS open 3695-4660 _na     321_aa sdhB 8-methylmenaquinol:fumarate reductase iron-sulfur subunit
1151 PPAX01000021.1 GCA002913265_00576 CDS open 4670-6508 _na     612_aa sdhA 8-methylmenaquinol:fumarate reductase flavoprotein subunit
1152 PPAX01000021.1 GCA002913265_00577 CDS open 6941-7363 _na     140_aa Heat-shock protein
1153 PPAX01000021.1 GCA002913265_00578 CDS open 7404-7955 _na     183_aa 2-oxoglutarate:acceptor oxidoreductase%2C gamma subunit
1154 PPAX01000021.1 GCA002913265_00579 CDS open 7952-8797 _na     281_aa 2-oxoglutarate ferredoxin oxidoreductase subunit beta
1155 PPAX01000021.1 GCA002913265_00580 CDS open 8787-9917 _na     376_aa 2-oxoglutarate synthase subunit alpha
1156 PPAX01000021.1 GCA002913265_00581 CDS open 9914-10225 _na     103_aa 2-oxoglutarate:acceptor oxidoreductase%2C delta subunit
1157 PPAX01000021.1 GCA002913265_00582 CDS open 10234-11127 _na     297_aa Malate dehydrogenase%2C NAD-dependent
1158 PPAX01000021.1 GCA002913265_00583 CDS open 11131-13305 _na     724_aa isocitrate dehydrogenase (NADP(+))
1159 PPAX01000021.1 GCA002913265_00584 CDS open 13369-14313 _na     314_aa Endolytic murein transglycosylase
1160 PPAX01000021.1 GCA002913265_00585 CDS open 14333-16852 _na     839_aa DUF3971 domain-containing protein
1161 PPAX01000021.1 GCA002913265_00586 CDS open 17528-17869 _na     113_aa hypA hydrogenase maturation nickel metallochaperone HypA
1162 PPAX01000021.1 GCA002913265_00587 CDS open 17869-18861 _na     330_aa hypE hydrogenase expression/formation protein HypE
1163 PPAX01000021.1 GCA002913265_00588 CDS open 18870-19958 _na     362_aa hypD hydrogenase formation protein HypD
1164 PPAX01000021.1 GCA002913265_00589 CDS open 19958-20197 _na     79_aa hypC Hydrogenase assembly chaperone HypC
1165 PPAX01000021.1 GCA002913265_00590 CDS open 20197-21009 _na     270_aa hypB hydrogenase nickel incorporation protein HypB
1166 PPAX01000021.1 GCA002913265_00591 CDS open 21133-21792 _na     219_aa GDYXXLXY protein
1167 PPAX01000021.1 GCA002913265_00592 CDS open 21789-23051 _na     420_aa DUF2157 domain-containing protein
1168 PPAX01000021.1 GCA002913265_00593 CDS open 23413-23826 _na     137_aa nikR nickel-responsive transcriptional regulator NikR
1169 PPAX01000021.1 GCA002913265_00594 CDS open 23872-26097 _na     741_aa hypF carbamoyltransferase HypF
1170 PPAX01000021.1 GCA002913265_00595 CDS open 26081-27553 _na     490_aa hydE Protein hydE
1171 PPAX01000021.1 GCA002913265_00596 CDS open 27550-28092 _na     180_aa Hydrogenase maturation protease
1172 PPAX01000021.1 GCA002913265_00597 CDS open 28092-28772 _na     226_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
1173 PPAX01000021.1 GCA002913265_00598 CDS open 28782-30500 _na     572_aa [NiFe] hydrogenase%2C large subunit
1174 PPAX01000021.1 GCA002913265_00599 CDS open 30510-31655 _na     381_aa [NiFe] hydrogenase%2C small subunit
1175 PPAX01000021.1 GCA002913265_00600 CDS open 31999-32706 _na     235_aa flgH flagellar basal body L-ring protein FlgH
1176 PPAX01000021.1 GCA002913265_00601 CDS open 32773-34140 _na     455_aa pta phosphate acetyltransferase
1177 PPAX01000021.1 GCA002913265_00602 CDS open 34142-35338 _na     398_aa ackA Acetate kinase
1178 PPAX01000021.1 GCA002913265_00603 CDS open 35417-36370 _na     317_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
1179 PPAX01000021.1 GCA002913265_00604 CDS open 36370-36837 _na     155_aa ilvN acetolactate synthase small subunit
1180 PPAX01000021.1 GCA002913265_00605 CDS open 36834-38531 _na     565_aa acetolactate synthase large subunit
1181 PPAX01000021.1 GCA002913265_00606 CDS open 38685-38942 _na     85_aa hypothetical protein
1182 PPAX01000021.1 GCA002913265_00607 CDS open 39089-40096 _na     335_aa mnmH tRNA 2-selenouridine(34) synthase MnmH
1183 PPAX01000021.1 GCA002913265_00608 CDS open 40083-40568 _na     161_aa HIT domain-containing protein
1184 PPAX01000021.1 GCA002913265_00609 CDS open 40568-41353 _na     261_aa trpC indole-3-glycerol phosphate synthase TrpC
1185 PPAX01000021.1 GCA002913265_00610 CDS open 41350-42612 _na     420_aa tetratricopeptide repeat protein
1186 PPAX01000021.1 GCA002913265_00611 CDS open 42591-42956 _na     121_aa Zinc/iron-chelating domain-containing protein
1187 PPAX01000021.1 GCA002913265_00612 CDS open 42953-43660 _na     235_aa Methyltransferase small domain-containing protein
1188 PPAX01000021.1 GCA002913265_00613 CDS open 43657-45909 _na     750_aa Cell division initiation protein DivIVA
1189 PPAX01000021.1 GCA002913265_00614 CDS open 45906-46868 _na     320_aa ccoS Cbb3-type cytochrome oxidase assembly protein CcoS
1190 PPAX01000021.1 GCA002913265_00615 CDS open 46893-48233 _na     446_aa class II 3-deoxy-7-phosphoheptulonate synthase
1191 PPAX01000021.1 GCA002913265_00616 CDS open 48377-49264 _na     295_aa rarD EamA family transporter RarD
1192 PPAX01000021.1 GCA002913265_00617 CDS open 49305-50135 _na     276_aa rarD EamA family transporter RarD
1193 PPAX01000021.1 GCA002913265_00618 CDS open 50128-50580 _na     150_aa Aryl-sulfate sulfotransferase
1194 PPAX01000021.1 GCA002913265_00619 CDS open 50691-51746 _na     351_aa beta-N-acetylhexosaminidase
1195 PPAX01000021.1 GCA002913265_00620 CDS open 51743-52633 _na     296_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
1196 PPAX01000021.1 GCA002913265_00621 CDS open 52646-54067 _na     473_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
1197 PPAX01000021.1 GCA002913265_00622 CDS open 54231-54914 _na     227_aa atpB F0F1 ATP synthase subunit A
1198 PPAX01000021.1 GCA002913265_00623 CDS open 54980-55741 _na     253_aa putative membrane transporter protein
1199 PPAX01000021.1 GCA002913265_00624 CDS open 55886-56422 _na     178_aa Superoxide dismutase (Cu/Zn)
1200 PPAX01000021.1 GCA002913265_00625 CDS open 56489-57256 _na     255_aa TIGR02757 family protein
1201 PPAX01000021.1 GCA002913265_00626 CDS open 57253-59124 _na     623_aa flgK flagellar hook-associated protein FlgK
1202 PPAX01000021.1 GCA002913265_00627 CDS open 59128-59559 _na     143_aa flgN Flagellar protein FlgN
1203 PPAX01000021.1 GCA002913265_00628 CDS open 59576-59779 _na     67_aa flgM Anti-sigma-28 factor%2C FlgM
1204 PPAX01000021.1 GCA002913265_00629 CDS open 59838-60137 _na     99_aa flgJ Flagellar protein FlgJ N-terminal domain-containing protein
1205 PPAX01000021.1 GCA002913265_00630 CDS open 60137-61189 _na     350_aa Flagellar P-ring protein
1206 PPAX01000021.1 GCA002913265_00631 CDS open 61246-61812 _na     188_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1207 PPAX01000021.1 GCA002913265_00632 CDS open 61809-62153 _na     114_aa Ornithine carbamoyltransferase
1208 PPAX01000021.1 GCA002913265_00633 CDS open 62273-62668 _na     131_aa flaG FlaG family protein
1209 PPAX01000021.1 GCA002913265_00634 CDS open 62671-64431 _na     586_aa fliD flagellar filament capping protein FliD
1210 PPAX01000021.1 GCA002913265_00635 CDS open 64441-64812 _na     123_aa fliS flagellar export chaperone FliS
1211 PPAX01000021.1 GCA002913265_00636 CDS open 64805-65032 _na     75_aa hypothetical protein
1212 PPAX01000021.1 GCA002913265_00573 gene open 841-2697 htpG
1213 PPAX01000021.1 GCA002913265_00574 gene open 2835-3692 sdhE
1214 PPAX01000021.1 GCA002913265_00575 gene open 3695-4660 sdhB
1215 PPAX01000021.1 GCA002913265_00576 gene open 4670-6508 sdhA
1216 PPAX01000021.1 GCA002913265_00577 gene open 6941-7363
1217 PPAX01000021.1 GCA002913265_00578 gene open 7404-7955
1218 PPAX01000021.1 GCA002913265_00579 gene open 7952-8797
1219 PPAX01000021.1 GCA002913265_00580 gene open 8787-9917
1220 PPAX01000021.1 GCA002913265_00581 gene open 9914-10225
1221 PPAX01000021.1 GCA002913265_00582 gene open 10234-11127
1222 PPAX01000021.1 GCA002913265_00583 gene open 11131-13305
1223 PPAX01000021.1 GCA002913265_00584 gene open 13369-14313
1224 PPAX01000021.1 GCA002913265_00585 gene open 14333-16852
1225 PPAX01000021.1 GCA002913265_00586 gene open 17528-17869 hypA
1226 PPAX01000021.1 GCA002913265_00587 gene open 17869-18861 hypE
1227 PPAX01000021.1 GCA002913265_00588 gene open 18870-19958 hypD
1228 PPAX01000021.1 GCA002913265_00589 gene open 19958-20197 hypC
1229 PPAX01000021.1 GCA002913265_00590 gene open 20197-21009 hypB
1230 PPAX01000021.1 GCA002913265_00591 gene open 21133-21792
1231 PPAX01000021.1 GCA002913265_00592 gene open 21789-23051
1232 PPAX01000021.1 GCA002913265_00593 gene open 23413-23826 nikR
1233 PPAX01000021.1 GCA002913265_00594 gene open 23872-26097 hypF
1234 PPAX01000021.1 GCA002913265_00595 gene open 26081-27553 hydE
1235 PPAX01000021.1 GCA002913265_00596 gene open 27550-28092
1236 PPAX01000021.1 GCA002913265_00597 gene open 28092-28772 cybH
1237 PPAX01000021.1 GCA002913265_00598 gene open 28782-30500
1238 PPAX01000021.1 GCA002913265_00599 gene open 30510-31655
1239 PPAX01000021.1 GCA002913265_00600 gene open 31999-32706 flgH
1240 PPAX01000021.1 GCA002913265_00601 gene open 32773-34140 pta
1241 PPAX01000021.1 GCA002913265_00602 gene open 34142-35338 ackA
1242 PPAX01000021.1 GCA002913265_00603 gene open 35417-36370 lpxD
1243 PPAX01000021.1 GCA002913265_00604 gene open 36370-36837 ilvN
1244 PPAX01000021.1 GCA002913265_00605 gene open 36834-38531
1245 PPAX01000021.1 GCA002913265_00606 gene open 38685-38942
1246 PPAX01000021.1 GCA002913265_00607 gene open 39089-40096 mnmH
1247 PPAX01000021.1 GCA002913265_00608 gene open 40083-40568
1248 PPAX01000021.1 GCA002913265_00609 gene open 40568-41353 trpC
1249 PPAX01000021.1 GCA002913265_00610 gene open 41350-42612
1250 PPAX01000021.1 GCA002913265_00611 gene open 42591-42956
1251 PPAX01000021.1 GCA002913265_00612 gene open 42953-43660
1252 PPAX01000021.1 GCA002913265_00613 gene open 43657-45909
1253 PPAX01000021.1 GCA002913265_00614 gene open 45906-46868 ccoS
1254 PPAX01000021.1 GCA002913265_00615 gene open 46893-48233
1255 PPAX01000021.1 GCA002913265_00616 gene open 48377-49264 rarD
1256 PPAX01000021.1 GCA002913265_00617 gene open 49305-50135 rarD
1257 PPAX01000021.1 GCA002913265_00618 gene open 50128-50580
1258 PPAX01000021.1 GCA002913265_00619 gene open 50691-51746
1259 PPAX01000021.1 GCA002913265_00620 gene open 51743-52633
1260 PPAX01000021.1 GCA002913265_00621 gene open 52646-54067 gatB
1261 PPAX01000021.1 GCA002913265_00622 gene open 54231-54914 atpB
1262 PPAX01000021.1 GCA002913265_00623 gene open 54980-55741
1263 PPAX01000021.1 GCA002913265_00624 gene open 55886-56422
1264 PPAX01000021.1 GCA002913265_00625 gene open 56489-57256
1265 PPAX01000021.1 GCA002913265_00626 gene open 57253-59124 flgK
1266 PPAX01000021.1 GCA002913265_00627 gene open 59128-59559 flgN
1267 PPAX01000021.1 GCA002913265_00628 gene open 59576-59779 flgM
1268 PPAX01000021.1 GCA002913265_00629 gene open 59838-60137 flgJ
1269 PPAX01000021.1 GCA002913265_00630 gene open 60137-61189
1270 PPAX01000021.1 GCA002913265_00631 gene open 61246-61812 rsmD
1271 PPAX01000021.1 GCA002913265_00632 gene open 61809-62153
1272 PPAX01000021.1 GCA002913265_00633 gene open 62273-62668 flaG
1273 PPAX01000021.1 GCA002913265_00634 gene open 62671-64431 fliD
1274 PPAX01000021.1 GCA002913265_00635 gene open 64441-64812 fliS
1275 PPAX01000021.1 GCA002913265_00636 gene open 64805-65032
1276 PPAX01000022.1 GCA002913265_00638 CDS open 925-2859 _na     644_aa metG methionine--tRNA ligase
1277 PPAX01000022.1 GCA002913265_00639 CDS open 2876-3094 _na     72_aa Uracil-DNA glycosylase
1278 PPAX01000022.1 GCA002913265_00640 CDS open 3094-3957 _na     287_aa fbp class 1 fructose-bisphosphatase
1279 PPAX01000022.1 GCA002913265_00641 CDS open 3957-4436 _na     159_aa mobB molybdopterin-guanine dinucleotide biosynthesis protein B
1280 PPAX01000022.1 GCA002913265_00642 CDS open 4558-5037 _na     159_aa Lipoprotein
1281 PPAX01000022.1 GCA002913265_00643 CDS open 4958-6595 _na     545_aa Soluble lytic murein transglycosylase
1282 PPAX01000022.1 GCA002913265_00644 CDS open 6573-6866 _na     97_aa Membrane protein%2C YGGT family
1283 PPAX01000022.1 GCA002913265_00645 CDS open 6875-8170 _na     431_aa gltX glutamate--tRNA ligase
1284 PPAX01000022.1 GCA002913265_00646 CDS open 8317-8724 _na     135_aa mscL large-conductance mechanosensitive channel protein MscL
1285 PPAX01000022.1 GCA002913265_00647 CDS open 8823-9461 _na     212_aa Cyclic nucleotide-binding domain-containing protein
1286 PPAX01000022.1 GCA002913265_00648 CDS open 9582-10154 _na     190_aa Cytochrome c-type protein
1287 PPAX01000022.1 GCA002913265_00649 CDS open 10164-11534 _na     456_aa Cytochrome c-552/4 domain-containing protein
1288 PPAX01000022.1 GCA002913265_00650 CDS open 11754-12866 _na     370_aa Calcineurin-like phosphoesterase domain-containing protein
1289 PPAX01000022.1 GCA002913265_00651 CDS open 12868-13665 _na     265_aa phosphatidylserine decarboxylase
1290 PPAX01000022.1 GCA002913265_00652 CDS open 13702-14805 _na     367_aa ychF redox-regulated ATPase YchF
1291 PPAX01000022.1 GCA002913265_00653 CDS open 14805-16256 _na     483_aa leucyl aminopeptidase
1292 PPAX01000022.1 GCA002913265_00654 CDS open 16237-16842 _na     201_aa VTT domain-containing protein
1293 PPAX01000022.1 GCA002913265_00655 CDS open 16844-17392 _na     182_aa apt adenine phosphoribosyltransferase
1294 PPAX01000022.1 GCA002913265_00656 CDS open 17413-17745 _na     110_aa Periplasmic protein
1295 PPAX01000022.1 GCA002913265_00657 CDS open 17742-18185 _na     147_aa rpiB ribose 5-phosphate isomerase B
1296 PPAX01000022.1 GCA002913265_00658 CDS open 18295-19680 _na     461_aa DUF4139 domain-containing protein
1297 PPAX01000022.1 GCA002913265_00659 CDS open 19699-20355 _na     218_aa Peptidase M50 domain-containing protein
1298 PPAX01000022.1 GCA002913265_00660 CDS open 20342-21247 _na     301_aa lepB signal peptidase I
1299 PPAX01000022.1 GCA002913265_00661 CDS open 21259-22110 _na     283_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
1300 PPAX01000022.1 GCA002913265_00662 CDS open 22194-22814 _na     206_aa Cytochrome c domain-containing protein
1301 PPAX01000022.1 GCA002913265_00663 CDS open 22811-24094 _na     427_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1302 PPAX01000022.1 GCA002913265_00664 CDS open 24094-24375 _na     93_aa AtpZ/AtpI family protein
1303 PPAX01000022.1 GCA002913265_00665 CDS open 24356-24877 _na     173_aa Integral membrane protein
1304 PPAX01000022.1 GCA002913265_00666 CDS open 24867-26111 _na     414_aa Major facilitator superfamily (MFS) profile domain-containing protein
1305 PPAX01000022.1 GCA002913265_00667 CDS open 26115-27761 _na     548_aa Flagellar hook-length control protein-like C-terminal domain-containing protein
1306 PPAX01000022.1 GCA002913265_00668 CDS open 27761-28027 _na     88_aa flhB FlhB C-terminus-related protein
1307 PPAX01000022.1 GCA002913265_00669 CDS open 28148-28714 _na     188_aa protein-glutamate methylesterase
1308 PPAX01000022.1 GCA002913265_00670 CDS open 28704-29528 _na     274_aa CheR-type methyltransferase domain-containing protein
1309 PPAX01000022.1 GCA002913265_00671 CDS open 29572-30768 _na     398_aa H+ antiporter protein%2C major facilitator superfamily
1310 PPAX01000022.1 GCA002913265_00672 CDS open 30770-31975 _na     401_aa nlpE NlpE C-terminal OB domain-containing protein
1311 PPAX01000022.1 GCA002913265_00673 CDS open 32024-32452 _na     142_aa nlpE Lipoprotein NlpE
1312 PPAX01000022.1 GCA002913265_00674 CDS open 32533-33447 _na     304_aa ybbK Stomatin/prohibitin-family membrane protease subunit YbbK
1313 PPAX01000022.1 GCA002913265_00675 CDS open 33444-33836 _na     130_aa NfeD-like C-terminal domain-containing protein
1314 PPAX01000022.1 GCA002913265_00676 CDS open 33857-34069 _na     70_aa Lipoprotein
1315 PPAX01000022.1 GCA002913265_00677 CDS open 34202-35248 _na     348_aa dehypoxanthine futalosine cyclase
1316 PPAX01000022.1 GCA002913265_00678 CDS open 35249-36478 _na     409_aa Peptidase M16 C-terminal domain-containing protein
1317 PPAX01000022.1 GCA002913265_00679 CDS open 36468-38282 _na     604_aa recG ATP-dependent DNA helicase RecG
1318 PPAX01000022.1 GCA002913265_00680 CDS open 38286-38492 _na     68_aa Transcriptional regulator
1319 PPAX01000022.1 GCA002913265_00681 CDS open 38653-39393 _na     246_aa DUF3944 domain-containing protein
1320 PPAX01000022.1 GCA002913265_00682 CDS open 39438-40211 _na     257_aa ABC transporter%2C ATP-binding protein
1321 PPAX01000022.1 GCA002913265_00683 CDS open 40211-41218 _na     335_aa ABC transporter%2C permease protein
1322 PPAX01000022.1 GCA002913265_00684 CDS open 41222-42277 _na     351_aa Fe/B12 periplasmic-binding domain-containing protein
1323 PPAX01000022.1 GCA002913265_00685 CDS open 42496-44727 _na     743_aa Nitric oxide reductase%2C monomeric type
1324 PPAX01000022.1 GCA002913265_00686 CDS open 44799-45347 _na     182_aa DUF1523 domain-containing protein
1325 PPAX01000022.1 GCA002913265_00687 CDS open 45389-45916 _na     175_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1326 PPAX01000022.1 GCA002913265_00688 CDS open 45997-46443 _na     148_aa Type II secretion system protein
1327 PPAX01000022.1 GCA002913265_00689 CDS open 46419-47441 _na     340_aa Type II secretion system protein
1328 PPAX01000022.1 GCA002913265_00690 CDS open 47438-48163 _na     241_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
1329 PPAX01000022.1 GCA002913265_00691 CDS open 48157-52161 _na     1334_aa Lipoprotein
1330 PPAX01000022.1 GCA002913265_00692 CDS open 52342-56538 _na     1398_aa Internalin
1331 PPAX01000022.1 GCA002913265_00693 CDS open 56594-56977 _na     127_aa fliW flagellar assembly protein FliW
1332 PPAX01000022.1 GCA002913265_00694 CDS open 57090-57737 _na     215_aa bamD Outer membrane protein assembly factor BamD
1333 PPAX01000022.1 GCA002913265_00695 CDS open 57746-60163 _na     805_aa lon endopeptidase La
1334 PPAX01000022.1 GCA002913265_00696 CDS open 60455-60913 _na     152_aa Methylated-DNA--protein-cysteine methyltransferase
1335 PPAX01000022.1 GCA002913265_00697 CDS open 61006-63591 _na     861_aa bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
1336 PPAX01000022.1 GCA002913265_00698 CDS open 63628-64839 _na     403_aa Ankyrin repeat domain-containing protein
1337 PPAX01000022.1 GCA002913265_00699 CDS open 64848-65594 _na     248_aa Oxidoreductase
1338 PPAX01000022.1 GCA002913265_00700 CDS open 65604-67307 _na     567_aa Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
1339 PPAX01000022.1 GCA002913265_00701 CDS open 67310-68419 _na     369_aa trmA tRNA (uridine(54)-C5)-methyltransferase TrmA
1340 PPAX01000022.1 GCA002913265_00702 CDS open 68434-69645 _na     403_aa ilvA threonine ammonia-lyase
1341 PPAX01000022.1 GCA002913265_00703 CDS open 69688-72879 _na     1063_aa Autotransporter domain-containing protein
1342 PPAX01000022.1 GCA002913265_00704 CDS open 73177-74010 _na     277_aa Metallo-beta-lactamase domain-containing protein
1343 PPAX01000022.1 GCA002913265_00705 CDS open 74068-74763 _na     231_aa DUF4230 domain-containing protein
1344 PPAX01000022.1 GCA002913265_00706 CDS open 74787-75710 _na     307_aa Dyp-type peroxidase family protein
1345 PPAX01000022.1 GCA002913265_00707 CDS open 75762-76184 _na     140_aa eamA EamA domain-containing protein
1346 PPAX01000022.1 GCA002913265_00708 CDS open 76282-76857 _na     191_aa Molybdopterin-containing oxidoreductase II%2C DMSO/TMAO/BSO reductase family%2C monoheme c-type cytochrome
1347 PPAX01000022.1 GCA002913265_00709 CDS open 76867-79434 _na     855_aa Anaerobic dimethyl sulfoxide reductase chain A
1348 PPAX01000022.1 GCA002913265_00710 CDS open 79566-79661 _na     31_aa hypothetical protein
1349 PPAX01000022.1 GCA002913265_00638 gene open 925-2859 metG
1350 PPAX01000022.1 GCA002913265_00639 gene open 2876-3094
1351 PPAX01000022.1 GCA002913265_00640 gene open 3094-3957 fbp
1352 PPAX01000022.1 GCA002913265_00641 gene open 3957-4436 mobB
1353 PPAX01000022.1 GCA002913265_00642 gene open 4558-5037
1354 PPAX01000022.1 GCA002913265_00643 gene open 4958-6595
1355 PPAX01000022.1 GCA002913265_00644 gene open 6573-6866
1356 PPAX01000022.1 GCA002913265_00645 gene open 6875-8170 gltX
1357 PPAX01000022.1 GCA002913265_00646 gene open 8317-8724 mscL
1358 PPAX01000022.1 GCA002913265_00647 gene open 8823-9461
1359 PPAX01000022.1 GCA002913265_00648 gene open 9582-10154
1360 PPAX01000022.1 GCA002913265_00649 gene open 10164-11534
1361 PPAX01000022.1 GCA002913265_00650 gene open 11754-12866
1362 PPAX01000022.1 GCA002913265_00651 gene open 12868-13665
1363 PPAX01000022.1 GCA002913265_00652 gene open 13702-14805 ychF
1364 PPAX01000022.1 GCA002913265_00653 gene open 14805-16256
1365 PPAX01000022.1 GCA002913265_00654 gene open 16237-16842
1366 PPAX01000022.1 GCA002913265_00655 gene open 16844-17392 apt
1367 PPAX01000022.1 GCA002913265_00656 gene open 17413-17745
1368 PPAX01000022.1 GCA002913265_00657 gene open 17742-18185 rpiB
1369 PPAX01000022.1 GCA002913265_00658 gene open 18295-19680
1370 PPAX01000022.1 GCA002913265_00659 gene open 19699-20355
1371 PPAX01000022.1 GCA002913265_00660 gene open 20342-21247 lepB
1372 PPAX01000022.1 GCA002913265_00661 gene open 21259-22110 folD
1373 PPAX01000022.1 GCA002913265_00662 gene open 22194-22814
1374 PPAX01000022.1 GCA002913265_00663 gene open 22811-24094 hemL
1375 PPAX01000022.1 GCA002913265_00664 gene open 24094-24375
1376 PPAX01000022.1 GCA002913265_00665 gene open 24356-24877
1377 PPAX01000022.1 GCA002913265_00666 gene open 24867-26111
1378 PPAX01000022.1 GCA002913265_00667 gene open 26115-27761
1379 PPAX01000022.1 GCA002913265_00668 gene open 27761-28027 flhB
1380 PPAX01000022.1 GCA002913265_00669 gene open 28148-28714
1381 PPAX01000022.1 GCA002913265_00670 gene open 28704-29528
1382 PPAX01000022.1 GCA002913265_00671 gene open 29572-30768
1383 PPAX01000022.1 GCA002913265_00672 gene open 30770-31975 nlpE
1384 PPAX01000022.1 GCA002913265_00673 gene open 32024-32452 nlpE
1385 PPAX01000022.1 GCA002913265_00674 gene open 32533-33447 ybbK
1386 PPAX01000022.1 GCA002913265_00675 gene open 33444-33836
1387 PPAX01000022.1 GCA002913265_00676 gene open 33857-34069
1388 PPAX01000022.1 GCA002913265_00677 gene open 34202-35248
1389 PPAX01000022.1 GCA002913265_00678 gene open 35249-36478
1390 PPAX01000022.1 GCA002913265_00679 gene open 36468-38282 recG
1391 PPAX01000022.1 GCA002913265_00680 gene open 38286-38492
1392 PPAX01000022.1 GCA002913265_00681 gene open 38653-39393
1393 PPAX01000022.1 GCA002913265_00682 gene open 39438-40211
1394 PPAX01000022.1 GCA002913265_00683 gene open 40211-41218
1395 PPAX01000022.1 GCA002913265_00684 gene open 41222-42277
1396 PPAX01000022.1 GCA002913265_00685 gene open 42496-44727
1397 PPAX01000022.1 GCA002913265_00686 gene open 44799-45347
1398 PPAX01000022.1 GCA002913265_00687 gene open 45389-45916 hpf
1399 PPAX01000022.1 GCA002913265_00688 gene open 45997-46443
1400 PPAX01000022.1 GCA002913265_00689 gene open 46419-47441
1401 PPAX01000022.1 GCA002913265_00690 gene open 47438-48163
1402 PPAX01000022.1 GCA002913265_00691 gene open 48157-52161
1403 PPAX01000022.1 GCA002913265_00692 gene open 52342-56538
1404 PPAX01000022.1 GCA002913265_00693 gene open 56594-56977 fliW
1405 PPAX01000022.1 GCA002913265_00694 gene open 57090-57737 bamD
1406 PPAX01000022.1 GCA002913265_00695 gene open 57746-60163 lon
1407 PPAX01000022.1 GCA002913265_00696 gene open 60455-60913
1408 PPAX01000022.1 GCA002913265_00697 gene open 61006-63591
1409 PPAX01000022.1 GCA002913265_00698 gene open 63628-64839
1410 PPAX01000022.1 GCA002913265_00699 gene open 64848-65594
1411 PPAX01000022.1 GCA002913265_00700 gene open 65604-67307
1412 PPAX01000022.1 GCA002913265_00701 gene open 67310-68419 trmA
1413 PPAX01000022.1 GCA002913265_00702 gene open 68434-69645 ilvA
1414 PPAX01000022.1 GCA002913265_00703 gene open 69688-72879
1415 PPAX01000022.1 GCA002913265_00704 gene open 73177-74010
1416 PPAX01000022.1 GCA002913265_00705 gene open 74068-74763
1417 PPAX01000022.1 GCA002913265_00706 gene open 74787-75710
1418 PPAX01000022.1 GCA002913265_00707 gene open 75762-76184 eamA
1419 PPAX01000022.1 GCA002913265_00708 gene open 76282-76857
1420 PPAX01000022.1 GCA002913265_00709 gene open 76867-79434
1421 PPAX01000022.1 GCA002913265_00710 gene open 79566-79661
1422 PPAX01000023.1 repeat_region open 8786-12455 CRISPR array with 56 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 36
1423 PPAX01000023.1 GCA002913265_00712 CDS open 336-1028 _na     230_aa CRISPR associated protein Cas6 C-terminal domain-containing protein
1424 PPAX01000023.1 GCA002913265_00713 CDS open 1199-2965 _na     588_aa CRISPR/Cas system-associated protein Cas8%2C type I-B/HMARI
1425 PPAX01000023.1 GCA002913265_00714 CDS open 2976-3917 _na     313_aa cas7b type I-B CRISPR-associated protein Cas7/Csh2
1426 PPAX01000023.1 GCA002913265_00715 CDS open 3919-4629 _na     236_aa CRISPR/Cas system-associated RAMP protein Cas5%2C type I-B/HMARI
1427 PPAX01000023.1 GCA002913265_00716 CDS open 4604-6805 _na     733_aa CRISPR/Cas system-associated endonuclease/helicase Cas3%2C type I-B/HMARI
1428 PPAX01000023.1 GCA002913265_00717 CDS open 6805-7182 _na     125_aa CRISPR-associated protein Cas4
1429 PPAX01000023.1 GCA002913265_00718 CDS open 7348-7626 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
1430 PPAX01000023.1 GCA002913265_00719 CDS open 7636-8646 _na     336_aa cas1 CRISPR-associated endonuclease Cas1
1431 PPAX01000023.1 GCA002913265_00720 CDS open 12653-12913 _na     86_aa rpsR 30S ribosomal protein S18
1432 PPAX01000023.1 GCA002913265_00721 CDS open 12931-13485 _na     184_aa single-stranded DNA-binding protein
1433 PPAX01000023.1 GCA002913265_00722 CDS open 13499-13918 _na     139_aa rpsF 30S ribosomal protein S6
1434 PPAX01000023.1 GCA002913265_00723 CDS open 13996-14994 _na     332_aa holA DNA polymerase III subunit delta
1435 PPAX01000023.1 GCA002913265_00724 CDS open 14987-16906 _na     639_aa exoribonuclease II
1436 PPAX01000023.1 GCA002913265_00725 CDS open 16903-17721 _na     272_aa HDOD domain-containing protein
1437 PPAX01000023.1 GCA002913265_00726 CDS open 17863-18885 _na     340_aa ilvC ketol-acid reductoisomerase
1438 PPAX01000023.1 GCA002913265_00727 CDS open 18889-20337 _na     482_aa Divergent polysaccharide deacetylase
1439 PPAX01000023.1 GCA002913265_00728 CDS open 20334-21104 _na     256_aa dprA DNA-processing protein DprA
1440 PPAX01000023.1 GCA002913265_00729 CDS open 21116-21484 _na     122_aa ruvX Holliday junction resolvase RuvX
1441 PPAX01000023.1 GCA002913265_00712 gene open 336-1028
1442 PPAX01000023.1 GCA002913265_00713 gene open 1199-2965
1443 PPAX01000023.1 GCA002913265_00714 gene open 2976-3917 cas7b
1444 PPAX01000023.1 GCA002913265_00715 gene open 3919-4629
1445 PPAX01000023.1 GCA002913265_00716 gene open 4604-6805
1446 PPAX01000023.1 GCA002913265_00717 gene open 6805-7182
1447 PPAX01000023.1 GCA002913265_00718 gene open 7348-7626 cas2
1448 PPAX01000023.1 GCA002913265_00719 gene open 7636-8646 cas1
1449 PPAX01000023.1 GCA002913265_00720 gene open 12653-12913 rpsR
1450 PPAX01000023.1 GCA002913265_00721 gene open 12931-13485
1451 PPAX01000023.1 GCA002913265_00722 gene open 13499-13918 rpsF
1452 PPAX01000023.1 GCA002913265_00723 gene open 13996-14994 holA
1453 PPAX01000023.1 GCA002913265_00724 gene open 14987-16906
1454 PPAX01000023.1 GCA002913265_00725 gene open 16903-17721
1455 PPAX01000023.1 GCA002913265_00726 gene open 17863-18885 ilvC
1456 PPAX01000023.1 GCA002913265_00727 gene open 18889-20337
1457 PPAX01000023.1 GCA002913265_00728 gene open 20334-21104 dprA
1458 PPAX01000023.1 GCA002913265_00729 gene open 21116-21484 ruvX
1459 PPAX01000023.1 GCA002913265_00711 gene open 50-125 trnK
1460 PPAX01000023.1 GCA002913265_00711 tRNA open 50-125 trnK tRNA-Lys(ttt)
1461 PPAX01000025.1 GCA002913265_00730 CDS open 60-1250 _na     396_aa nifS NifS family cysteine desulfurase
1462 PPAX01000025.1 GCA002913265_00731 CDS open 1267-2259 _na     330_aa nifU Nitrogen fixation protein NifU
1463 PPAX01000025.1 GCA002913265_00732 CDS open 2341-3216 _na     291_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1464 PPAX01000025.1 GCA002913265_00733 CDS open 3219-4433 _na     404_aa D-amino acid dehydrogenase small subunit
1465 PPAX01000025.1 GCA002913265_00734 CDS open 4536-5396 _na     286_aa mqnP menaquinone biosynthesis prenyltransferase MqnP
1466 PPAX01000025.1 GCA002913265_00735 CDS open 5393-5914 _na     173_aa hypothetical protein
1467 PPAX01000025.1 GCA002913265_00736 CDS open 5924-6430 _na     168_aa Periplasmic protein
1468 PPAX01000025.1 GCA002913265_00737 CDS open 6564-7532 _na     322_aa moaA GTP 3'%2C8-cyclase MoaA
1469 PPAX01000025.1 GCA002913265_00738 CDS open 7532-8287 _na     251_aa 7-carboxy-7-deazaguanine synthase
1470 PPAX01000025.1 GCA002913265_00739 CDS open 8287-8868 _na     193_aa 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase
1471 PPAX01000025.1 GCA002913265_00740 CDS open 8868-9071 _na     67_aa Lipoprotein
1472 PPAX01000025.1 GCA002913265_00741 CDS open 9068-9469 _na     133_aa Integral membrane protein
1473 PPAX01000025.1 GCA002913265_00742 CDS open 9470-10126 _na     218_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
1474 PPAX01000025.1 GCA002913265_00743 CDS open 10208-10408 _na     66_aa rpmE 50S ribosomal protein L31
1475 PPAX01000025.1 GCA002913265_00744 CDS open 10412-11227 _na     271_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
1476 PPAX01000025.1 GCA002913265_00745 CDS open 11328-12008 _na     226_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
1477 PPAX01000025.1 GCA002913265_00746 CDS open 12001-12942 _na     313_aa Phosphatidylglycerophosphate synthase
1478 PPAX01000025.1 GCA002913265_00747 CDS open 12936-13718 _na     260_aa Periplasmic protein
1479 PPAX01000025.1 GCA002913265_00748 CDS open 13728-14936 _na     402_aa LL-diaminopimelate aminotransferase
1480 PPAX01000025.1 GCA002913265_00749 CDS open 14933-16195 _na     420_aa Homoserine dehydrogenase
1481 PPAX01000025.1 GCA002913265_00750 CDS open 16197-16538 _na     113_aa yraN YraN family protein
1482 PPAX01000025.1 GCA002913265_00751 CDS open 16612-16926 _na     104_aa trxA thioredoxin
1483 PPAX01000025.1 GCA002913265_00752 CDS open 16926-17372 _na     148_aa fliL Flagellar protein FliL
1484 PPAX01000025.1 GCA002913265_00753 CDS open 17382-18320 _na     312_aa Thioredoxin reductase
1485 PPAX01000025.1 GCA002913265_00754 CDS open 18727-19497 _na     256_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
1486 PPAX01000025.1 GCA002913265_00755 CDS open 19769-21106 _na     445_aa purF amidophosphoribosyltransferase
1487 PPAX01000025.1 GCA002913265_00756 CDS open 21103-21765 _na     220_aa Lipoprotein
1488 PPAX01000025.1 GCA002913265_00757 CDS open 22180-22731 _na     183_aa DUF2393 domain-containing protein
1489 PPAX01000025.1 GCA002913265_00758 CDS open 22731-23261 _na     176_aa Integral membrane protein
1490 PPAX01000025.1 GCA002913265_00759 CDS open 23251-23985 _na     244_aa hisIE bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE
1491 PPAX01000025.1 GCA002913265_00760 CDS open 23988-25100 _na     370_aa Band 7 domain-containing protein
1492 PPAX01000025.1 GCA002913265_00761 CDS open 25117-26031 _na     304_aa branched-chain amino acid transaminase
1493 PPAX01000025.1 GCA002913265_00762 CDS open 26132-26773 _na     213_aa dsbA Thiol:disulfide interchange protein DsbA
1494 PPAX01000025.1 GCA002913265_00763 CDS open 26783-27280 _na     165_aa bcp thioredoxin-dependent thiol peroxidase
1495 PPAX01000025.1 GCA002913265_00764 CDS open 27277-27480 _na     67_aa Tautomerase
1496 PPAX01000025.1 GCA002913265_00765 CDS open 27595-27999 _na     134_aa 50S ribosomal protein L20
1497 PPAX01000025.1 GCA002913265_00766 CDS open 27996-31331 _na     1111_aa Diaminopimelate epimerase
1498 PPAX01000025.1 GCA002913265_00767 CDS open 31507-33039 _na     510_aa Solute-binding protein family 5 domain-containing protein
1499 PPAX01000025.1 GCA002913265_00768 CDS open 33052-33990 _na     312_aa ABC transmembrane type-1 domain-containing protein
1500 PPAX01000025.1 GCA002913265_00769 CDS open 33987-34787 _na     266_aa ABC transmembrane type-1 domain-containing protein