HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_002913385.1)

Select a Genome:
BAKTA Annotations for GCA_002913385.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
69 1866885 1796 3 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3684 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3684 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 PPBH01000013.1 GCA002913385_00467 gene open 50345-51409
1002 PPBH01000013.1 GCA002913385_00468 gene open 51406-51954 pth
1003 PPBH01000013.1 GCA002913385_00469 gene open 51966-52502
1004 PPBH01000013.1 GCA002913385_00470 gene open 52570-53730
1005 PPBH01000013.1 GCA002913385_00471 gene open 53730-54722
1006 PPBH01000013.1 GCA002913385_00472 gene open 54727-55353 serB
1007 PPBH01000013.1 GCA002913385_00473 gene open 55362-55859 cheW
1008 PPBH01000013.1 GCA002913385_00474 gene open 55870-58221
1009 PPBH01000013.1 GCA002913385_00475 gene open 58230-59183
1010 PPBH01000013.1 GCA002913385_00476 gene open 59183-59974
1011 PPBH01000013.1 GCA002913385_00477 gene open 60037-60522 greA
1012 PPBH01000013.1 GCA002913385_00478 gene open 60526-61560 lpxB
1013 PPBH01000013.1 GCA002913385_00479 gene open 61663-62439 surE
1014 PPBH01000013.1 GCA002913385_00480 gene open 62429-63085
1015 PPBH01000013.1 GCA002913385_00481 gene open 63955-64548
1016 PPBH01000013.1 GCA002913385_00482 gene open 64573-65139 efp
1017 PPBH01000013.1 GCA002913385_00483 gene open 65161-66738 serA
1018 PPBH01000013.1 GCA002913385_00484 gene open 66735-67217
1019 PPBH01000013.1 GCA002913385_00485 gene open 67223-68899
1020 PPBH01000013.1 GCA002913385_00486 gene open 68980-69804 ispH
1021 PPBH01000013.1 GCA002913385_00487 gene open 69785-71071 aroA
1022 PPBH01000013.1 GCA002913385_00488 gene open 71068-73404 pheT
1023 PPBH01000013.1 GCA002913385_00489 gene open 73401-74396 pheS
1024 PPBH01000013.1 GCA002913385_00490 gene open 74515-74868
1025 PPBH01000013.1 GCA002913385_00491 gene open 74927-77806
1026 PPBH01000013.1 GCA002913385_00492 gene open 77796-78530
1027 PPBH01000013.1 GCA002913385_00493 gene open 78527-80344 uvrC
1028 PPBH01000013.1 GCA002913385_00494 gene open 80386-80856
1029 PPBH01000013.1 GCA002913385_00495 gene open 81102-82490 nhaD
1030 PPBH01000013.1 GCA002913385_00496 gene open 82501-84033 guaA
1031 PPBH01000013.1 GCA002913385_00497 gene open 84073-85224
1032 PPBH01000013.1 GCA002913385_00498 gene open 85227-87341
1033 PPBH01000013.1 GCA002913385_00499 gene open 87597-88397
1034 PPBH01000013.1 GCA002913385_00500 gene open 88399-89511
1035 PPBH01000013.1 GCA002913385_00501 gene open 89732-91102
1036 PPBH01000013.1 GCA002913385_00502 gene open 91112-91684
1037 PPBH01000013.1 GCA002913385_00503 gene open 91805-92443
1038 PPBH01000013.1 GCA002913385_00504 gene open 92542-92949 mscL
1039 PPBH01000013.1 GCA002913385_00505 gene open 93097-94392 gltX
1040 PPBH01000013.1 GCA002913385_00506 gene open 94401-94694
1041 PPBH01000013.1 GCA002913385_00507 gene open 94672-96309
1042 PPBH01000013.1 GCA002913385_00508 gene open 96230-96709
1043 PPBH01000013.1 GCA002913385_00509 gene open 96831-97310 mobB
1044 PPBH01000013.1 GCA002913385_00510 gene open 97310-98173 fbp
1045 PPBH01000013.1 GCA002913385_00511 gene open 98173-98391
1046 PPBH01000013.1 GCA002913385_00512 gene open 98407-100338 metG
1047 PPBH01000013.1 GCA002913385_00513 gene open 100339-101316
1048 PPBH01000013.1 GCA002913385_00514 gene open 101350-102678 hcp
1049 PPBH01000013.1 GCA002913385_00515 gene open 102899-103543
1050 PPBH01000013.1 GCA002913385_00516 gene open 103600-104265 queC
1051 PPBH01000013.1 GCA002913385_00517 gene open 104323-104760 ybeY
1052 PPBH01000013.1 GCA002913385_00518 gene open 104774-105328
1053 PPBH01000013.1 GCA002913385_00519 gene open 105400-107631
1054 PPBH01000013.1 GCA002913385_00520 gene open 107850-108905
1055 PPBH01000013.1 GCA002913385_00521 gene open 108909-109916
1056 PPBH01000013.1 GCA002913385_00522 gene open 109916-110689
1057 PPBH01000013.1 GCA002913385_00523 gene open 110801-111124
1058 PPBH01000013.1 GCA002913385_00524 gene open 111515-113329 recG
1059 PPBH01000013.1 GCA002913385_00525 gene open 113319-114548
1060 PPBH01000013.1 GCA002913385_00526 gene open 114549-115595
1061 PPBH01000013.1 GCA002913385_00527 gene open 115728-115940
1062 PPBH01000013.1 GCA002913385_00528 gene open 115961-116353
1063 PPBH01000013.1 GCA002913385_00529 gene open 116350-117264 ybbK
1064 PPBH01000013.1 GCA002913385_00530 gene open 117344-117772 nlpE
1065 PPBH01000013.1 GCA002913385_00531 gene open 117821-119026 nlpE
1066 PPBH01000013.1 GCA002913385_00532 gene open 119028-120224
1067 PPBH01000013.1 GCA002913385_00533 gene open 120265-121347
1068 PPBH01000013.1 GCA002913385_00534 gene open 121425-122144
1069 PPBH01000014.1 repeat_region open 4851-6983 CRISPR array with 28 repeats of length 33%2C consensus sequence GTTTCAATCCCCTAGATCGGGGAAATTTGTATC and spacer length 44
1070 PPBH01000014.1 repeat_region open 27723-28703 CRISPR array with 13 repeats of length 37%2C consensus sequence ATTTAAACAAATTTGACCCGATCAAGGGGATTGAAAC and spacer length 38
1071 PPBH01000014.1 GCA002913385_00535 CDS open 355-1356 _na     333_aa Transcriptional regulator
1072 PPBH01000014.1 GCA002913385_00536 CDS open 1356-1736 _na     126_aa csx20 CRISPR-associated protein Csx20
1073 PPBH01000014.1 GCA002913385_00537 CDS open 1733-2980 _na     415_aa CRISPR-associated DxTHG motif protein
1074 PPBH01000014.1 GCA002913385_00538 CDS open 2984-3778 _na     264_aa CRISPR-associated protein
1075 PPBH01000014.1 GCA002913385_00539 CDS open 3926-4594 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
1076 PPBH01000014.1 GCA002913385_00540 CDS open 7319-8062 _na     247_aa reverse transcriptase domain-containing protein
1077 PPBH01000014.1 GCA002913385_00541 CDS open 8125-8937 _na     270_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
1078 PPBH01000014.1 GCA002913385_00542 CDS open 9294-9893 _na     199_aa DUF4359 domain-containing protein
1079 PPBH01000014.1 GCA002913385_00543 CDS open 9988-10374 _na     128_aa hypothetical protein
1080 PPBH01000014.1 GCA002913385_00544 CDS open 10502-12184 _na     560_aa Lactate permease
1081 PPBH01000014.1 GCA002913385_00545 CDS open 12189-13001 _na     270_aa hypothetical protein
1082 PPBH01000014.1 GCA002913385_00546 CDS open 13176-14048 _na     290_aa Putative transcriptional regulator
1083 PPBH01000014.1 GCA002913385_00547 CDS open 14587-14889 _na     100_aa hypothetical protein
1084 PPBH01000014.1 GCA002913385_00548 CDS open 14867-15412 _na     181_aa Chemotaxis protein
1085 PPBH01000014.1 GCA002913385_00549 CDS open 15565-15927 _na     120_aa Nuclease-associated modular DNA-binding 1 domain-containing protein
1086 PPBH01000014.1 GCA002913385_00550 CDS open 15917-18367 _na     816_aa Aminotransferase
1087 PPBH01000014.1 GCA002913385_00551 CDS open 18748-19785 _na     345_aa CRISPR system Cms protein Csm5
1088 PPBH01000014.1 GCA002913385_00552 CDS open 19775-20662 _na     295_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
1089 PPBH01000014.1 GCA002913385_00553 CDS open 20662-21300 _na     212_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
1090 PPBH01000014.1 GCA002913385_00554 CDS open 21310-21720 _na     136_aa CRISPR system Cms protein Csm2
1091 PPBH01000014.1 GCA002913385_00555 CDS open 21717-23225 _na     502_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
1092 PPBH01000014.1 GCA002913385_00556 CDS open 23212-24048 _na     278_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
1093 PPBH01000014.1 GCA002913385_00557 CDS open 24029-24196 _na     55_aa hypothetical protein
1094 PPBH01000014.1 GCA002913385_00558 CDS open 24769-27003 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
1095 PPBH01000014.1 GCA002913385_00559 CDS open 27003-27278 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
1096 PPBH01000014.1 GCA002913385_00560 CDS open 29179-30138 _na     319_aa WYL domain-containing protein
1097 PPBH01000014.1 GCA002913385_00561 CDS open 30135-30818 _na     227_aa Macro domain-containing protein
1098 PPBH01000014.1 GCA002913385_00562 CDS open 30827-31447 _na     206_aa DUF4433 domain-containing protein
1099 PPBH01000014.1 GCA002913385_00563 CDS open 31517-32839 _na     440_aa CRISPR-associated DxTHG motif protein
1100 PPBH01000014.1 GCA002913385_00564 CDS open 32934-33308 _na     124_aa csx20 CRISPR-associated protein Csx20
1101 PPBH01000014.1 GCA002913385_00565 CDS open 33475-33612 _na     45_aa hypothetical protein
1102 PPBH01000014.1 GCA002913385_00566 CDS open 33728-33847 _na     39_aa hypothetical protein
1103 PPBH01000014.1 GCA002913385_00567 CDS open 33857-35038 _na     393_aa AAA+ ATPase domain-containing protein
1104 PPBH01000014.1 GCA002913385_00535 gene open 355-1356
1105 PPBH01000014.1 GCA002913385_00536 gene open 1356-1736 csx20
1106 PPBH01000014.1 GCA002913385_00537 gene open 1733-2980
1107 PPBH01000014.1 GCA002913385_00538 gene open 2984-3778
1108 PPBH01000014.1 GCA002913385_00539 gene open 3926-4594
1109 PPBH01000014.1 GCA002913385_00540 gene open 7319-8062
1110 PPBH01000014.1 GCA002913385_00541 gene open 8125-8937
1111 PPBH01000014.1 GCA002913385_00542 gene open 9294-9893
1112 PPBH01000014.1 GCA002913385_00543 gene open 9988-10374
1113 PPBH01000014.1 GCA002913385_00544 gene open 10502-12184
1114 PPBH01000014.1 GCA002913385_00545 gene open 12189-13001
1115 PPBH01000014.1 GCA002913385_00546 gene open 13176-14048
1116 PPBH01000014.1 GCA002913385_00547 gene open 14587-14889
1117 PPBH01000014.1 GCA002913385_00548 gene open 14867-15412
1118 PPBH01000014.1 GCA002913385_00549 gene open 15565-15927
1119 PPBH01000014.1 GCA002913385_00550 gene open 15917-18367
1120 PPBH01000014.1 GCA002913385_00551 gene open 18748-19785
1121 PPBH01000014.1 GCA002913385_00552 gene open 19775-20662 csm4
1122 PPBH01000014.1 GCA002913385_00553 gene open 20662-21300 csm3
1123 PPBH01000014.1 GCA002913385_00554 gene open 21310-21720
1124 PPBH01000014.1 GCA002913385_00555 gene open 21717-23225 cas10
1125 PPBH01000014.1 GCA002913385_00556 gene open 23212-24048
1126 PPBH01000014.1 GCA002913385_00557 gene open 24029-24196
1127 PPBH01000014.1 GCA002913385_00558 gene open 24769-27003 cas1
1128 PPBH01000014.1 GCA002913385_00559 gene open 27003-27278 cas2
1129 PPBH01000014.1 GCA002913385_00560 gene open 29179-30138
1130 PPBH01000014.1 GCA002913385_00561 gene open 30135-30818
1131 PPBH01000014.1 GCA002913385_00562 gene open 30827-31447
1132 PPBH01000014.1 GCA002913385_00563 gene open 31517-32839
1133 PPBH01000014.1 GCA002913385_00564 gene open 32934-33308 csx20
1134 PPBH01000014.1 GCA002913385_00565 gene open 33475-33612
1135 PPBH01000014.1 GCA002913385_00566 gene open 33728-33847
1136 PPBH01000014.1 GCA002913385_00567 gene open 33857-35038
1137 PPBH01000015.1 GCA002913385_00568 CDS open 60-668 _na     202_aa Glycine transporter domain-containing protein
1138 PPBH01000015.1 GCA002913385_00569 CDS open 665-1651 _na     328_aa Dihydrodipicolinate reductase
1139 PPBH01000015.1 GCA002913385_00570 CDS open 1640-2122 _na     160_aa ybaK Cys-tRNA(Pro) deacylase
1140 PPBH01000015.1 GCA002913385_00571 CDS open 2181-2717 _na     178_aa fliL flagellar basal body-associated protein FliL
1141 PPBH01000015.1 GCA002913385_00572 CDS open 2714-3058 _na     114_aa acpS Holo-[acyl-carrier-protein] synthase
1142 PPBH01000015.1 GCA002913385_00573 CDS open 3173-3790 _na     205_aa hypothetical protein
1143 PPBH01000015.1 GCA002913385_00574 CDS open 3805-4404 _na     199_aa DUF2719 domain-containing protein
1144 PPBH01000015.1 GCA002913385_00575 CDS open 4427-4819 _na     130_aa Histidine kinase
1145 PPBH01000015.1 GCA002913385_00576 CDS open 4833-6173 _na     446_aa radA DNA repair protein RadA
1146 PPBH01000015.1 GCA002913385_00577 CDS open 6148-6510 _na     120_aa VanZ-like domain-containing protein
1147 PPBH01000015.1 GCA002913385_00578 CDS open 6503-7369 _na     288_aa ftsY signal recognition particle-docking protein FtsY
1148 PPBH01000015.1 GCA002913385_00579 CDS open 7369-8007 _na     212_aa Thioredoxin domain-containing protein
1149 PPBH01000015.1 GCA002913385_00580 CDS open 8057-8701 _na     214_aa 5-formyltetrahydrofolate cyclo-ligase
1150 PPBH01000015.1 GCA002913385_00581 CDS open 8655-10175 _na     506_aa rny ribonuclease Y
1151 PPBH01000015.1 GCA002913385_00582 CDS open 10209-10781 _na     190_aa Ysc84 actin-binding domain-containing protein
1152 PPBH01000015.1 GCA002913385_00583 CDS open 10778-11347 _na     189_aa VTT domain-containing protein
1153 PPBH01000015.1 GCA002913385_00584 CDS open 11344-12684 _na     446_aa Periplasmic protein
1154 PPBH01000015.1 GCA002913385_00568 gene open 60-668
1155 PPBH01000015.1 GCA002913385_00569 gene open 665-1651
1156 PPBH01000015.1 GCA002913385_00570 gene open 1640-2122 ybaK
1157 PPBH01000015.1 GCA002913385_00571 gene open 2181-2717 fliL
1158 PPBH01000015.1 GCA002913385_00572 gene open 2714-3058 acpS
1159 PPBH01000015.1 GCA002913385_00573 gene open 3173-3790
1160 PPBH01000015.1 GCA002913385_00574 gene open 3805-4404
1161 PPBH01000015.1 GCA002913385_00575 gene open 4427-4819
1162 PPBH01000015.1 GCA002913385_00576 gene open 4833-6173 radA
1163 PPBH01000015.1 GCA002913385_00577 gene open 6148-6510
1164 PPBH01000015.1 GCA002913385_00578 gene open 6503-7369 ftsY
1165 PPBH01000015.1 GCA002913385_00579 gene open 7369-8007
1166 PPBH01000015.1 GCA002913385_00580 gene open 8057-8701
1167 PPBH01000015.1 GCA002913385_00581 gene open 8655-10175 rny
1168 PPBH01000015.1 GCA002913385_00582 gene open 10209-10781
1169 PPBH01000015.1 GCA002913385_00583 gene open 10778-11347
1170 PPBH01000015.1 GCA002913385_00584 gene open 11344-12684
1171 PPBH01000016.1 GCA002913385_00585 CDS open 953-2368 _na     471_aa Mobilization protein
1172 PPBH01000016.1 GCA002913385_00586 CDS open 2944-5085 _na     713_aa Tyr recombinase domain-containing protein
1173 PPBH01000016.1 GCA002913385_00587 CDS open 5220-6419 _na     399_aa AAA+ ATPase domain-containing protein
1174 PPBH01000016.1 GCA002913385_00588 CDS open 6443-8023 _na     526_aa DUF4435 domain-containing protein
1175 PPBH01000016.1 GCA002913385_00585 gene open 953-2368
1176 PPBH01000016.1 GCA002913385_00586 gene open 2944-5085
1177 PPBH01000016.1 GCA002913385_00587 gene open 5220-6419
1178 PPBH01000016.1 GCA002913385_00588 gene open 6443-8023
1179 PPBH01000017.1 GCA002913385_00589 CDS open 21-461 _na     146_aa Methyl-accepting transducer domain-containing protein
1180 PPBH01000017.1 GCA002913385_00590 CDS open 772-1605 _na     277_aa modD Putative pyrophosphorylase ModD
1181 PPBH01000017.1 GCA002913385_00591 CDS open 1607-1864 _na     85_aa Helicase
1182 PPBH01000017.1 GCA002913385_00592 CDS open 1875-3335 _na     486_aa Na+/alanine symporter family protein
1183 PPBH01000017.1 GCA002913385_00593 CDS open 3353-5443 _na     696_aa Lead%2C cadmium%2C zinc and mercury transporting ATPase
1184 PPBH01000017.1 GCA002913385_00594 CDS open 5412-5732 _na     106_aa Oxidoreductase
1185 PPBH01000017.1 GCA002913385_00595 CDS open 5732-6046 _na     104_aa Cys/Met metabolism pyridoxal-phosphate-dependent enzyme
1186 PPBH01000017.1 GCA002913385_00596 CDS open 6056-6406 _na     116_aa Periplasmic protein
1187 PPBH01000017.1 GCA002913385_00597 CDS open 6399-7049 _na     216_aa Aminotransferase
1188 PPBH01000017.1 GCA002913385_00598 CDS open 7042-7365 _na     107_aa HMA domain-containing protein
1189 PPBH01000017.1 GCA002913385_00599 CDS open 7468-7914 _na     148_aa Transcriptional regulator%2C Fur family
1190 PPBH01000017.1 GCA002913385_00600 CDS open 8065-8274 _na     69_aa hypothetical protein
1191 PPBH01000017.1 GCA002913385_00601 CDS open 8380-9045 _na     221_aa Ysc84 actin-binding domain-containing protein
1192 PPBH01000017.1 GCA002913385_00589 gene open 21-461
1193 PPBH01000017.1 GCA002913385_00590 gene open 772-1605 modD
1194 PPBH01000017.1 GCA002913385_00591 gene open 1607-1864
1195 PPBH01000017.1 GCA002913385_00592 gene open 1875-3335
1196 PPBH01000017.1 GCA002913385_00593 gene open 3353-5443
1197 PPBH01000017.1 GCA002913385_00594 gene open 5412-5732
1198 PPBH01000017.1 GCA002913385_00595 gene open 5732-6046
1199 PPBH01000017.1 GCA002913385_00596 gene open 6056-6406
1200 PPBH01000017.1 GCA002913385_00597 gene open 6399-7049
1201 PPBH01000017.1 GCA002913385_00598 gene open 7042-7365
1202 PPBH01000017.1 GCA002913385_00599 gene open 7468-7914
1203 PPBH01000017.1 GCA002913385_00600 gene open 8065-8274
1204 PPBH01000017.1 GCA002913385_00601 gene open 8380-9045
1205 PPBH01000019.1 GCA002913385_00602 CDS open 1173-2591 _na     472_aa argH argininosuccinate lyase
1206 PPBH01000019.1 GCA002913385_00603 CDS open 2861-3250 _na     129_aa hypothetical protein
1207 PPBH01000019.1 GCA002913385_00604 CDS open 3253-3792 _na     179_aa Oxidoreductase
1208 PPBH01000019.1 GCA002913385_00605 CDS open 3795-5972 _na     725_aa Copper-transporting ATPase
1209 PPBH01000019.1 GCA002913385_00606 CDS open 5974-6177 _na     67_aa HMA domain-containing protein
1210 PPBH01000019.1 GCA002913385_00607 CDS open 6174-6728 _na     184_aa N-acetyltransferase domain-containing protein
1211 PPBH01000019.1 GCA002913385_00608 CDS open 6880-7587 _na     235_aa putative transcriptional regulatory protein Ccon26_04940
1212 PPBH01000019.1 GCA002913385_00609 CDS open 7599-8093 _na     164_aa Peptidyl-prolyl cis-trans isomerase
1213 PPBH01000019.1 GCA002913385_00610 CDS open 8105-9460 _na     451_aa C4-dicarboxylate transport protein
1214 PPBH01000019.1 GCA002913385_00611 CDS open 9625-10317 _na     230_aa Aspartate racemase
1215 PPBH01000019.1 GCA002913385_00602 gene open 1173-2591 argH
1216 PPBH01000019.1 GCA002913385_00603 gene open 2861-3250
1217 PPBH01000019.1 GCA002913385_00604 gene open 3253-3792
1218 PPBH01000019.1 GCA002913385_00605 gene open 3795-5972
1219 PPBH01000019.1 GCA002913385_00606 gene open 5974-6177
1220 PPBH01000019.1 GCA002913385_00607 gene open 6174-6728
1221 PPBH01000019.1 GCA002913385_00608 gene open 6880-7587
1222 PPBH01000019.1 GCA002913385_00609 gene open 7599-8093
1223 PPBH01000019.1 GCA002913385_00610 gene open 8105-9460
1224 PPBH01000019.1 GCA002913385_00611 gene open 9625-10317
1225 PPBH01000020.1 GCA002913385_00612 CDS open 39-926 _na     295_aa Thioredoxin reductase
1226 PPBH01000020.1 GCA002913385_00612 gene open 39-926
1227 PPBH01000021.1 GCA002913385_00613 CDS open 1283-1825 _na     180_aa Hydrogenase maturation protease
1228 PPBH01000021.1 GCA002913385_00614 CDS open 1825-2505 _na     226_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
1229 PPBH01000021.1 GCA002913385_00615 CDS open 2515-4233 _na     572_aa [NiFe] hydrogenase%2C large subunit
1230 PPBH01000021.1 GCA002913385_00616 CDS open 4243-5388 _na     381_aa [NiFe] hydrogenase%2C small subunit
1231 PPBH01000021.1 GCA002913385_00613 gene open 1283-1825
1232 PPBH01000021.1 GCA002913385_00614 gene open 1825-2505 cybH
1233 PPBH01000021.1 GCA002913385_00615 gene open 2515-4233
1234 PPBH01000021.1 GCA002913385_00616 gene open 4243-5388
1235 PPBH01000022.1 GCA002913385_00617 CDS open 247-1599 _na     450_aa Thioredoxin reductase
1236 PPBH01000022.1 GCA002913385_00618 CDS open 1715-2182 _na     155_aa tssJ type VI secretion system lipoprotein TssJ
1237 PPBH01000022.1 GCA002913385_00619 CDS open 2184-3578 _na     464_aa tssK type VI secretion system baseplate subunit TssK
1238 PPBH01000022.1 GCA002913385_00620 CDS open 3588-4352 _na     254_aa icmH type IVB secretion system protein IcmH/DotU
1239 PPBH01000022.1 GCA002913385_00621 CDS open 4353-5636 _na     427_aa Type VI secretion system protein
1240 PPBH01000022.1 GCA002913385_00622 CDS open 5717-6202 _na     161_aa tssB type VI secretion system contractile sheath small subunit
1241 PPBH01000022.1 GCA002913385_00623 CDS open 6205-7653 _na     482_aa tssC type VI secretion system contractile sheath large subunit
1242 PPBH01000022.1 GCA002913385_00624 CDS open 7662-8051 _na     129_aa GPW/gp25 family protein
1243 PPBH01000022.1 GCA002913385_00625 CDS open 8051-9769 _na     572_aa tssF type VI secretion system baseplate subunit TssF
1244 PPBH01000022.1 GCA002913385_00626 CDS open 9766-10662 _na     298_aa Type VI secretion protein
1245 PPBH01000022.1 GCA002913385_00627 CDS open 10740-14228 _na     1162_aa tssM type VI secretion system membrane subunit TssM
1246 PPBH01000022.1 GCA002913385_00628 CDS open 14238-15155 _na     305_aa Type VI secretion system protein
1247 PPBH01000022.1 GCA002913385_00629 CDS open 15220-15741 _na     173_aa Hcp family type VI secretion system effector
1248 PPBH01000022.1 GCA002913385_00630 CDS open 15851-16411 _na     186_aa Ankyrin repeat domain-containing protein
1249 PPBH01000022.1 GCA002913385_00631 CDS open 16408-16962 _na     184_aa Ankyrin repeat domain-containing protein
1250 PPBH01000022.1 GCA002913385_00617 gene open 247-1599
1251 PPBH01000022.1 GCA002913385_00618 gene open 1715-2182 tssJ
1252 PPBH01000022.1 GCA002913385_00619 gene open 2184-3578 tssK
1253 PPBH01000022.1 GCA002913385_00620 gene open 3588-4352 icmH
1254 PPBH01000022.1 GCA002913385_00621 gene open 4353-5636
1255 PPBH01000022.1 GCA002913385_00622 gene open 5717-6202 tssB
1256 PPBH01000022.1 GCA002913385_00623 gene open 6205-7653 tssC
1257 PPBH01000022.1 GCA002913385_00624 gene open 7662-8051
1258 PPBH01000022.1 GCA002913385_00625 gene open 8051-9769 tssF
1259 PPBH01000022.1 GCA002913385_00626 gene open 9766-10662
1260 PPBH01000022.1 GCA002913385_00627 gene open 10740-14228 tssM
1261 PPBH01000022.1 GCA002913385_00628 gene open 14238-15155
1262 PPBH01000022.1 GCA002913385_00629 gene open 15220-15741
1263 PPBH01000022.1 GCA002913385_00630 gene open 15851-16411
1264 PPBH01000022.1 GCA002913385_00631 gene open 16408-16962
1265 PPBH01000024.1 GCA002913385_00632 CDS open 204-1079 _na     291_aa thioredoxin reductase
1266 PPBH01000024.1 GCA002913385_00632 gene open 204-1079
1267 PPBH01000025.1 GCA002913385_00633 CDS open 388-942 _na     184_aa isoaspartyl peptidase/L-asparaginase
1268 PPBH01000025.1 GCA002913385_00634 CDS open 997-1881 _na     294_aa nrfD Polysulfide reductase NrfD
1269 PPBH01000025.1 GCA002913385_00635 CDS open 1892-2530 _na     212_aa Reductase assembly protein
1270 PPBH01000025.1 GCA002913385_00636 CDS open 2541-3092 _na     183_aa 4Fe-4S dicluster domain-containing protein
1271 PPBH01000025.1 GCA002913385_00637 CDS open 3104-5395 _na     763_aa Anaerobic dehydrogenase
1272 PPBH01000025.1 GCA002913385_00638 CDS open 5418-6311 _na     297_aa dsbB Disulfide bond formation protein%2C DsbB family
1273 PPBH01000025.1 GCA002913385_00639 CDS open 6322-7032 _na     236_aa Disulfide bond formation protein B
1274 PPBH01000025.1 GCA002913385_00640 CDS open 7042-7209 _na     55_aa hypothetical protein
1275 PPBH01000025.1 GCA002913385_00641 CDS open 7505-8653 _na     382_aa Replication initiation protein
1276 PPBH01000025.1 GCA002913385_00642 CDS open 8656-9252 _na     198_aa Effector protein
1277 PPBH01000025.1 GCA002913385_00643 CDS open 9400-10242 _na     280_aa Hydrogenase
1278 PPBH01000025.1 GCA002913385_00644 CDS open 10367-10927 _na     186_aa dcd dCTP deaminase
1279 PPBH01000025.1 GCA002913385_00645 CDS open 11124-13103 _na     659_aa pseE PseE protein%2C putative pseudaminic acid transferase
1280 PPBH01000025.1 GCA002913385_00646 CDS open 13106-14293 _na     395_aa UDP-N-acetylglucosamine 4%2C6-dehydratase
1281 PPBH01000025.1 GCA002913385_00647 CDS open 14280-15431 _na     383_aa Aminotransferase%2C DegT/DnrJ/EryC1/StrS family
1282 PPBH01000025.1 GCA002913385_00648 CDS open 15434-16045 _na     203_aa Acetyltransferase
1283 PPBH01000025.1 GCA002913385_00649 CDS open 16070-17071 _na     333_aa neuB N-acetylneuraminate synthase
1284 PPBH01000025.1 GCA002913385_00650 CDS open 17068-18228 _na     386_aa neuC UDP-N-acetylglucosamine 2-epimerase
1285 PPBH01000025.1 GCA002913385_00651 CDS open 18225-19271 _na     348_aa Glucosamine-1-P guanylyltransferase
1286 PPBH01000025.1 GCA002913385_00652 CDS open 19285-20187 _na     300_aa ptmF Glucosamine-6-P synthase%2C isomerase subunit PtmF
1287 PPBH01000025.1 GCA002913385_00653 CDS open 20180-20887 _na     235_aa CMP-legionaminic acid synthetase
1288 PPBH01000025.1 GCA002913385_00654 CDS open 20874-21644 _na     256_aa oxidoreductase
1289 PPBH01000025.1 GCA002913385_00655 CDS open 21920-23419 _na     499_aa Flagellin
1290 PPBH01000025.1 GCA002913385_00656 CDS open 23622-25736 _na     704_aa topA type I DNA topoisomerase
1291 PPBH01000025.1 GCA002913385_00657 CDS open 25796-26515 _na     239_aa Internalin%2C (LPXTG motif)
1292 PPBH01000025.1 GCA002913385_00658 CDS open 27305-28144 _na     279_aa bioB biotin synthase
1293 PPBH01000025.1 GCA002913385_00659 CDS open 28144-28497 _na     117_aa crcB fluoride efflux transporter CrcB
1294 PPBH01000025.1 GCA002913385_00660 CDS open 29760-30842 _na     360_aa PepSY domain-containing protein
1295 PPBH01000025.1 GCA002913385_00661 CDS open 30839-32953 _na     704_aa TonB-dependent siderophore receptor
1296 PPBH01000025.1 GCA002913385_00662 CDS open 33049-33561 _na     170_aa Chemotaxis protein
1297 PPBH01000025.1 GCA002913385_00663 CDS open 33558-35075 _na     505_aa Na+/H+ antiporter
1298 PPBH01000025.1 GCA002913385_00665 CDS open 35321-35803 _na     160_aa N-acetyltransferase domain-containing protein
1299 PPBH01000025.1 GCA002913385_00666 CDS open 35806-36609 _na     267_aa Peptidase M48 domain-containing protein
1300 PPBH01000025.1 GCA002913385_00667 CDS open 37221-38189 _na     322_aa putative transporter
1301 PPBH01000025.1 GCA002913385_00668 CDS open 38299-38745 _na     148_aa copG CopG family transcriptional regulator
1302 PPBH01000025.1 GCA002913385_00669 CDS open 38785-40098 _na     437_aa Transporter
1303 PPBH01000025.1 GCA002913385_00670 CDS open 40269-41609 _na     446_aa corC Magnesium and cobalt efflux protein CorC
1304 PPBH01000025.1 GCA002913385_00671 CDS open 42049-42705 _na     218_aa Sugar transporter
1305 PPBH01000025.1 GCA002913385_00672 CDS open 42715-43605 _na     296_aa Galanin
1306 PPBH01000025.1 GCA002913385_00673 CDS open 43615-44178 _na     187_aa lemA LemA family protein
1307 PPBH01000025.1 GCA002913385_00674 CDS open 44337-45182 _na     281_aa fumarate hydratase
1308 PPBH01000025.1 GCA002913385_00675 CDS open 45192-45752 _na     186_aa Fe-S-containing hydro-lyase
1309 PPBH01000025.1 GCA002913385_00676 CDS open 45796-46335 _na     179_aa tcyA L-cystine-binding protein TcyA
1310 PPBH01000025.1 GCA002913385_00677 CDS open 46313-46786 _na     157_aa Cysteine permease
1311 PPBH01000025.1 GCA002913385_00678 CDS open 46881-47255 _na     124_aa Reactive intermediate/imine deaminase
1312 PPBH01000025.1 GCA002913385_00679 CDS open 47342-52054 _na     1570_aa Retention module-containing protein
1313 PPBH01000025.1 GCA002913385_00633 gene open 388-942
1314 PPBH01000025.1 GCA002913385_00634 gene open 997-1881 nrfD
1315 PPBH01000025.1 GCA002913385_00635 gene open 1892-2530
1316 PPBH01000025.1 GCA002913385_00636 gene open 2541-3092
1317 PPBH01000025.1 GCA002913385_00637 gene open 3104-5395
1318 PPBH01000025.1 GCA002913385_00638 gene open 5418-6311 dsbB
1319 PPBH01000025.1 GCA002913385_00639 gene open 6322-7032
1320 PPBH01000025.1 GCA002913385_00640 gene open 7042-7209
1321 PPBH01000025.1 GCA002913385_00641 gene open 7505-8653
1322 PPBH01000025.1 GCA002913385_00642 gene open 8656-9252
1323 PPBH01000025.1 GCA002913385_00643 gene open 9400-10242
1324 PPBH01000025.1 GCA002913385_00644 gene open 10367-10927 dcd
1325 PPBH01000025.1 GCA002913385_00645 gene open 11124-13103 pseE
1326 PPBH01000025.1 GCA002913385_00646 gene open 13106-14293
1327 PPBH01000025.1 GCA002913385_00647 gene open 14280-15431
1328 PPBH01000025.1 GCA002913385_00648 gene open 15434-16045
1329 PPBH01000025.1 GCA002913385_00649 gene open 16070-17071 neuB
1330 PPBH01000025.1 GCA002913385_00650 gene open 17068-18228 neuC
1331 PPBH01000025.1 GCA002913385_00651 gene open 18225-19271
1332 PPBH01000025.1 GCA002913385_00652 gene open 19285-20187 ptmF
1333 PPBH01000025.1 GCA002913385_00653 gene open 20180-20887
1334 PPBH01000025.1 GCA002913385_00654 gene open 20874-21644
1335 PPBH01000025.1 GCA002913385_00655 gene open 21920-23419
1336 PPBH01000025.1 GCA002913385_00656 gene open 23622-25736 topA
1337 PPBH01000025.1 GCA002913385_00657 gene open 25796-26515
1338 PPBH01000025.1 GCA002913385_00658 gene open 27305-28144 bioB
1339 PPBH01000025.1 GCA002913385_00659 gene open 28144-28497 crcB
1340 PPBH01000025.1 GCA002913385_00660 gene open 29760-30842
1341 PPBH01000025.1 GCA002913385_00661 gene open 30839-32953
1342 PPBH01000025.1 GCA002913385_00662 gene open 33049-33561
1343 PPBH01000025.1 GCA002913385_00663 gene open 33558-35075
1344 PPBH01000025.1 GCA002913385_00665 gene open 35321-35803
1345 PPBH01000025.1 GCA002913385_00666 gene open 35806-36609
1346 PPBH01000025.1 GCA002913385_00667 gene open 37221-38189
1347 PPBH01000025.1 GCA002913385_00668 gene open 38299-38745 copG
1348 PPBH01000025.1 GCA002913385_00669 gene open 38785-40098
1349 PPBH01000025.1 GCA002913385_00670 gene open 40269-41609 corC
1350 PPBH01000025.1 GCA002913385_00671 gene open 42049-42705
1351 PPBH01000025.1 GCA002913385_00672 gene open 42715-43605
1352 PPBH01000025.1 GCA002913385_00673 gene open 43615-44178 lemA
1353 PPBH01000025.1 GCA002913385_00674 gene open 44337-45182
1354 PPBH01000025.1 GCA002913385_00675 gene open 45192-45752
1355 PPBH01000025.1 GCA002913385_00676 gene open 45796-46335 tcyA
1356 PPBH01000025.1 GCA002913385_00677 gene open 46313-46786
1357 PPBH01000025.1 GCA002913385_00678 gene open 46881-47255
1358 PPBH01000025.1 GCA002913385_00679 gene open 47342-52054
1359 PPBH01000025.1 GCA002913385_00664 gene open 35190-35277 trnS
1360 PPBH01000025.1 GCA002913385_00664 tRNA open 35190-35277 trnS tRNA-Ser(gga)
1361 PPBH01000026.1 GCA002913385_00680 CDS open 722-1876 _na     384_aa DegT/DnrJ/EryC1/StrS aminotransferase family protein
1362 PPBH01000026.1 GCA002913385_00681 CDS open 1869-3431 _na     520_aa Heparinase II/III-like protein
1363 PPBH01000026.1 GCA002913385_00680 gene open 722-1876
1364 PPBH01000026.1 GCA002913385_00681 gene open 1869-3431
1365 PPBH01000027.1 GCA002913385_00682 CDS open 105-785 _na     226_aa NlpC/P60 domain-containing protein
1366 PPBH01000027.1 GCA002913385_00683 CDS open 769-1344 _na     191_aa Peptidase S54 rhomboid domain-containing protein
1367 PPBH01000027.1 GCA002913385_00684 CDS open 1331-2143 _na     270_aa Ferritin
1368 PPBH01000027.1 GCA002913385_00685 CDS open 2140-2637 _na     165_aa Phosphohistidine phosphatase
1369 PPBH01000027.1 GCA002913385_00686 CDS open 3422-3913 _na     163_aa Flagellar protein
1370 PPBH01000027.1 GCA002913385_00687 CDS open 3918-5264 _na     448_aa TolC-like outer membrane efflux protein
1371 PPBH01000027.1 GCA002913385_00688 CDS open 5266-7194 _na     642_aa pvdT Pyoverdine export ATP-binding/permease protein PvdT
1372 PPBH01000027.1 GCA002913385_00689 CDS open 7195-8391 _na     398_aa Efflux transporter periplasmic adaptor subunit
1373 PPBH01000027.1 GCA002913385_00690 CDS open 8445-10478 _na     677_aa DNA 3'-5' helicase
1374 PPBH01000027.1 GCA002913385_00691 CDS open 10543-12711 _na     722_aa pbpC penicillin-binding protein 1C
1375 PPBH01000027.1 GCA002913385_00692 CDS open 12713-17836 _na     1707_aa Alpha-2-macroglobulin
1376 PPBH01000027.1 GCA002913385_00693 CDS open 17957-20581 _na     874_aa valine--tRNA ligase
1377 PPBH01000027.1 GCA002913385_00694 CDS open 20581-21537 _na     318_aa DL-methionine ABC transporter MetINQ%2C ATP-binding protein
1378 PPBH01000027.1 GCA002913385_00695 CDS open 21537-22211 _na     224_aa DL-methionine ABC transporter MetINQ%2C permease protein
1379 PPBH01000027.1 GCA002913385_00696 CDS open 22200-23159 _na     319_aa Putative membrane protein
1380 PPBH01000027.1 GCA002913385_00697 CDS open 23262-23597 _na     111_aa arsR Transcriptional regulator%2C ArsR family
1381 PPBH01000027.1 GCA002913385_00698 CDS open 23857-24639 _na     260_aa DL-methionine ABC transporter MetINQ%2C substrate-binding protein
1382 PPBH01000027.1 GCA002913385_00699 CDS open 24716-25495 _na     259_aa DL-methionine ABC transporter MetINQ%2C substrate-binding protein
1383 PPBH01000027.1 GCA002913385_00700 CDS open 25653-26243 _na     196_aa VTT domain-containing protein
1384 PPBH01000027.1 GCA002913385_00701 CDS open 26314-27102 _na     262_aa murI glutamate racemase
1385 PPBH01000027.1 GCA002913385_00702 CDS open 27194-28354 _na     386_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1386 PPBH01000027.1 GCA002913385_00703 CDS open 28351-29373 _na     340_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1387 PPBH01000027.1 GCA002913385_00704 CDS open 29365-30099 _na     244_aa Imidazole glycerol phosphate synthase
1388 PPBH01000027.1 GCA002913385_00705 CDS open 30215-30973 _na     252_aa hypothetical protein
1389 PPBH01000027.1 GCA002913385_00706 CDS open 30974-32224 _na     416_aa RNA polymerase factor sigma-54
1390 PPBH01000027.1 GCA002913385_00707 CDS open 32228-32956 _na     242_aa lptB LPS export ABC transporter ATP-binding protein
1391 PPBH01000027.1 GCA002913385_00708 CDS open 32949-33347 _na     132_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1392 PPBH01000027.1 GCA002913385_00709 CDS open 33347-33592 _na     81_aa RNA-binding S4 domain-containing protein
1393 PPBH01000027.1 GCA002913385_00710 CDS open 33626-34453 _na     275_aa iroE IroE protein
1394 PPBH01000027.1 GCA002913385_00711 CDS open 34447-36552 _na     701_aa TonB-dependent siderophore receptor
1395 PPBH01000027.1 GCA002913385_00712 CDS open 36735-37991 _na     418_aa Signal transduction protein CetA%2C mediates an energy taxis response
1396 PPBH01000027.1 GCA002913385_00713 CDS open 37993-38493 _na     166_aa Signal transduction protein CetB%2C mediates an energy taxis response
1397 PPBH01000027.1 GCA002913385_00714 CDS open 38521-39756 _na     411_aa gspF Type II secretion system protein GspF domain-containing protein
1398 PPBH01000027.1 GCA002913385_00715 CDS open 39753-41504 _na     583_aa Bacterial type II secretion system protein E domain-containing protein
1399 PPBH01000027.1 GCA002913385_00716 CDS open 41504-42043 _na     179_aa Periplasmic protein
1400 PPBH01000027.1 GCA002913385_00717 CDS open 42040-42906 _na     288_aa Transformation system protein
1401 PPBH01000027.1 GCA002913385_00718 CDS open 42899-43726 _na     275_aa AAA+ ATPase domain-containing protein
1402 PPBH01000027.1 GCA002913385_00719 CDS open 43719-45245 _na     508_aa mshL pilus (MSHA type) biogenesis protein MshL
1403 PPBH01000027.1 GCA002913385_00720 CDS open 45223-45633 _na     136_aa Transformation system protein
1404 PPBH01000027.1 GCA002913385_00721 CDS open 45633-46280 _na     215_aa pilO Pilus assembly protein PilO
1405 PPBH01000027.1 GCA002913385_00722 CDS open 46277-47797 _na     506_aa C4-dicarboxylate ABC transporter
1406 PPBH01000027.1 GCA002913385_00723 CDS open 47858-48727 _na     289_aa era GTPase Era
1407 PPBH01000027.1 GCA002913385_00724 CDS open 48724-50046 _na     440_aa hslU HslU--HslV peptidase ATPase subunit
1408 PPBH01000027.1 GCA002913385_00725 CDS open 50055-50588 _na     177_aa hslV ATP-dependent protease subunit HslV
1409 PPBH01000027.1 GCA002913385_00726 CDS open 50589-51035 _na     148_aa rplI 50S ribosomal protein L9
1410 PPBH01000027.1 GCA002913385_00727 CDS open 51059-52282 _na     407_aa argG argininosuccinate synthase
1411 PPBH01000027.1 GCA002913385_00728 CDS open 52464-54002 _na     512_aa Phosphate transporter
1412 PPBH01000027.1 GCA002913385_00729 CDS open 54133-55035 _na     300_aa Ppx/GppA phosphatase N-terminal domain-containing protein
1413 PPBH01000027.1 GCA002913385_00730 CDS open 55066-55497 _na     143_aa Glutamyl-tRNA amidotransferase
1414 PPBH01000027.1 GCA002913385_00733 CDS open 56224-56583 _na     119_aa tyrosine-type recombinase/integrase
1415 PPBH01000027.1 GCA002913385_00734 CDS open 56986-58881 _na     631_aa DUF87 domain-containing protein
1416 PPBH01000027.1 GCA002913385_00735 CDS open 59235-61550 _na     771_aa flgL flagellar hook-associated protein FlgL
1417 PPBH01000027.1 GCA002913385_00682 gene open 105-785
1418 PPBH01000027.1 GCA002913385_00683 gene open 769-1344
1419 PPBH01000027.1 GCA002913385_00684 gene open 1331-2143
1420 PPBH01000027.1 GCA002913385_00685 gene open 2140-2637
1421 PPBH01000027.1 GCA002913385_00686 gene open 3422-3913
1422 PPBH01000027.1 GCA002913385_00687 gene open 3918-5264
1423 PPBH01000027.1 GCA002913385_00688 gene open 5266-7194 pvdT
1424 PPBH01000027.1 GCA002913385_00689 gene open 7195-8391
1425 PPBH01000027.1 GCA002913385_00690 gene open 8445-10478
1426 PPBH01000027.1 GCA002913385_00691 gene open 10543-12711 pbpC
1427 PPBH01000027.1 GCA002913385_00692 gene open 12713-17836
1428 PPBH01000027.1 GCA002913385_00693 gene open 17957-20581
1429 PPBH01000027.1 GCA002913385_00694 gene open 20581-21537
1430 PPBH01000027.1 GCA002913385_00695 gene open 21537-22211
1431 PPBH01000027.1 GCA002913385_00696 gene open 22200-23159
1432 PPBH01000027.1 GCA002913385_00697 gene open 23262-23597 arsR
1433 PPBH01000027.1 GCA002913385_00698 gene open 23857-24639
1434 PPBH01000027.1 GCA002913385_00699 gene open 24716-25495
1435 PPBH01000027.1 GCA002913385_00700 gene open 25653-26243
1436 PPBH01000027.1 GCA002913385_00701 gene open 26314-27102 murI
1437 PPBH01000027.1 GCA002913385_00702 gene open 27194-28354 ftsW
1438 PPBH01000027.1 GCA002913385_00703 gene open 28351-29373 murG
1439 PPBH01000027.1 GCA002913385_00704 gene open 29365-30099
1440 PPBH01000027.1 GCA002913385_00705 gene open 30215-30973
1441 PPBH01000027.1 GCA002913385_00706 gene open 30974-32224
1442 PPBH01000027.1 GCA002913385_00707 gene open 32228-32956 lptB
1443 PPBH01000027.1 GCA002913385_00708 gene open 32949-33347 tsaE
1444 PPBH01000027.1 GCA002913385_00709 gene open 33347-33592
1445 PPBH01000027.1 GCA002913385_00710 gene open 33626-34453 iroE
1446 PPBH01000027.1 GCA002913385_00711 gene open 34447-36552
1447 PPBH01000027.1 GCA002913385_00712 gene open 36735-37991
1448 PPBH01000027.1 GCA002913385_00713 gene open 37993-38493
1449 PPBH01000027.1 GCA002913385_00714 gene open 38521-39756 gspF
1450 PPBH01000027.1 GCA002913385_00715 gene open 39753-41504
1451 PPBH01000027.1 GCA002913385_00716 gene open 41504-42043
1452 PPBH01000027.1 GCA002913385_00717 gene open 42040-42906
1453 PPBH01000027.1 GCA002913385_00718 gene open 42899-43726
1454 PPBH01000027.1 GCA002913385_00719 gene open 43719-45245 mshL
1455 PPBH01000027.1 GCA002913385_00720 gene open 45223-45633
1456 PPBH01000027.1 GCA002913385_00721 gene open 45633-46280 pilO
1457 PPBH01000027.1 GCA002913385_00722 gene open 46277-47797
1458 PPBH01000027.1 GCA002913385_00723 gene open 47858-48727 era
1459 PPBH01000027.1 GCA002913385_00724 gene open 48724-50046 hslU
1460 PPBH01000027.1 GCA002913385_00725 gene open 50055-50588 hslV
1461 PPBH01000027.1 GCA002913385_00726 gene open 50589-51035 rplI
1462 PPBH01000027.1 GCA002913385_00727 gene open 51059-52282 argG
1463 PPBH01000027.1 GCA002913385_00728 gene open 52464-54002
1464 PPBH01000027.1 GCA002913385_00729 gene open 54133-55035
1465 PPBH01000027.1 GCA002913385_00730 gene open 55066-55497
1466 PPBH01000027.1 GCA002913385_00733 gene open 56224-56583
1467 PPBH01000027.1 GCA002913385_00734 gene open 56986-58881
1468 PPBH01000027.1 GCA002913385_00735 gene open 59235-61550 flgL
1469 PPBH01000027.1 GCA002913385_00731 gene open 55691-55765 trnQ
1470 PPBH01000027.1 GCA002913385_00732 gene open 55793-55867 trnfM
1471 PPBH01000027.1 GCA002913385_00731 tRNA open 55691-55765 trnQ tRNA-Gln(ttg)
1472 PPBH01000027.1 GCA002913385_00732 tRNA open 55793-55867 trnfM tRNA-fMet(cat)
1473 PPBH01000028.1 GCA002913385_00736 CDS open 1347-2117 _na     256_aa Solute-binding protein family 3/N-terminal domain-containing protein
1474 PPBH01000028.1 GCA002913385_00737 CDS open 2129-2857 _na     242_aa Amino acid ABC transporter%2C ATP-binding protein
1475 PPBH01000028.1 GCA002913385_00738 CDS open 2850-3560 _na     236_aa Amino acid ABC transporter permease
1476 PPBH01000028.1 GCA002913385_00739 CDS open 3707-5194 _na     495_aa putP sodium/proline symporter PutP
1477 PPBH01000028.1 GCA002913385_00740 CDS open 5243-6247 _na     334_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1478 PPBH01000028.1 GCA002913385_00741 CDS open 6244-7542 _na     432_aa Deacylase
1479 PPBH01000028.1 GCA002913385_00742 CDS open 7542-8777 _na     411_aa Xanthine/uracil permease
1480 PPBH01000028.1 GCA002913385_00743 CDS open 8764-9873 _na     369_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
1481 PPBH01000028.1 GCA002913385_00744 CDS open 9855-10586 _na     243_aa Phosphatidate cytidylyltransferase
1482 PPBH01000028.1 GCA002913385_00745 CDS open 10761-11147 _na     128_aa Restriction endonuclease type IV Mrr domain-containing protein
1483 PPBH01000028.1 GCA002913385_00746 CDS open 11488-12207 _na     239_aa fumarate reductase iron-sulfur subunit
1484 PPBH01000028.1 GCA002913385_00747 CDS open 12200-14218 _na     672_aa fumarate reductase flavoprotein subunit
1485 PPBH01000028.1 GCA002913385_00748 CDS open 14233-14931 _na     232_aa fumarate reductase cytochrome b subunit
1486 PPBH01000028.1 GCA002913385_00749 CDS open 15051-15866 _na     271_aa lgt prolipoprotein diacylglyceryl transferase
1487 PPBH01000028.1 GCA002913385_00750 CDS open 15903-16538 _na     211_aa Impact N-terminal domain-containing protein
1488 PPBH01000028.1 GCA002913385_00751 CDS open 16665-17486 _na     273_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
1489 PPBH01000028.1 GCA002913385_00752 CDS open 17483-18703 _na     406_aa glucose-6-phosphate isomerase
1490 PPBH01000028.1 GCA002913385_00753 CDS open 18707-19252 _na     181_aa NADH:ubiquinone oxidoreductase%2C Na
1491 PPBH01000028.1 GCA002913385_00754 CDS open 19313-20902 _na     529_aa abc-f ribosomal protection-like ABC-F family protein
1492 PPBH01000028.1 GCA002913385_00755 CDS open 21107-21433 _na     108_aa DUF4272 domain-containing protein
1493 PPBH01000028.1 GCA002913385_00756 CDS open 21418-21783 _na     121_aa DUF4272 domain-containing protein
1494 PPBH01000028.1 GCA002913385_00757 CDS open 21823-23169 _na     448_aa malate dehydrogenase (quinone)
1495 PPBH01000028.1 GCA002913385_00758 CDS open 23298-25304 _na     668_aa TonB-dependent receptor
1496 PPBH01000028.1 GCA002913385_00759 CDS open 25537-26559 _na     340_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
1497 PPBH01000028.1 GCA002913385_00736 gene open 1347-2117
1498 PPBH01000028.1 GCA002913385_00737 gene open 2129-2857
1499 PPBH01000028.1 GCA002913385_00738 gene open 2850-3560
1500 PPBH01000028.1 GCA002913385_00739 gene open 3707-5194 putP