HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_002913545.1)

Select a Genome:
BAKTA Annotations for GCA_002913545.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
133 1,887,759 1845 3 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3788 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3788 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 PPBR01000040.1 repeat_region open 9783-11274 CRISPR array with 20 repeats of length 37%2C consensus sequence ATTTAAACAAATTTGACCCGATCAAGGGGATTGAAAC and spacer length 37
1002 PPBR01000040.1 GCA002913545_00501 CDS open 236-472 _na     78_aa hypothetical protein
1003 PPBR01000040.1 GCA002913545_00502 CDS open 910-1947 _na     345_aa CRISPR system Cms protein Csm5
1004 PPBR01000040.1 GCA002913545_00503 CDS open 1937-2824 _na     295_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
1005 PPBR01000040.1 GCA002913545_00504 CDS open 2824-3462 _na     212_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
1006 PPBR01000040.1 GCA002913545_00505 CDS open 3472-3882 _na     136_aa CRISPR system Cms protein Csm2
1007 PPBR01000040.1 GCA002913545_00506 CDS open 3879-5387 _na     502_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
1008 PPBR01000040.1 GCA002913545_00507 CDS open 5374-6210 _na     278_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
1009 PPBR01000040.1 GCA002913545_00508 CDS open 6191-6400 _na     69_aa hypothetical protein
1010 PPBR01000040.1 GCA002913545_00509 CDS open 6828-9062 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
1011 PPBR01000040.1 GCA002913545_00510 CDS open 9062-9337 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
1012 PPBR01000040.1 GCA002913545_00511 CDS open 11790-12749 _na     319_aa WYL domain-containing protein
1013 PPBR01000040.1 GCA002913545_00512 CDS open 12746-13429 _na     227_aa Macro domain-containing protein
1014 PPBR01000040.1 GCA002913545_00513 CDS open 13439-14059 _na     206_aa DUF4433 domain-containing protein
1015 PPBR01000040.1 GCA002913545_00514 CDS open 14129-15148 _na     339_aa CRISPR-associated DxTHG motif protein
1016 PPBR01000040.1 GCA002913545_00515 CDS open 15132-15467 _na     111_aa hypothetical protein
1017 PPBR01000040.1 GCA002913545_00516 CDS open 15561-15935 _na     124_aa csx20 CRISPR-associated protein Csx20
1018 PPBR01000040.1 GCA002913545_00517 CDS open 16102-16239 _na     45_aa hypothetical protein
1019 PPBR01000040.1 GCA002913545_00518 CDS open 16480-17676 _na     398_aa AAA+ ATPase domain-containing protein
1020 PPBR01000040.1 GCA002913545_00519 CDS open 17988-18245 _na     85_aa hypothetical protein
1021 PPBR01000040.1 GCA002913545_00520 CDS open 18462-20369 _na     635_aa DUF262 domain-containing protein
1022 PPBR01000040.1 GCA002913545_00521 CDS open 20366-21844 _na     492_aa DUF2779 domain-containing protein
1023 PPBR01000040.1 GCA002913545_00522 CDS open 21902-23110 _na     402_aa PD-(D/E)XK nuclease family protein
1024 PPBR01000040.1 GCA002913545_00523 CDS open 23293-23628 _na     111_aa Histidine kinase
1025 PPBR01000040.1 GCA002913545_00524 CDS open 23607-24182 _na     191_aa Calcineurin-like phosphoesterase domain-containing protein
1026 PPBR01000040.1 GCA002913545_00525 CDS open 24200-24736 _na     178_aa Fido domain-containing protein
1027 PPBR01000040.1 GCA002913545_00526 CDS open 24749-25666 _na     305_aa WYL domain-containing protein
1028 PPBR01000040.1 GCA002913545_00527 CDS open 25720-26541 _na     273_aa Sir2 family NAD-dependent protein deacetylase
1029 PPBR01000040.1 GCA002913545_00528 CDS open 26648-27457 _na     269_aa HNH domain-containing protein
1030 PPBR01000040.1 GCA002913545_00529 CDS open 27586-28272 _na     228_aa Peptidylarginine deiminase family protein
1031 PPBR01000040.1 GCA002913545_00530 CDS open 28406-28993 _na     195_aa hypothetical protein
1032 PPBR01000040.1 GCA002913545_00531 CDS open 29008-30264 _na     418_aa HEAT repeat domain-containing protein
1033 PPBR01000040.1 GCA002913545_00532 CDS open 30275-31600 _na     441_aa PD-(D/E)XK endonuclease-like domain-containing protein
1034 PPBR01000040.1 GCA002913545_00533 CDS open 31631-32248 _na     205_aa hypothetical protein
1035 PPBR01000040.1 GCA002913545_00534 CDS open 32333-33229 _na     298_aa Knr4/Smi1-like domain-containing protein
1036 PPBR01000040.1 GCA002913545_00535 CDS open 33360-33707 _na     115_aa Phage protein
1037 PPBR01000040.1 GCA002913545_00536 CDS open 33881-35953 _na     690_aa AAA+ ATPase domain-containing protein
1038 PPBR01000040.1 GCA002913545_00537 CDS open 36135-36419 _na     94_aa HTH cro/C1-type domain-containing protein
1039 PPBR01000040.1 GCA002913545_00538 CDS open 36416-36682 _na     88_aa RelE/StbE family addiction module toxin
1040 PPBR01000040.1 GCA002913545_00539 CDS open 37100-38281 _na     393_aa AAA+ ATPase domain-containing protein
1041 PPBR01000040.1 GCA002913545_00540 CDS open 38687-40267 _na     526_aa DUF4435 domain-containing protein
1042 PPBR01000040.1 GCA002913545_00541 CDS open 40291-41487 _na     398_aa AAA+ ATPase domain-containing protein
1043 PPBR01000040.1 GCA002913545_00542 CDS open 41624-43765 _na     713_aa Tyr recombinase domain-containing protein
1044 PPBR01000040.1 GCA002913545_00543 CDS open 44337-45650 _na     437_aa Mobilization protein
1045 PPBR01000040.1 GCA002913545_00544 CDS open 46208-49405 _na     1065_aa retention module-containing protein
1046 PPBR01000040.1 GCA002913545_00545 CDS open 51632-51883 _na     83_aa Antitoxin
1047 PPBR01000040.1 GCA002913545_00546 CDS open 51972-52763 _na     263_aa ABC transporter substrate-binding protein
1048 PPBR01000040.1 GCA002913545_00547 CDS open 53114-54103 _na     329_aa tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
1049 PPBR01000040.1 GCA002913545_00548 CDS open 54163-55386 _na     407_aa pepT peptidase T
1050 PPBR01000040.1 GCA002913545_00549 CDS open 55396-56706 _na     436_aa dcuC C4-dicarboxylate transporter DcuC
1051 PPBR01000040.1 GCA002913545_00550 CDS open 56721-57419 _na     232_aa pepE dipeptidase PepE
1052 PPBR01000040.1 GCA002913545_00551 CDS open 57416-58735 _na     439_aa Peptidase family M20/M25/M40%2C putative N-carbamoyl-L-amino acid amidohydrolase
1053 PPBR01000040.1 GCA002913545_00552 CDS open 58738-59976 _na     412_aa Peptidase family M20/M25/M40%2C putative N-carbamoyl-L-amino acid amidohydrolase
1054 PPBR01000040.1 GCA002913545_00553 CDS open 60075-61787 _na     570_aa DNA primase
1055 PPBR01000040.1 GCA002913545_00554 CDS open 61849-62874 _na     341_aa Tetratricopeptide repeat lipoprotein
1056 PPBR01000040.1 GCA002913545_00555 CDS open 62852-63286 _na     144_aa rnhA ribonuclease HI
1057 PPBR01000040.1 GCA002913545_00556 CDS open 63283-63954 _na     223_aa rnc ribonuclease III
1058 PPBR01000040.1 GCA002913545_00557 CDS open 63963-65027 _na     354_aa aroC chorismate synthase
1059 PPBR01000040.1 GCA002913545_00558 CDS open 65337-66008 _na     223_aa hypothetical protein
1060 PPBR01000040.1 GCA002913545_00501 gene open 236-472
1061 PPBR01000040.1 GCA002913545_00502 gene open 910-1947
1062 PPBR01000040.1 GCA002913545_00503 gene open 1937-2824 csm4
1063 PPBR01000040.1 GCA002913545_00504 gene open 2824-3462 csm3
1064 PPBR01000040.1 GCA002913545_00505 gene open 3472-3882
1065 PPBR01000040.1 GCA002913545_00506 gene open 3879-5387 cas10
1066 PPBR01000040.1 GCA002913545_00507 gene open 5374-6210
1067 PPBR01000040.1 GCA002913545_00508 gene open 6191-6400
1068 PPBR01000040.1 GCA002913545_00509 gene open 6828-9062 cas1
1069 PPBR01000040.1 GCA002913545_00510 gene open 9062-9337 cas2
1070 PPBR01000040.1 GCA002913545_00511 gene open 11790-12749
1071 PPBR01000040.1 GCA002913545_00512 gene open 12746-13429
1072 PPBR01000040.1 GCA002913545_00513 gene open 13439-14059
1073 PPBR01000040.1 GCA002913545_00514 gene open 14129-15148
1074 PPBR01000040.1 GCA002913545_00515 gene open 15132-15467
1075 PPBR01000040.1 GCA002913545_00516 gene open 15561-15935 csx20
1076 PPBR01000040.1 GCA002913545_00517 gene open 16102-16239
1077 PPBR01000040.1 GCA002913545_00518 gene open 16480-17676
1078 PPBR01000040.1 GCA002913545_00519 gene open 17988-18245
1079 PPBR01000040.1 GCA002913545_00520 gene open 18462-20369
1080 PPBR01000040.1 GCA002913545_00521 gene open 20366-21844
1081 PPBR01000040.1 GCA002913545_00522 gene open 21902-23110
1082 PPBR01000040.1 GCA002913545_00523 gene open 23293-23628
1083 PPBR01000040.1 GCA002913545_00524 gene open 23607-24182
1084 PPBR01000040.1 GCA002913545_00525 gene open 24200-24736
1085 PPBR01000040.1 GCA002913545_00526 gene open 24749-25666
1086 PPBR01000040.1 GCA002913545_00527 gene open 25720-26541
1087 PPBR01000040.1 GCA002913545_00528 gene open 26648-27457
1088 PPBR01000040.1 GCA002913545_00529 gene open 27586-28272
1089 PPBR01000040.1 GCA002913545_00530 gene open 28406-28993
1090 PPBR01000040.1 GCA002913545_00531 gene open 29008-30264
1091 PPBR01000040.1 GCA002913545_00532 gene open 30275-31600
1092 PPBR01000040.1 GCA002913545_00533 gene open 31631-32248
1093 PPBR01000040.1 GCA002913545_00534 gene open 32333-33229
1094 PPBR01000040.1 GCA002913545_00535 gene open 33360-33707
1095 PPBR01000040.1 GCA002913545_00536 gene open 33881-35953
1096 PPBR01000040.1 GCA002913545_00537 gene open 36135-36419
1097 PPBR01000040.1 GCA002913545_00538 gene open 36416-36682
1098 PPBR01000040.1 GCA002913545_00539 gene open 37100-38281
1099 PPBR01000040.1 GCA002913545_00540 gene open 38687-40267
1100 PPBR01000040.1 GCA002913545_00541 gene open 40291-41487
1101 PPBR01000040.1 GCA002913545_00542 gene open 41624-43765
1102 PPBR01000040.1 GCA002913545_00543 gene open 44337-45650
1103 PPBR01000040.1 GCA002913545_00544 gene open 46208-49405
1104 PPBR01000040.1 GCA002913545_00545 gene open 51632-51883
1105 PPBR01000040.1 GCA002913545_00546 gene open 51972-52763
1106 PPBR01000040.1 GCA002913545_00547 gene open 53114-54103
1107 PPBR01000040.1 GCA002913545_00548 gene open 54163-55386 pepT
1108 PPBR01000040.1 GCA002913545_00549 gene open 55396-56706 dcuC
1109 PPBR01000040.1 GCA002913545_00550 gene open 56721-57419 pepE
1110 PPBR01000040.1 GCA002913545_00551 gene open 57416-58735
1111 PPBR01000040.1 GCA002913545_00552 gene open 58738-59976
1112 PPBR01000040.1 GCA002913545_00553 gene open 60075-61787
1113 PPBR01000040.1 GCA002913545_00554 gene open 61849-62874
1114 PPBR01000040.1 GCA002913545_00555 gene open 62852-63286 rnhA
1115 PPBR01000040.1 GCA002913545_00556 gene open 63283-63954 rnc
1116 PPBR01000040.1 GCA002913545_00557 gene open 63963-65027 aroC
1117 PPBR01000040.1 GCA002913545_00558 gene open 65337-66008
1118 PPBR01000041.1 GCA002913545_00559 CDS open 82-384 _na     100_aa hypothetical protein
1119 PPBR01000041.1 GCA002913545_00560 CDS open 381-1805 _na     474_aa UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanine ligase
1120 PPBR01000041.1 GCA002913545_00561 CDS open 1802-2251 _na     149_aa Beta-lactamase
1121 PPBR01000041.1 GCA002913545_00562 CDS open 2557-2712 _na     51_aa hypothetical protein
1122 PPBR01000041.1 GCA002913545_00563 CDS open 3422-4486 _na     354_aa xerH Tyrosine recombinase XerH
1123 PPBR01000041.1 GCA002913545_00564 CDS open 4489-5682 _na     397_aa ackA Acetate kinase
1124 PPBR01000041.1 GCA002913545_00565 CDS open 5684-7051 _na     455_aa pta phosphate acetyltransferase
1125 PPBR01000041.1 GCA002913545_00566 CDS open 7118-7825 _na     235_aa flgH flagellar basal body L-ring protein FlgH
1126 PPBR01000041.1 GCA002913545_00567 CDS open 8172-9317 _na     381_aa [NiFe] hydrogenase%2C small subunit
1127 PPBR01000041.1 GCA002913545_00568 CDS open 9327-11045 _na     572_aa [NiFe] hydrogenase%2C large subunit
1128 PPBR01000041.1 GCA002913545_00569 CDS open 11055-11735 _na     226_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
1129 PPBR01000041.1 GCA002913545_00570 CDS open 11735-12277 _na     180_aa Hydrogenase maturation protease
1130 PPBR01000041.1 GCA002913545_00571 CDS open 12274-13746 _na     490_aa hydE Protein hydE
1131 PPBR01000041.1 GCA002913545_00572 CDS open 13730-15955 _na     741_aa hypF carbamoyltransferase HypF
1132 PPBR01000041.1 GCA002913545_00573 CDS open 16001-16414 _na     137_aa nikR nickel-responsive transcriptional regulator NikR
1133 PPBR01000041.1 GCA002913545_00574 CDS open 16776-18038 _na     420_aa DUF2157 domain-containing protein
1134 PPBR01000041.1 GCA002913545_00575 CDS open 18035-18667 _na     210_aa GDYXXLXY protein
1135 PPBR01000041.1 GCA002913545_00576 CDS open 18791-19603 _na     270_aa hypB hydrogenase nickel incorporation protein HypB
1136 PPBR01000041.1 GCA002913545_00577 CDS open 19603-19842 _na     79_aa hypC Hydrogenase assembly chaperone HypC
1137 PPBR01000041.1 GCA002913545_00578 CDS open 19842-20930 _na     362_aa hypD hydrogenase formation protein HypD
1138 PPBR01000041.1 GCA002913545_00579 CDS open 20939-21931 _na     330_aa hypE hydrogenase expression/formation protein HypE
1139 PPBR01000041.1 GCA002913545_00580 CDS open 21931-22272 _na     113_aa hypA hydrogenase maturation nickel metallochaperone HypA
1140 PPBR01000041.1 GCA002913545_00581 CDS open 22469-22786 _na     105_aa hypothetical protein
1141 PPBR01000041.1 GCA002913545_00582 CDS open 22944-25463 _na     839_aa DUF3971 domain-containing protein
1142 PPBR01000041.1 GCA002913545_00583 CDS open 25483-26427 _na     314_aa Endolytic murein transglycosylase
1143 PPBR01000041.1 GCA002913545_00584 CDS open 26491-28665 _na     724_aa isocitrate dehydrogenase (NADP(+))
1144 PPBR01000041.1 GCA002913545_00585 CDS open 28669-29562 _na     297_aa Malate dehydrogenase%2C NAD-dependent
1145 PPBR01000041.1 GCA002913545_00586 CDS open 29571-29882 _na     103_aa 2-oxoglutarate:acceptor oxidoreductase%2C delta subunit
1146 PPBR01000041.1 GCA002913545_00587 CDS open 29879-31009 _na     376_aa 2-oxoglutarate synthase subunit alpha
1147 PPBR01000041.1 GCA002913545_00588 CDS open 30999-31844 _na     281_aa 2-oxoglutarate ferredoxin oxidoreductase subunit beta
1148 PPBR01000041.1 GCA002913545_00589 CDS open 31841-32392 _na     183_aa 2-oxoglutarate:acceptor oxidoreductase%2C gamma subunit
1149 PPBR01000041.1 GCA002913545_00590 CDS open 32425-32976 _na     183_aa 2-oxoglutarate:acceptor oxidoreductase%2C gamma subunit
1150 PPBR01000041.1 GCA002913545_00591 CDS open 32973-33818 _na     281_aa 2-oxoglutarate ferredoxin oxidoreductase subunit beta
1151 PPBR01000041.1 GCA002913545_00592 CDS open 33808-34938 _na     376_aa 2-oxoglutarate synthase subunit alpha
1152 PPBR01000041.1 GCA002913545_00593 CDS open 34935-35246 _na     103_aa 2-oxoglutarate:acceptor oxidoreductase%2C delta subunit
1153 PPBR01000041.1 GCA002913545_00594 CDS open 35255-36148 _na     297_aa Malate dehydrogenase%2C NAD-dependent
1154 PPBR01000041.1 GCA002913545_00595 CDS open 36152-38326 _na     724_aa isocitrate dehydrogenase (NADP(+))
1155 PPBR01000041.1 GCA002913545_00596 CDS open 38390-39334 _na     314_aa Endolytic murein transglycosylase
1156 PPBR01000041.1 GCA002913545_00597 CDS open 39354-41873 _na     839_aa DUF3971 domain-containing protein
1157 PPBR01000041.1 GCA002913545_00598 CDS open 42031-42348 _na     105_aa hypothetical protein
1158 PPBR01000041.1 GCA002913545_00599 CDS open 42545-42886 _na     113_aa hypA hydrogenase maturation nickel metallochaperone HypA
1159 PPBR01000041.1 GCA002913545_00600 CDS open 42886-43878 _na     330_aa hypE hydrogenase expression/formation protein HypE
1160 PPBR01000041.1 GCA002913545_00601 CDS open 43887-44975 _na     362_aa hypD hydrogenase formation protein HypD
1161 PPBR01000041.1 GCA002913545_00602 CDS open 44975-45214 _na     79_aa hypC Hydrogenase assembly chaperone HypC
1162 PPBR01000041.1 GCA002913545_00603 CDS open 45214-46026 _na     270_aa hypB hydrogenase nickel incorporation protein HypB
1163 PPBR01000041.1 GCA002913545_00604 CDS open 46150-46782 _na     210_aa GDYXXLXY protein
1164 PPBR01000041.1 GCA002913545_00605 CDS open 46779-48041 _na     420_aa DUF2157 domain-containing protein
1165 PPBR01000041.1 GCA002913545_00606 CDS open 48403-48816 _na     137_aa nikR nickel-responsive transcriptional regulator NikR
1166 PPBR01000041.1 GCA002913545_00607 CDS open 48862-51087 _na     741_aa hypF carbamoyltransferase HypF
1167 PPBR01000041.1 GCA002913545_00608 CDS open 51071-52543 _na     490_aa hydE Protein hydE
1168 PPBR01000041.1 GCA002913545_00609 CDS open 52540-53082 _na     180_aa Hydrogenase maturation protease
1169 PPBR01000041.1 GCA002913545_00610 CDS open 53082-53663 _na     193_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
1170 PPBR01000041.1 GCA002913545_00559 gene open 82-384
1171 PPBR01000041.1 GCA002913545_00560 gene open 381-1805
1172 PPBR01000041.1 GCA002913545_00561 gene open 1802-2251
1173 PPBR01000041.1 GCA002913545_00562 gene open 2557-2712
1174 PPBR01000041.1 GCA002913545_00563 gene open 3422-4486 xerH
1175 PPBR01000041.1 GCA002913545_00564 gene open 4489-5682 ackA
1176 PPBR01000041.1 GCA002913545_00565 gene open 5684-7051 pta
1177 PPBR01000041.1 GCA002913545_00566 gene open 7118-7825 flgH
1178 PPBR01000041.1 GCA002913545_00567 gene open 8172-9317
1179 PPBR01000041.1 GCA002913545_00568 gene open 9327-11045
1180 PPBR01000041.1 GCA002913545_00569 gene open 11055-11735 cybH
1181 PPBR01000041.1 GCA002913545_00570 gene open 11735-12277
1182 PPBR01000041.1 GCA002913545_00571 gene open 12274-13746 hydE
1183 PPBR01000041.1 GCA002913545_00572 gene open 13730-15955 hypF
1184 PPBR01000041.1 GCA002913545_00573 gene open 16001-16414 nikR
1185 PPBR01000041.1 GCA002913545_00574 gene open 16776-18038
1186 PPBR01000041.1 GCA002913545_00575 gene open 18035-18667
1187 PPBR01000041.1 GCA002913545_00576 gene open 18791-19603 hypB
1188 PPBR01000041.1 GCA002913545_00577 gene open 19603-19842 hypC
1189 PPBR01000041.1 GCA002913545_00578 gene open 19842-20930 hypD
1190 PPBR01000041.1 GCA002913545_00579 gene open 20939-21931 hypE
1191 PPBR01000041.1 GCA002913545_00580 gene open 21931-22272 hypA
1192 PPBR01000041.1 GCA002913545_00581 gene open 22469-22786
1193 PPBR01000041.1 GCA002913545_00582 gene open 22944-25463
1194 PPBR01000041.1 GCA002913545_00583 gene open 25483-26427
1195 PPBR01000041.1 GCA002913545_00584 gene open 26491-28665
1196 PPBR01000041.1 GCA002913545_00585 gene open 28669-29562
1197 PPBR01000041.1 GCA002913545_00586 gene open 29571-29882
1198 PPBR01000041.1 GCA002913545_00587 gene open 29879-31009
1199 PPBR01000041.1 GCA002913545_00588 gene open 30999-31844
1200 PPBR01000041.1 GCA002913545_00589 gene open 31841-32392
1201 PPBR01000041.1 GCA002913545_00590 gene open 32425-32976
1202 PPBR01000041.1 GCA002913545_00591 gene open 32973-33818
1203 PPBR01000041.1 GCA002913545_00592 gene open 33808-34938
1204 PPBR01000041.1 GCA002913545_00593 gene open 34935-35246
1205 PPBR01000041.1 GCA002913545_00594 gene open 35255-36148
1206 PPBR01000041.1 GCA002913545_00595 gene open 36152-38326
1207 PPBR01000041.1 GCA002913545_00596 gene open 38390-39334
1208 PPBR01000041.1 GCA002913545_00597 gene open 39354-41873
1209 PPBR01000041.1 GCA002913545_00598 gene open 42031-42348
1210 PPBR01000041.1 GCA002913545_00599 gene open 42545-42886 hypA
1211 PPBR01000041.1 GCA002913545_00600 gene open 42886-43878 hypE
1212 PPBR01000041.1 GCA002913545_00601 gene open 43887-44975 hypD
1213 PPBR01000041.1 GCA002913545_00602 gene open 44975-45214 hypC
1214 PPBR01000041.1 GCA002913545_00603 gene open 45214-46026 hypB
1215 PPBR01000041.1 GCA002913545_00604 gene open 46150-46782
1216 PPBR01000041.1 GCA002913545_00605 gene open 46779-48041
1217 PPBR01000041.1 GCA002913545_00606 gene open 48403-48816 nikR
1218 PPBR01000041.1 GCA002913545_00607 gene open 48862-51087 hypF
1219 PPBR01000041.1 GCA002913545_00608 gene open 51071-52543 hydE
1220 PPBR01000041.1 GCA002913545_00609 gene open 52540-53082
1221 PPBR01000041.1 GCA002913545_00610 gene open 53082-53663 cybH
1222 PPBR01000044.1 GCA002913545_00611 CDS open 190-1203 _na     337_aa bifunctional 3%2C4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II
1223 PPBR01000044.1 GCA002913545_00612 CDS open 1214-2767 _na     517_aa type I restriction-modification system subunit M
1224 PPBR01000044.1 GCA002913545_00613 CDS open 2764-3963 _na     399_aa restriction endonuclease subunit S
1225 PPBR01000044.1 GCA002913545_00614 CDS open 3974-7072 _na     1032_aa Type I restriction enzyme endonuclease subunit
1226 PPBR01000044.1 GCA002913545_00615 CDS open 7108-7566 _na     152_aa Methylated-DNA--protein-cysteine methyltransferase
1227 PPBR01000044.1 GCA002913545_00616 CDS open 7689-10274 _na     861_aa bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
1228 PPBR01000044.1 GCA002913545_00617 CDS open 10311-11522 _na     403_aa Ankyrin repeat domain-containing protein
1229 PPBR01000044.1 GCA002913545_00618 CDS open 11531-12277 _na     248_aa Oxidoreductase
1230 PPBR01000044.1 GCA002913545_00619 CDS open 12287-13990 _na     567_aa Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
1231 PPBR01000044.1 GCA002913545_00620 CDS open 13993-15102 _na     369_aa trmA tRNA (uridine(54)-C5)-methyltransferase TrmA
1232 PPBR01000044.1 GCA002913545_00621 CDS open 15117-16328 _na     403_aa ilvA threonine ammonia-lyase
1233 PPBR01000044.1 GCA002913545_00622 CDS open 16421-17254 _na     277_aa Metallo-beta-lactamase domain-containing protein
1234 PPBR01000044.1 GCA002913545_00623 CDS open 17311-18006 _na     231_aa DUF4230 domain-containing protein
1235 PPBR01000044.1 GCA002913545_00624 CDS open 18030-18953 _na     307_aa Dyp-type peroxidase family protein
1236 PPBR01000044.1 GCA002913545_00625 CDS open 19005-19427 _na     140_aa eamA EamA domain-containing protein
1237 PPBR01000044.1 GCA002913545_00626 CDS open 19525-20100 _na     191_aa Molybdopterin-containing oxidoreductase II%2C DMSO/TMAO/BSO reductase family%2C monoheme c-type cytochrome
1238 PPBR01000044.1 GCA002913545_00627 CDS open 20110-22677 _na     855_aa Anaerobic dimethyl sulfoxide reductase chain A
1239 PPBR01000044.1 GCA002913545_00628 CDS open 22809-22904 _na     31_aa hypothetical protein
1240 PPBR01000044.1 GCA002913545_00611 gene open 190-1203
1241 PPBR01000044.1 GCA002913545_00612 gene open 1214-2767
1242 PPBR01000044.1 GCA002913545_00613 gene open 2764-3963
1243 PPBR01000044.1 GCA002913545_00614 gene open 3974-7072
1244 PPBR01000044.1 GCA002913545_00615 gene open 7108-7566
1245 PPBR01000044.1 GCA002913545_00616 gene open 7689-10274
1246 PPBR01000044.1 GCA002913545_00617 gene open 10311-11522
1247 PPBR01000044.1 GCA002913545_00618 gene open 11531-12277
1248 PPBR01000044.1 GCA002913545_00619 gene open 12287-13990
1249 PPBR01000044.1 GCA002913545_00620 gene open 13993-15102 trmA
1250 PPBR01000044.1 GCA002913545_00621 gene open 15117-16328 ilvA
1251 PPBR01000044.1 GCA002913545_00622 gene open 16421-17254
1252 PPBR01000044.1 GCA002913545_00623 gene open 17311-18006
1253 PPBR01000044.1 GCA002913545_00624 gene open 18030-18953
1254 PPBR01000044.1 GCA002913545_00625 gene open 19005-19427 eamA
1255 PPBR01000044.1 GCA002913545_00626 gene open 19525-20100
1256 PPBR01000044.1 GCA002913545_00627 gene open 20110-22677
1257 PPBR01000044.1 GCA002913545_00628 gene open 22809-22904
1258 PPBR01000045.1 GCA002913545_00629 CDS open 165-650 _na     161_aa threonine/serine exporter family protein
1259 PPBR01000045.1 GCA002913545_00629 gene open 165-650
1260 PPBR01000046.1 GCA002913545_00630 CDS open 685-1686 _na     333_aa neuB N-acetylneuraminate synthase
1261 PPBR01000046.1 GCA002913545_00631 CDS open 1711-2322 _na     203_aa Acetyltransferase
1262 PPBR01000046.1 GCA002913545_00632 CDS open 2325-3476 _na     383_aa Aminotransferase%2C DegT/DnrJ/EryC1/StrS family
1263 PPBR01000046.1 GCA002913545_00633 CDS open 3463-4650 _na     395_aa UDP-N-acetylglucosamine 4%2C6-dehydratase
1264 PPBR01000046.1 GCA002913545_00634 CDS open 4647-5381 _na     244_aa SAM-dependent methyltransferase
1265 PPBR01000046.1 GCA002913545_00635 CDS open 5387-6970 _na     527_aa argS arginine--tRNA ligase
1266 PPBR01000046.1 GCA002913545_00636 CDS open 6980-7201 _na     73_aa tatA Sec-independent protein translocase protein TatA
1267 PPBR01000046.1 GCA002913545_00637 CDS open 7253-7864 _na     203_aa gmk guanylate kinase
1268 PPBR01000046.1 GCA002913545_00638 CDS open 7865-9433 _na     522_aa Highly acidic protein
1269 PPBR01000046.1 GCA002913545_00639 CDS open 9491-10252 _na     253_aa fliR flagellar biosynthetic protein FliR
1270 PPBR01000046.1 GCA002913545_00640 CDS open 10342-10986 _na     214_aa ABC transporter%2C ATP-binding protein
1271 PPBR01000046.1 GCA002913545_00641 CDS open 10986-12050 _na     354_aa tsf translation elongation factor Ts
1272 PPBR01000046.1 GCA002913545_00642 CDS open 12050-12838 _na     262_aa rpsB 30S ribosomal protein S2
1273 PPBR01000046.1 GCA002913545_00643 CDS open 13016-13570 _na     184_aa hypothetical protein
1274 PPBR01000046.1 GCA002913545_00644 CDS open 13597-13812 _na     71_aa hypothetical protein
1275 PPBR01000046.1 GCA002913545_00645 CDS open 13805-14542 _na     245_aa hypothetical protein
1276 PPBR01000046.1 GCA002913545_00630 gene open 685-1686 neuB
1277 PPBR01000046.1 GCA002913545_00631 gene open 1711-2322
1278 PPBR01000046.1 GCA002913545_00632 gene open 2325-3476
1279 PPBR01000046.1 GCA002913545_00633 gene open 3463-4650
1280 PPBR01000046.1 GCA002913545_00634 gene open 4647-5381
1281 PPBR01000046.1 GCA002913545_00635 gene open 5387-6970 argS
1282 PPBR01000046.1 GCA002913545_00636 gene open 6980-7201 tatA
1283 PPBR01000046.1 GCA002913545_00637 gene open 7253-7864 gmk
1284 PPBR01000046.1 GCA002913545_00638 gene open 7865-9433
1285 PPBR01000046.1 GCA002913545_00639 gene open 9491-10252 fliR
1286 PPBR01000046.1 GCA002913545_00640 gene open 10342-10986
1287 PPBR01000046.1 GCA002913545_00641 gene open 10986-12050 tsf
1288 PPBR01000046.1 GCA002913545_00642 gene open 12050-12838 rpsB
1289 PPBR01000046.1 GCA002913545_00643 gene open 13016-13570
1290 PPBR01000046.1 GCA002913545_00644 gene open 13597-13812
1291 PPBR01000046.1 GCA002913545_00645 gene open 13805-14542
1292 PPBR01000049.1 regulatory_region open 32334-32462 purD RNA motif
1293 PPBR01000049.1 GCA002913545_00646 CDS open 153-1553 _na     466_aa argH argininosuccinate lyase
1294 PPBR01000049.1 GCA002913545_00647 CDS open 1600-2682 _na     360_aa Methyl-accepting transducer domain-containing protein
1295 PPBR01000049.1 GCA002913545_00648 CDS open 2760-3113 _na     117_aa HIT domain-containing protein
1296 PPBR01000049.1 GCA002913545_00649 CDS open 3232-4227 _na     331_aa pheS phenylalanine--tRNA ligase subunit alpha
1297 PPBR01000049.1 GCA002913545_00650 CDS open 4224-6560 _na     778_aa pheT phenylalanine--tRNA ligase subunit beta
1298 PPBR01000049.1 GCA002913545_00651 CDS open 6557-7843 _na     428_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1299 PPBR01000049.1 GCA002913545_00652 CDS open 7824-8648 _na     274_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
1300 PPBR01000049.1 GCA002913545_00653 CDS open 8729-10405 _na     558_aa 30S ribosomal protein S1
1301 PPBR01000049.1 GCA002913545_00654 CDS open 10411-10893 _na     160_aa Periplasmic protein
1302 PPBR01000049.1 GCA002913545_00655 CDS open 10890-12467 _na     525_aa serA phosphoglycerate dehydrogenase
1303 PPBR01000049.1 GCA002913545_00656 CDS open 12489-13055 _na     188_aa efp elongation factor P
1304 PPBR01000049.1 GCA002913545_00657 CDS open 13080-13691 _na     203_aa DUF4304 domain-containing protein
1305 PPBR01000049.1 GCA002913545_00658 CDS open 13681-14787 _na     368_aa Rod shape-determining protein
1306 PPBR01000049.1 GCA002913545_00659 CDS open 14840-15811 _na     323_aa Pseudouridine synthase
1307 PPBR01000049.1 GCA002913545_00660 CDS open 15873-16418 _na     181_aa Fibronectin type-III domain-containing protein
1308 PPBR01000049.1 GCA002913545_00661 CDS open 16537-16950 _na     137_aa Fibronectin type-III domain-containing protein
1309 PPBR01000049.1 GCA002913545_00662 CDS open 16950-18137 _na     395_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1310 PPBR01000049.1 GCA002913545_00663 CDS open 18121-18792 _na     223_aa ftsE Cell division ATP-binding protein FtsE
1311 PPBR01000049.1 GCA002913545_00664 CDS open 18779-19594 _na     271_aa ftsX Cell division protein FtsX
1312 PPBR01000049.1 GCA002913545_00665 CDS open 19591-20808 _na     405_aa Zinc metallopeptidase%2C M23 family
1313 PPBR01000049.1 GCA002913545_00666 CDS open 20882-21598 _na     238_aa pyrH UMP kinase
1314 PPBR01000049.1 GCA002913545_00667 CDS open 21617-21832 _na     71_aa rpoZ DNA-directed RNA polymerase subunit omega
1315 PPBR01000049.1 GCA002913545_00668 CDS open 21819-24008 _na     729_aa PpGpp synthetase/guanosine-3'%2C5'-bis(Diphosphate) 3' pyrophosphohydrolase
1316 PPBR01000049.1 GCA002913545_00669 CDS open 24018-25226 _na     402_aa tyrS tyrosine--tRNA ligase
1317 PPBR01000049.1 GCA002913545_00670 CDS open 25227-26318 _na     363_aa 2-nitropropane dioxygenase
1318 PPBR01000049.1 GCA002913545_00671 CDS open 26315-27760 _na     481_aa N-acetylmuramoyl-L-alanine amidase
1319 PPBR01000049.1 GCA002913545_00672 CDS open 27757-29622 _na     621_aa mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
1320 PPBR01000049.1 GCA002913545_00673 CDS open 29696-30340 _na     214_aa Cupin type-2 domain-containing protein
1321 PPBR01000049.1 GCA002913545_00674 CDS open 30460-31620 _na     386_aa Drug resistance transporter%2C Bcr/CflA family
1322 PPBR01000049.1 GCA002913545_00675 CDS open 31613-32251 _na     212_aa Uroporphyrinogen-III synthase
1323 PPBR01000049.1 GCA002913545_00676 CDS open 32484-33731 _na     415_aa Phosphoribosylamine--glycine ligase
1324 PPBR01000049.1 GCA002913545_00677 CDS open 33728-34177 _na     149_aa RDD domain-containing protein
1325 PPBR01000049.1 GCA002913545_00678 CDS open 34170-36332 _na     720_aa lptD LPS-assembly protein LptD
1326 PPBR01000049.1 GCA002913545_00679 CDS open 36346-37044 _na     232_aa Sodium:proton antiporter
1327 PPBR01000049.1 GCA002913545_00680 CDS open 37034-39232 _na     732_aa pnp polyribonucleotide nucleotidyltransferase
1328 PPBR01000049.1 GCA002913545_00681 CDS open 39251-40102 _na     283_aa uspA UspA domain-containing protein
1329 PPBR01000049.1 GCA002913545_00682 CDS open 40384-40836 _na     150_aa Methyl-accepting transducer domain-containing protein
1330 PPBR01000049.1 GCA002913545_00646 gene open 153-1553 argH
1331 PPBR01000049.1 GCA002913545_00647 gene open 1600-2682
1332 PPBR01000049.1 GCA002913545_00648 gene open 2760-3113
1333 PPBR01000049.1 GCA002913545_00649 gene open 3232-4227 pheS
1334 PPBR01000049.1 GCA002913545_00650 gene open 4224-6560 pheT
1335 PPBR01000049.1 GCA002913545_00651 gene open 6557-7843 aroA
1336 PPBR01000049.1 GCA002913545_00652 gene open 7824-8648 ispH
1337 PPBR01000049.1 GCA002913545_00653 gene open 8729-10405
1338 PPBR01000049.1 GCA002913545_00654 gene open 10411-10893
1339 PPBR01000049.1 GCA002913545_00655 gene open 10890-12467 serA
1340 PPBR01000049.1 GCA002913545_00656 gene open 12489-13055 efp
1341 PPBR01000049.1 GCA002913545_00657 gene open 13080-13691
1342 PPBR01000049.1 GCA002913545_00658 gene open 13681-14787
1343 PPBR01000049.1 GCA002913545_00659 gene open 14840-15811
1344 PPBR01000049.1 GCA002913545_00660 gene open 15873-16418
1345 PPBR01000049.1 GCA002913545_00661 gene open 16537-16950
1346 PPBR01000049.1 GCA002913545_00662 gene open 16950-18137 trmB
1347 PPBR01000049.1 GCA002913545_00663 gene open 18121-18792 ftsE
1348 PPBR01000049.1 GCA002913545_00664 gene open 18779-19594 ftsX
1349 PPBR01000049.1 GCA002913545_00665 gene open 19591-20808
1350 PPBR01000049.1 GCA002913545_00666 gene open 20882-21598 pyrH
1351 PPBR01000049.1 GCA002913545_00667 gene open 21617-21832 rpoZ
1352 PPBR01000049.1 GCA002913545_00668 gene open 21819-24008
1353 PPBR01000049.1 GCA002913545_00669 gene open 24018-25226 tyrS
1354 PPBR01000049.1 GCA002913545_00670 gene open 25227-26318
1355 PPBR01000049.1 GCA002913545_00671 gene open 26315-27760
1356 PPBR01000049.1 GCA002913545_00672 gene open 27757-29622 mnmC
1357 PPBR01000049.1 GCA002913545_00673 gene open 29696-30340
1358 PPBR01000049.1 GCA002913545_00674 gene open 30460-31620
1359 PPBR01000049.1 GCA002913545_00675 gene open 31613-32251
1360 PPBR01000049.1 GCA002913545_00676 gene open 32484-33731
1361 PPBR01000049.1 GCA002913545_00677 gene open 33728-34177
1362 PPBR01000049.1 GCA002913545_00678 gene open 34170-36332 lptD
1363 PPBR01000049.1 GCA002913545_00679 gene open 36346-37044
1364 PPBR01000049.1 GCA002913545_00680 gene open 37034-39232 pnp
1365 PPBR01000049.1 GCA002913545_00681 gene open 39251-40102 uspA
1366 PPBR01000049.1 GCA002913545_00682 gene open 40384-40836
1367 PPBR01000053.1 GCA002913545_00683 CDS open 21-326 _na     101_aa hypothetical protein
1368 PPBR01000053.1 GCA002913545_00683 gene open 21-326
1369 PPBR01000054.1 GCA002913545_00684 CDS open 78-593 _na     171_aa hypothetical protein
1370 PPBR01000054.1 GCA002913545_00684 gene open 78-593
1371 PPBR01000055.1 GCA002913545_00685 CDS open 82-384 _na     100_aa hypothetical protein
1372 PPBR01000055.1 GCA002913545_00686 CDS open 381-1805 _na     474_aa UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanine ligase
1373 PPBR01000055.1 GCA002913545_00687 CDS open 1802-2251 _na     149_aa Beta-lactamase
1374 PPBR01000055.1 GCA002913545_00688 CDS open 3543-4604 _na     353_aa xerH Tyrosine recombinase XerH
1375 PPBR01000055.1 GCA002913545_00689 CDS open 4607-5800 _na     397_aa ackA Acetate kinase
1376 PPBR01000055.1 GCA002913545_00690 CDS open 5802-6761 _na     319_aa pta phosphate acetyltransferase
1377 PPBR01000055.1 GCA002913545_00685 gene open 82-384
1378 PPBR01000055.1 GCA002913545_00686 gene open 381-1805
1379 PPBR01000055.1 GCA002913545_00687 gene open 1802-2251
1380 PPBR01000055.1 GCA002913545_00688 gene open 3543-4604 xerH
1381 PPBR01000055.1 GCA002913545_00689 gene open 4607-5800 ackA
1382 PPBR01000055.1 GCA002913545_00690 gene open 5802-6761 pta
1383 PPBR01000056.1 GCA002913545_00691 CDS open 51-431 _na     126_aa hypothetical protein
1384 PPBR01000056.1 GCA002913545_00691 gene open 51-431
1385 PPBR01000057.1 GCA002913545_00692 CDS open 308-1927 _na     539_aa MobA/VirD2-like nuclease domain-containing protein
1386 PPBR01000057.1 GCA002913545_00693 CDS open 2100-2405 _na     101_aa type II toxin-antitoxin system RelE/ParE family toxin
1387 PPBR01000057.1 GCA002913545_00694 CDS open 2395-2646 _na     83_aa hypothetical protein
1388 PPBR01000057.1 GCA002913545_00695 CDS open 2658-2909 _na     83_aa Lipoprotein
1389 PPBR01000057.1 GCA002913545_00696 CDS open 2994-3191 _na     65_aa hypothetical protein
1390 PPBR01000057.1 GCA002913545_00697 CDS open 3245-3622 _na     125_aa hypothetical protein
1391 PPBR01000057.1 GCA002913545_00698 CDS open 3633-3872 _na     79_aa TIR domain-containing protein
1392 PPBR01000057.1 GCA002913545_00699 CDS open 3883-4122 _na     79_aa hypothetical protein
1393 PPBR01000057.1 GCA002913545_00700 CDS open 4865-6103 _na     412_aa Toprim domain-containing protein
1394 PPBR01000057.1 GCA002913545_00701 CDS open 6100-6336 _na     78_aa trbM Conjugal transfer protein TrbM
1395 PPBR01000057.1 GCA002913545_00702 CDS open 6346-7332 _na     328_aa virB5 Type IV secretion system protein VirB5
1396 PPBR01000057.1 GCA002913545_00703 CDS open 7359-8660 _na     433_aa hypothetical protein
1397 PPBR01000057.1 GCA002913545_00692 gene open 308-1927
1398 PPBR01000057.1 GCA002913545_00693 gene open 2100-2405
1399 PPBR01000057.1 GCA002913545_00694 gene open 2395-2646
1400 PPBR01000057.1 GCA002913545_00695 gene open 2658-2909
1401 PPBR01000057.1 GCA002913545_00696 gene open 2994-3191
1402 PPBR01000057.1 GCA002913545_00697 gene open 3245-3622
1403 PPBR01000057.1 GCA002913545_00698 gene open 3633-3872
1404 PPBR01000057.1 GCA002913545_00699 gene open 3883-4122
1405 PPBR01000057.1 GCA002913545_00700 gene open 4865-6103
1406 PPBR01000057.1 GCA002913545_00701 gene open 6100-6336 trbM
1407 PPBR01000057.1 GCA002913545_00702 gene open 6346-7332 virB5
1408 PPBR01000057.1 GCA002913545_00703 gene open 7359-8660
1409 PPBR01000058.1 GCA002913545_00704 CDS open 32-268 _na     78_aa Bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase
1410 PPBR01000058.1 GCA002913545_00704 gene open 32-268
1411 PPBR01000061.1 GCA002913545_00705 CDS open 213-881 _na     222_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
1412 PPBR01000061.1 GCA002913545_00706 CDS open 868-2175 _na     435_aa Periplasmic protein
1413 PPBR01000061.1 GCA002913545_00707 CDS open 2169-2834 _na     221_aa purQ phosphoribosylformylglycinamidine synthase I
1414 PPBR01000061.1 GCA002913545_00708 CDS open 2831-3067 _na     78_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
1415 PPBR01000061.1 GCA002913545_00709 CDS open 3076-3786 _na     236_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
1416 PPBR01000061.1 GCA002913545_00710 CDS open 3803-5110 _na     435_aa Carboxyl-terminal protease family protein
1417 PPBR01000061.1 GCA002913545_00711 CDS open 5330-7903 _na     857_aa clpB Chaperone protein ClpB
1418 PPBR01000061.1 GCA002913545_00712 CDS open 8008-9546 _na     512_aa Phosphate transporter
1419 PPBR01000061.1 GCA002913545_00713 CDS open 9677-10579 _na     300_aa Ppx/GppA phosphatase N-terminal domain-containing protein
1420 PPBR01000061.1 GCA002913545_00714 CDS open 10610-11041 _na     143_aa Glutamyl-tRNA amidotransferase
1421 PPBR01000061.1 GCA002913545_00715 CDS open 11826-13085 _na     419_aa Signal transduction protein CetA%2C mediates an energy taxis response
1422 PPBR01000061.1 GCA002913545_00716 CDS open 13085-13585 _na     166_aa Signal transduction protein CetB%2C mediates an energy taxis response
1423 PPBR01000061.1 GCA002913545_00717 CDS open 13613-14848 _na     411_aa gspF Type II secretion system protein GspF domain-containing protein
1424 PPBR01000061.1 GCA002913545_00718 CDS open 14845-16596 _na     583_aa Bacterial type II secretion system protein E domain-containing protein
1425 PPBR01000061.1 GCA002913545_00719 CDS open 16596-17135 _na     179_aa Periplasmic protein
1426 PPBR01000061.1 GCA002913545_00720 CDS open 17132-18007 _na     291_aa Transformation system protein
1427 PPBR01000061.1 GCA002913545_00721 CDS open 18000-18827 _na     275_aa AAA+ ATPase domain-containing protein
1428 PPBR01000061.1 GCA002913545_00722 CDS open 18820-20346 _na     508_aa mshL pilus (MSHA type) biogenesis protein MshL
1429 PPBR01000061.1 GCA002913545_00723 CDS open 20324-20734 _na     136_aa Transformation system protein
1430 PPBR01000061.1 GCA002913545_00724 CDS open 20734-21381 _na     215_aa pilO Pilus assembly protein PilO
1431 PPBR01000061.1 GCA002913545_00725 CDS open 21378-22901 _na     507_aa C4-dicarboxylate ABC transporter
1432 PPBR01000061.1 GCA002913545_00726 CDS open 22960-23829 _na     289_aa era GTPase Era
1433 PPBR01000061.1 GCA002913545_00727 CDS open 23826-25148 _na     440_aa hslU HslU--HslV peptidase ATPase subunit
1434 PPBR01000061.1 GCA002913545_00728 CDS open 25157-25690 _na     177_aa hslV ATP-dependent protease subunit HslV
1435 PPBR01000061.1 GCA002913545_00729 CDS open 25691-26137 _na     148_aa rplI 50S ribosomal protein L9
1436 PPBR01000061.1 GCA002913545_00730 CDS open 26161-27384 _na     407_aa argG argininosuccinate synthase
1437 PPBR01000061.1 GCA002913545_00731 CDS open 27608-28612 _na     334_aa TonB-dependent receptor plug domain-containing protein
1438 PPBR01000061.1 GCA002913545_00732 CDS open 28708-29706 _na     332_aa Colicin I receptor
1439 PPBR01000061.1 GCA002913545_00733 CDS open 29700-30527 _na     275_aa iroE IroE protein
1440 PPBR01000061.1 GCA002913545_00734 CDS open 30561-30806 _na     81_aa RNA-binding S4 domain-containing protein
1441 PPBR01000061.1 GCA002913545_00735 CDS open 30806-31204 _na     132_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1442 PPBR01000061.1 GCA002913545_00736 CDS open 31197-31925 _na     242_aa lptB LPS export ABC transporter ATP-binding protein
1443 PPBR01000061.1 GCA002913545_00737 CDS open 31929-33179 _na     416_aa RNA polymerase factor sigma-54
1444 PPBR01000061.1 GCA002913545_00738 CDS open 33180-33938 _na     252_aa hypothetical protein
1445 PPBR01000061.1 GCA002913545_00739 CDS open 34056-34790 _na     244_aa Imidazole glycerol phosphate synthase
1446 PPBR01000061.1 GCA002913545_00740 CDS open 34782-35804 _na     340_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1447 PPBR01000061.1 GCA002913545_00741 CDS open 35801-36961 _na     386_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1448 PPBR01000061.1 GCA002913545_00742 CDS open 37053-37841 _na     262_aa murI glutamate racemase
1449 PPBR01000061.1 GCA002913545_00743 CDS open 37911-38501 _na     196_aa VTT domain-containing protein
1450 PPBR01000061.1 GCA002913545_00744 CDS open 38659-39438 _na     259_aa DL-methionine ABC transporter MetINQ%2C substrate-binding protein
1451 PPBR01000061.1 GCA002913545_00745 CDS open 39515-40297 _na     260_aa DL-methionine ABC transporter MetINQ%2C substrate-binding protein
1452 PPBR01000061.1 GCA002913545_00746 CDS open 40556-41230 _na     224_aa ABC transmembrane type-1 domain-containing protein
1453 PPBR01000061.1 GCA002913545_00747 CDS open 41230-42186 _na     318_aa DL-methionine ABC transporter MetINQ%2C ATP-binding protein
1454 PPBR01000061.1 GCA002913545_00748 CDS open 42219-43205 _na     328_aa diaminopimelate dehydrogenase
1455 PPBR01000061.1 GCA002913545_00749 CDS open 43349-45970 _na     873_aa valine--tRNA ligase
1456 PPBR01000061.1 GCA002913545_00750 CDS open 46092-51215 _na     1707_aa Alpha-2-macroglobulin
1457 PPBR01000061.1 GCA002913545_00751 CDS open 51217-53385 _na     722_aa pbpC penicillin-binding protein 1C
1458 PPBR01000061.1 GCA002913545_00752 CDS open 53451-55484 _na     677_aa DNA 3'-5' helicase
1459 PPBR01000061.1 GCA002913545_00753 CDS open 55538-56734 _na     398_aa Efflux transporter periplasmic adaptor subunit
1460 PPBR01000061.1 GCA002913545_00754 CDS open 56735-58663 _na     642_aa pvdT Pyoverdine export ATP-binding/permease protein PvdT
1461 PPBR01000061.1 GCA002913545_00755 CDS open 58665-60011 _na     448_aa TolC-like outer membrane efflux protein
1462 PPBR01000061.1 GCA002913545_00756 CDS open 60016-60507 _na     163_aa Flagellar protein
1463 PPBR01000061.1 GCA002913545_00757 CDS open 61561-62076 _na     171_aa Phosphohistidine phosphatase
1464 PPBR01000061.1 GCA002913545_00758 CDS open 62073-62885 _na     270_aa Ferritin
1465 PPBR01000061.1 GCA002913545_00759 CDS open 62872-63447 _na     191_aa Peptidase S54 rhomboid domain-containing protein
1466 PPBR01000061.1 GCA002913545_00760 CDS open 63431-64111 _na     226_aa NlpC/P60 domain-containing protein
1467 PPBR01000061.1 GCA002913545_00761 CDS open 64250-65518 _na     422_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
1468 PPBR01000061.1 GCA002913545_00762 CDS open 65521-66681 _na     386_aa Molybdopterin molybdenumtransferase
1469 PPBR01000061.1 GCA002913545_00764 CDS open 67675-68226 _na     183_aa ubiX Flavin prenyltransferase UbiX
1470 PPBR01000061.1 GCA002913545_00765 CDS open 68223-68693 _na     156_aa coaD pantetheine-phosphate adenylyltransferase
1471 PPBR01000061.1 GCA002913545_00766 CDS open 68695-69282 _na     195_aa tmk dTMP kinase
1472 PPBR01000061.1 GCA002913545_00767 CDS open 69312-70538 _na     408_aa hisS histidine--tRNA ligase
1473 PPBR01000061.1 GCA002913545_00768 CDS open 70535-72370 _na     611_aa speA biosynthetic arginine decarboxylase
1474 PPBR01000061.1 GCA002913545_00769 CDS open 72382-73560 _na     392_aa Aspartate aminotransferase%2C aminotransferase%2C classes I and II
1475 PPBR01000061.1 GCA002913545_00770 CDS open 73560-73763 _na     67_aa thiS sulfur carrier protein ThiS
1476 PPBR01000061.1 GCA002913545_00771 CDS open 73771-74622 _na     283_aa thiF sulfur carrier protein ThiS adenylyltransferase ThiF
1477 PPBR01000061.1 GCA002913545_00772 CDS open 74623-75387 _na     254_aa thiazole synthase
1478 PPBR01000061.1 GCA002913545_00773 CDS open 75387-76541 _na     384_aa thiH 2-iminoacetate synthase ThiH
1479 PPBR01000061.1 GCA002913545_00774 CDS open 76534-77142 _na     202_aa Thiamin-phosphate pyrophosphorylase
1480 PPBR01000061.1 GCA002913545_00705 gene open 213-881
1481 PPBR01000061.1 GCA002913545_00706 gene open 868-2175
1482 PPBR01000061.1 GCA002913545_00707 gene open 2169-2834 purQ
1483 PPBR01000061.1 GCA002913545_00708 gene open 2831-3067 purS
1484 PPBR01000061.1 GCA002913545_00709 gene open 3076-3786 purC
1485 PPBR01000061.1 GCA002913545_00710 gene open 3803-5110
1486 PPBR01000061.1 GCA002913545_00711 gene open 5330-7903 clpB
1487 PPBR01000061.1 GCA002913545_00712 gene open 8008-9546
1488 PPBR01000061.1 GCA002913545_00713 gene open 9677-10579
1489 PPBR01000061.1 GCA002913545_00714 gene open 10610-11041
1490 PPBR01000061.1 GCA002913545_00715 gene open 11826-13085
1491 PPBR01000061.1 GCA002913545_00716 gene open 13085-13585
1492 PPBR01000061.1 GCA002913545_00717 gene open 13613-14848 gspF
1493 PPBR01000061.1 GCA002913545_00718 gene open 14845-16596
1494 PPBR01000061.1 GCA002913545_00719 gene open 16596-17135
1495 PPBR01000061.1 GCA002913545_00720 gene open 17132-18007
1496 PPBR01000061.1 GCA002913545_00721 gene open 18000-18827
1497 PPBR01000061.1 GCA002913545_00722 gene open 18820-20346 mshL
1498 PPBR01000061.1 GCA002913545_00723 gene open 20324-20734
1499 PPBR01000061.1 GCA002913545_00724 gene open 20734-21381 pilO
1500 PPBR01000061.1 GCA002913545_00725 gene open 21378-22901