HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_002913545.1)

Select a Genome:
BAKTA Annotations for GCA_002913545.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
133 1887759 1845 3 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3788 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3788 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 PPBR01000101.1 GCA002913545_01250 CDS open 608-2071 _na     487_aa FAD-binding protein
2502 PPBR01000101.1 GCA002913545_01251 CDS open 2081-3046 _na     321_aa sdhB 8-methylmenaquinol:fumarate reductase iron-sulfur subunit
2503 PPBR01000101.1 GCA002913545_01252 CDS open 3049-3906 _na     285_aa sdhE 8-methylmenaquinol:fumarate reductase membrane anchor subunit
2504 PPBR01000101.1 GCA002913545_01253 CDS open 4013-5869 _na     618_aa htpG molecular chaperone HtpG
2505 PPBR01000101.1 GCA002913545_01249 gene open 232-594
2506 PPBR01000101.1 GCA002913545_01250 gene open 608-2071
2507 PPBR01000101.1 GCA002913545_01251 gene open 2081-3046 sdhB
2508 PPBR01000101.1 GCA002913545_01252 gene open 3049-3906 sdhE
2509 PPBR01000101.1 GCA002913545_01253 gene open 4013-5869 htpG
2510 PPBR01000102.1 GCA002913545_01254 CDS open 310-801 _na     163_aa hypothetical protein
2511 PPBR01000102.1 GCA002913545_01254 gene open 310-801
2512 PPBR01000103.1 repeat_region open 22152-22647 CRISPR array with 7 repeats of length 37%2C consensus sequence GTTTCAATCCCCTAGATCGGGGAAATTTGTATCAGAT and spacer length 38
2513 PPBR01000103.1 repeat_region open 22678-23061 CRISPR array with 5 repeats of length 33%2C consensus sequence GTTTCAATCCCCTAGATCGGGGAAATTTGTATC and spacer length 44
2514 PPBR01000103.1 repeat_region open 23366-23878 CRISPR array with 7 repeats of length 33%2C consensus sequence GTTTCAATCCCCTAGATCGGGGAAATTTGTATC and spacer length 45
2515 PPBR01000103.1 GCA002913545_01255 CDS open 248-2002 _na     584_aa Response regulator
2516 PPBR01000103.1 GCA002913545_01256 CDS open 2093-3274 _na     393_aa DUF4885 domain-containing protein
2517 PPBR01000103.1 GCA002913545_01257 CDS open 3301-4104 _na     267_aa hypothetical protein
2518 PPBR01000103.1 GCA002913545_01258 CDS open 4118-4909 _na     263_aa Cell surface protein
2519 PPBR01000103.1 GCA002913545_01259 CDS open 4925-6091 _na     388_aa DUF4885 domain-containing protein
2520 PPBR01000103.1 GCA002913545_01260 CDS open 6104-6895 _na     263_aa Cell surface protein
2521 PPBR01000103.1 GCA002913545_01261 CDS open 7000-8106 _na     368_aa Cj0814 family flagellar-dependent secreted protein
2522 PPBR01000103.1 GCA002913545_01262 CDS open 8498-8908 _na     136_aa Bacteriocin-type signal sequence domain-containing protein
2523 PPBR01000103.1 GCA002913545_01263 CDS open 8934-9746 _na     270_aa Cell surface protein
2524 PPBR01000103.1 GCA002913545_01264 CDS open 9817-10524 _na     235_aa hypothetical protein
2525 PPBR01000103.1 GCA002913545_01265 CDS open 10597-11697 _na     366_aa flgG Flagellar biosynthesis protein FlgG
2526 PPBR01000103.1 GCA002913545_01266 CDS open 12334-13929 _na     531_aa Mobilization protein
2527 PPBR01000103.1 GCA002913545_01267 CDS open 13977-14306 _na     109_aa Bacterial mobilisation domain-containing protein
2528 PPBR01000103.1 GCA002913545_01268 CDS open 14652-14939 _na     95_aa relE Toxin-antitoxin system%2C toxin component%2C RelE family
2529 PPBR01000103.1 GCA002913545_01269 CDS open 14929-15180 _na     83_aa Antitoxin
2530 PPBR01000103.1 GCA002913545_01270 CDS open 15235-17043 _na     602_aa Tyr recombinase domain-containing protein
2531 PPBR01000103.1 GCA002913545_01271 CDS open 17630-18631 _na     333_aa Transcriptional regulator
2532 PPBR01000103.1 GCA002913545_01272 CDS open 18631-19011 _na     126_aa csx20 CRISPR-associated protein Csx20
2533 PPBR01000103.1 GCA002913545_01273 CDS open 19008-20288 _na     426_aa csx2 TIGR02221 family CRISPR-associated protein
2534 PPBR01000103.1 GCA002913545_01274 CDS open 20290-21084 _na     264_aa CRISPR-associated protein
2535 PPBR01000103.1 GCA002913545_01275 CDS open 21232-21900 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
2536 PPBR01000103.1 GCA002913545_01276 CDS open 24301-24573 _na     90_aa cas2 CRISPR-associated endonuclease Cas2
2537 PPBR01000103.1 GCA002913545_01277 CDS open 24570-26765 _na     731_aa cas1 CRISPR-associated endonuclease Cas1
2538 PPBR01000103.1 GCA002913545_01278 CDS open 26824-27327 _na     167_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
2539 PPBR01000103.1 GCA002913545_01279 CDS open 27406-27636 _na     76_aa hypothetical protein
2540 PPBR01000103.1 GCA002913545_01280 CDS open 28156-29271 _na     371_aa GTPase
2541 PPBR01000103.1 GCA002913545_01281 CDS open 29275-30840 _na     521_aa GTP-binding protein
2542 PPBR01000103.1 GCA002913545_01282 CDS open 30901-31800 _na     299_aa hypothetical protein
2543 PPBR01000103.1 GCA002913545_01283 CDS open 31921-32619 _na     232_aa Periplasmic protein
2544 PPBR01000103.1 GCA002913545_01284 CDS open 32896-33105 _na     69_aa hypothetical protein
2545 PPBR01000103.1 GCA002913545_01285 CDS open 33110-34213 _na     367_aa HP0729 family protein
2546 PPBR01000103.1 GCA002913545_01286 CDS open 34210-34812 _na     200_aa ftsZ Cell division protein FtsZ
2547 PPBR01000103.1 GCA002913545_01287 CDS open 34921-35796 _na     291_aa Putative transcriptional regulator
2548 PPBR01000103.1 GCA002913545_01288 CDS open 36344-36646 _na     100_aa hypothetical protein
2549 PPBR01000103.1 GCA002913545_01289 CDS open 36624-37169 _na     181_aa Chemotaxis protein
2550 PPBR01000103.1 GCA002913545_01255 gene open 248-2002
2551 PPBR01000103.1 GCA002913545_01256 gene open 2093-3274
2552 PPBR01000103.1 GCA002913545_01257 gene open 3301-4104
2553 PPBR01000103.1 GCA002913545_01258 gene open 4118-4909
2554 PPBR01000103.1 GCA002913545_01259 gene open 4925-6091
2555 PPBR01000103.1 GCA002913545_01260 gene open 6104-6895
2556 PPBR01000103.1 GCA002913545_01261 gene open 7000-8106
2557 PPBR01000103.1 GCA002913545_01262 gene open 8498-8908
2558 PPBR01000103.1 GCA002913545_01263 gene open 8934-9746
2559 PPBR01000103.1 GCA002913545_01264 gene open 9817-10524
2560 PPBR01000103.1 GCA002913545_01265 gene open 10597-11697 flgG
2561 PPBR01000103.1 GCA002913545_01266 gene open 12334-13929
2562 PPBR01000103.1 GCA002913545_01267 gene open 13977-14306
2563 PPBR01000103.1 GCA002913545_01268 gene open 14652-14939 relE
2564 PPBR01000103.1 GCA002913545_01269 gene open 14929-15180
2565 PPBR01000103.1 GCA002913545_01270 gene open 15235-17043
2566 PPBR01000103.1 GCA002913545_01271 gene open 17630-18631
2567 PPBR01000103.1 GCA002913545_01272 gene open 18631-19011 csx20
2568 PPBR01000103.1 GCA002913545_01273 gene open 19008-20288 csx2
2569 PPBR01000103.1 GCA002913545_01274 gene open 20290-21084
2570 PPBR01000103.1 GCA002913545_01275 gene open 21232-21900
2571 PPBR01000103.1 GCA002913545_01276 gene open 24301-24573 cas2
2572 PPBR01000103.1 GCA002913545_01277 gene open 24570-26765 cas1
2573 PPBR01000103.1 GCA002913545_01278 gene open 26824-27327
2574 PPBR01000103.1 GCA002913545_01279 gene open 27406-27636
2575 PPBR01000103.1 GCA002913545_01280 gene open 28156-29271
2576 PPBR01000103.1 GCA002913545_01281 gene open 29275-30840
2577 PPBR01000103.1 GCA002913545_01282 gene open 30901-31800
2578 PPBR01000103.1 GCA002913545_01283 gene open 31921-32619
2579 PPBR01000103.1 GCA002913545_01284 gene open 32896-33105
2580 PPBR01000103.1 GCA002913545_01285 gene open 33110-34213
2581 PPBR01000103.1 GCA002913545_01286 gene open 34210-34812 ftsZ
2582 PPBR01000103.1 GCA002913545_01287 gene open 34921-35796
2583 PPBR01000103.1 GCA002913545_01288 gene open 36344-36646
2584 PPBR01000103.1 GCA002913545_01289 gene open 36624-37169
2585 PPBR01000104.1 GCA002913545_01290 CDS open 128-3388 _na     1086_aa carB carbamoyl-phosphate synthase large subunit
2586 PPBR01000104.1 GCA002913545_01291 CDS open 3388-4143 _na     251_aa mreC rod shape-determining protein MreC
2587 PPBR01000104.1 GCA002913545_01292 CDS open 4133-5170 _na     345_aa mreB Cell shape-determining protein MreB
2588 PPBR01000104.1 GCA002913545_01293 CDS open 5180-6412 _na     410_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
2589 PPBR01000104.1 GCA002913545_01294 CDS open 6412-7200 _na     262_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2590 PPBR01000104.1 GCA002913545_01295 CDS open 7225-7671 _na     148_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2591 PPBR01000104.1 GCA002913545_01296 CDS open 7782-8858 _na     358_aa queH Epoxyqueuosine reductase QueH
2592 PPBR01000104.1 GCA002913545_01297 CDS open 8885-9634 _na     249_aa ABC transporter domain-containing protein
2593 PPBR01000104.1 GCA002913545_01298 CDS open 9631-10311 _na     226_aa ABC transporter domain-containing protein
2594 PPBR01000104.1 GCA002913545_01299 CDS open 10308-11108 _na     266_aa ABC transmembrane type-1 domain-containing protein
2595 PPBR01000104.1 GCA002913545_01300 CDS open 11105-12043 _na     312_aa ABC transmembrane type-1 domain-containing protein
2596 PPBR01000104.1 GCA002913545_01301 CDS open 12056-13588 _na     510_aa Solute-binding protein family 5 domain-containing protein
2597 PPBR01000104.1 GCA002913545_01302 CDS open 13635-17084 _na     1149_aa Diaminopimelate epimerase
2598 PPBR01000104.1 GCA002913545_01303 CDS open 17081-17485 _na     134_aa 50S ribosomal protein L20
2599 PPBR01000104.1 GCA002913545_01304 CDS open 17599-17802 _na     67_aa Tautomerase
2600 PPBR01000104.1 GCA002913545_01305 CDS open 17799-18296 _na     165_aa bcp thioredoxin-dependent thiol peroxidase
2601 PPBR01000104.1 GCA002913545_01306 CDS open 18306-18947 _na     213_aa dsbA Thiol:disulfide interchange protein DsbA
2602 PPBR01000104.1 GCA002913545_01307 CDS open 19053-19967 _na     304_aa branched-chain amino acid transaminase
2603 PPBR01000104.1 GCA002913545_01308 CDS open 19984-21096 _na     370_aa Band 7 domain-containing protein
2604 PPBR01000104.1 GCA002913545_01309 CDS open 21099-21833 _na     244_aa hisIE bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE
2605 PPBR01000104.1 GCA002913545_01310 CDS open 21823-22353 _na     176_aa Integral membrane protein
2606 PPBR01000104.1 GCA002913545_01311 CDS open 22353-22904 _na     183_aa DUF2393 domain-containing protein
2607 PPBR01000104.1 GCA002913545_01312 CDS open 23066-24397 _na     443_aa acetyl-CoA carboxylase biotin carboxylase subunit
2608 PPBR01000104.1 GCA002913545_01313 CDS open 24397-24849 _na     150_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
2609 PPBR01000104.1 GCA002913545_01314 CDS open 25126-25551 _na     141_aa ComEA protein
2610 PPBR01000104.1 GCA002913545_01315 CDS open 25982-26323 _na     113_aa ftsZ Cell division protein FtsZ
2611 PPBR01000104.1 GCA002913545_01316 CDS open 26326-27648 _na     440_aa NFACT RNA-binding domain-containing protein
2612 PPBR01000104.1 GCA002913545_01317 CDS open 27847-29373 _na     508_aa TonB-dependent siderophore receptor
2613 PPBR01000104.1 GCA002913545_01318 CDS open 29435-29980 _na     181_aa TonB-dependent siderophore receptor
2614 PPBR01000104.1 GCA002913545_01319 CDS open 30064-31329 _na     421_aa leuC 3-isopropylmalate dehydratase large subunit
2615 PPBR01000104.1 GCA002913545_01320 CDS open 31643-31900 _na     85_aa eamA EamA domain-containing protein
2616 PPBR01000104.1 GCA002913545_01321 CDS open 32100-32663 _na     187_aa Molybdenum cofactor guanylyltransferase protein A
2617 PPBR01000104.1 GCA002913545_01322 CDS open 32671-33618 _na     315_aa phospholipase A
2618 PPBR01000104.1 GCA002913545_01323 CDS open 33784-35178 _na     464_aa Gluconate:H+ symporter (GntP) family transporter
2619 PPBR01000104.1 GCA002913545_01324 CDS open 35175-36305 _na     376_aa Glycerate kinase
2620 PPBR01000104.1 GCA002913545_01325 CDS open 36511-38010 _na     499_aa Flagellin
2621 PPBR01000104.1 GCA002913545_01326 CDS open 38292-40358 _na     688_aa Motility accessory factor
2622 PPBR01000104.1 GCA002913545_01327 CDS open 40355-41386 _na     343_aa pseI pseudaminic acid synthase
2623 PPBR01000104.1 GCA002913545_01328 CDS open 41390-41848 _na     152_aa pseH UDP-4-amino-4%2C6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase
2624 PPBR01000104.1 GCA002913545_01329 CDS open 41833-42705 _na     290_aa pseG UDP-2%2C4-diacetamido-2%2C4%2C6-trideoxy-beta-L-altropyranose hydrolase
2625 PPBR01000104.1 GCA002913545_01330 CDS open 42706-43383 _na     225_aa pseF pseudaminic acid cytidylyltransferase
2626 PPBR01000104.1 GCA002913545_01331 CDS open 43387-44499 _na     370_aa pseC UDP-4-amino-4%2C6-dideoxy-N-acetyl-beta-L-altrosamine transaminase
2627 PPBR01000104.1 GCA002913545_01332 CDS open 44496-45491 _na     331_aa pseB UDP-N-acetylglucosamine 4%2C6-dehydratase (inverting)
2628 PPBR01000104.1 GCA002913545_01333 CDS open 45707-46267 _na     186_aa dcd dCTP deaminase
2629 PPBR01000104.1 GCA002913545_01334 CDS open 46391-47233 _na     280_aa Hydrogenase
2630 PPBR01000104.1 GCA002913545_01335 CDS open 47254-47796 _na     180_aa ycxB YcxB family protein
2631 PPBR01000104.1 GCA002913545_01336 CDS open 47891-48277 _na     128_aa hypothetical protein
2632 PPBR01000104.1 GCA002913545_01290 gene open 128-3388 carB
2633 PPBR01000104.1 GCA002913545_01291 gene open 3388-4143 mreC
2634 PPBR01000104.1 GCA002913545_01292 gene open 4133-5170 mreB
2635 PPBR01000104.1 GCA002913545_01293 gene open 5180-6412 clpX
2636 PPBR01000104.1 GCA002913545_01294 gene open 6412-7200 lpxA
2637 PPBR01000104.1 GCA002913545_01295 gene open 7225-7671 fabZ
2638 PPBR01000104.1 GCA002913545_01296 gene open 7782-8858 queH
2639 PPBR01000104.1 GCA002913545_01297 gene open 8885-9634
2640 PPBR01000104.1 GCA002913545_01298 gene open 9631-10311
2641 PPBR01000104.1 GCA002913545_01299 gene open 10308-11108
2642 PPBR01000104.1 GCA002913545_01300 gene open 11105-12043
2643 PPBR01000104.1 GCA002913545_01301 gene open 12056-13588
2644 PPBR01000104.1 GCA002913545_01302 gene open 13635-17084
2645 PPBR01000104.1 GCA002913545_01303 gene open 17081-17485
2646 PPBR01000104.1 GCA002913545_01304 gene open 17599-17802
2647 PPBR01000104.1 GCA002913545_01305 gene open 17799-18296 bcp
2648 PPBR01000104.1 GCA002913545_01306 gene open 18306-18947 dsbA
2649 PPBR01000104.1 GCA002913545_01307 gene open 19053-19967
2650 PPBR01000104.1 GCA002913545_01308 gene open 19984-21096
2651 PPBR01000104.1 GCA002913545_01309 gene open 21099-21833 hisIE
2652 PPBR01000104.1 GCA002913545_01310 gene open 21823-22353
2653 PPBR01000104.1 GCA002913545_01311 gene open 22353-22904
2654 PPBR01000104.1 GCA002913545_01312 gene open 23066-24397
2655 PPBR01000104.1 GCA002913545_01313 gene open 24397-24849 accB
2656 PPBR01000104.1 GCA002913545_01314 gene open 25126-25551
2657 PPBR01000104.1 GCA002913545_01315 gene open 25982-26323 ftsZ
2658 PPBR01000104.1 GCA002913545_01316 gene open 26326-27648
2659 PPBR01000104.1 GCA002913545_01317 gene open 27847-29373
2660 PPBR01000104.1 GCA002913545_01318 gene open 29435-29980
2661 PPBR01000104.1 GCA002913545_01319 gene open 30064-31329 leuC
2662 PPBR01000104.1 GCA002913545_01320 gene open 31643-31900 eamA
2663 PPBR01000104.1 GCA002913545_01321 gene open 32100-32663
2664 PPBR01000104.1 GCA002913545_01322 gene open 32671-33618
2665 PPBR01000104.1 GCA002913545_01323 gene open 33784-35178
2666 PPBR01000104.1 GCA002913545_01324 gene open 35175-36305
2667 PPBR01000104.1 GCA002913545_01325 gene open 36511-38010
2668 PPBR01000104.1 GCA002913545_01326 gene open 38292-40358
2669 PPBR01000104.1 GCA002913545_01327 gene open 40355-41386 pseI
2670 PPBR01000104.1 GCA002913545_01328 gene open 41390-41848 pseH
2671 PPBR01000104.1 GCA002913545_01329 gene open 41833-42705 pseG
2672 PPBR01000104.1 GCA002913545_01330 gene open 42706-43383 pseF
2673 PPBR01000104.1 GCA002913545_01331 gene open 43387-44499 pseC
2674 PPBR01000104.1 GCA002913545_01332 gene open 44496-45491 pseB
2675 PPBR01000104.1 GCA002913545_01333 gene open 45707-46267 dcd
2676 PPBR01000104.1 GCA002913545_01334 gene open 46391-47233
2677 PPBR01000104.1 GCA002913545_01335 gene open 47254-47796 ycxB
2678 PPBR01000104.1 GCA002913545_01336 gene open 47891-48277
2679 PPBR01000105.1 GCA002913545_01337 CDS open 99-419 _na     106_aa hypothetical protein
2680 PPBR01000105.1 GCA002913545_01337 gene open 99-419
2681 PPBR01000107.1 GCA002913545_01338 CDS open 657-1958 _na     433_aa Major facilitator superfamily (MFS) profile domain-containing protein
2682 PPBR01000107.1 GCA002913545_01339 CDS open 2072-2713 _na     213_aa dITP/XTP pyrophosphatase
2683 PPBR01000107.1 GCA002913545_01340 CDS open 2706-3428 _na     240_aa tetratricopeptide repeat protein
2684 PPBR01000107.1 GCA002913545_01341 CDS open 3522-4733 _na     403_aa Saccharopine dehydrogenase
2685 PPBR01000107.1 GCA002913545_01342 CDS open 5144-6310 _na     388_aa Putative transporter
2686 PPBR01000107.1 GCA002913545_01343 CDS open 6391-7938 _na     515_aa rmuC DNA recombination protein RmuC
2687 PPBR01000107.1 GCA002913545_01344 CDS open 8367-10202 _na     611_aa Arylsulfate sulfotransferase
2688 PPBR01000107.1 GCA002913545_01345 CDS open 10261-10857 _na     198_aa hypothetical protein
2689 PPBR01000107.1 GCA002913545_01346 CDS open 10889-11677 _na     262_aa shikimate dehydrogenase
2690 PPBR01000107.1 GCA002913545_01347 CDS open 11674-12615 _na     313_aa SPOR domain-containing protein
2691 PPBR01000107.1 GCA002913545_01348 CDS open 12625-13167 _na     180_aa DUF1882 domain-containing protein
2692 PPBR01000107.1 GCA002913545_01349 CDS open 13167-14411 _na     414_aa glyA Serine hydroxymethyltransferase
2693 PPBR01000107.1 GCA002913545_01350 CDS open 14408-15919 _na     503_aa lysS lysine--tRNA ligase
2694 PPBR01000107.1 GCA002913545_01351 CDS open 15921-16388 _na     155_aa Ferric uptake regulation protein
2695 PPBR01000107.1 GCA002913545_01352 CDS open 16391-17002 _na     203_aa cvpA Membrane protein%2C CvpA family
2696 PPBR01000107.1 GCA002913545_01353 CDS open 17002-18135 _na     377_aa pilT Type IV pili twitching motility protein PilT
2697 PPBR01000107.1 GCA002913545_01354 CDS open 18140-18427 _na     95_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
2698 PPBR01000107.1 GCA002913545_01355 CDS open 18552-19115 _na     187_aa Tetratricopeptide repeat-like domain-containing protein
2699 PPBR01000107.1 GCA002913545_01356 CDS open 19115-20122 _na     335_aa L-seryl-tRNA selenium transferase
2700 PPBR01000107.1 GCA002913545_01357 CDS open 20119-20451 _na     110_aa hypothetical protein
2701 PPBR01000107.1 GCA002913545_01358 CDS open 20438-21067 _na     209_aa type III pantothenate kinase
2702 PPBR01000107.1 GCA002913545_01359 CDS open 21064-21678 _na     204_aa hisG ATP phosphoribosyltransferase
2703 PPBR01000107.1 GCA002913545_01360 CDS open 21682-22026 _na     114_aa DUF6980 domain-containing protein
2704 PPBR01000107.1 GCA002913545_01361 CDS open 22427-23752 _na     441_aa Cysteine sulfinate desulfinase
2705 PPBR01000107.1 GCA002913545_01362 CDS open 23840-24028 _na     62_aa Sodium-dependent tyrosine transporter
2706 PPBR01000107.1 GCA002913545_01363 CDS open 24054-24797 _na     247_aa HTH lysR-type domain-containing protein
2707 PPBR01000107.1 GCA002913545_01364 CDS open 24790-25572 _na     260_aa fdhD formate dehydrogenase accessory sulfurtransferase FdhD
2708 PPBR01000107.1 GCA002913545_01365 CDS open 25792-26433 _na     213_aa fdh3B formate dehydrogenase FDH3 subunit beta
2709 PPBR01000107.1 GCA002913545_01366 CDS open 26435-28657 _na     740_aa Fumarate hydratase
2710 PPBR01000107.1 GCA002913545_01367 CDS open 28706-29260 _na     184_aa Formate dehydrogenase N%2C alpha subunit%2C selenocysteine-containing
2711 PPBR01000107.1 GCA002913545_01368 CDS open 29291-29464 _na     57_aa Tat pathway signal protein
2712 PPBR01000107.1 GCA002913545_01369 CDS open 29454-30149 _na     231_aa Formate dehydrogenase-specific chaperone
2713 PPBR01000107.1 GCA002913545_01370 CDS open 30395-31348 _na     317_aa tupC tungstate ABC transporter ATP-binding protein TupC
2714 PPBR01000107.1 GCA002913545_01371 CDS open 31358-32050 _na     230_aa tupB tungstate ABC transporter permease TupB
2715 PPBR01000107.1 GCA002913545_01372 CDS open 32126-32944 _na     272_aa tupA tungstate ABC transporter substrate-binding protein TupA
2716 PPBR01000107.1 GCA002913545_01375 CDS open 33427-39267 _na     1946_aa PA14 domain-containing protein
2717 PPBR01000107.1 GCA002913545_01376 CDS open 39390-40607 _na     405_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
2718 PPBR01000107.1 GCA002913545_01377 CDS open 40611-41126 _na     171_aa Phage protein
2719 PPBR01000107.1 GCA002913545_01378 CDS open 41130-42194 _na     354_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
2720 PPBR01000107.1 GCA002913545_01379 CDS open 42274-43737 _na     487_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
2721 PPBR01000107.1 GCA002913545_01380 CDS open 43774-44517 _na     247_aa fabG 3-oxoacyl-ACP reductase FabG
2722 PPBR01000107.1 GCA002913545_01381 CDS open 44604-44837 _na     77_aa acpP acyl carrier protein
2723 PPBR01000107.1 GCA002913545_01382 CDS open 44872-46083 _na     403_aa beta-ketoacyl-ACP synthase II
2724 PPBR01000107.1 GCA002913545_01383 CDS open 46085-47020 _na     311_aa accA acetyl-CoA carboxylase carboxyl transferase subunit alpha
2725 PPBR01000107.1 GCA002913545_01384 CDS open 47225-48079 _na     284_aa Colicin E2 tolerance protein CbrC-like protein
2726 PPBR01000107.1 GCA002913545_01385 CDS open 48091-48933 _na     280_aa Peptide methionine sulfoxide reductase
2727 PPBR01000107.1 GCA002913545_01386 CDS open 49444-49668 _na     74_aa hypothetical protein
2728 PPBR01000107.1 GCA002913545_01387 CDS open 49964-50419 _na     151_aa cupin domain-containing protein
2729 PPBR01000107.1 GCA002913545_01388 CDS open 50538-51107 _na     189_aa flavodoxin
2730 PPBR01000107.1 GCA002913545_01389 CDS open 51254-51742 _na     162_aa Aldo/keto reductase
2731 PPBR01000107.1 GCA002913545_01390 CDS open 51746-52105 _na     119_aa 2%2C5-diketo-D-gluconic acid reductase
2732 PPBR01000107.1 GCA002913545_01391 CDS open 52160-53242 _na     360_aa Dienelactone hydrolase domain-containing protein
2733 PPBR01000107.1 GCA002913545_01392 CDS open 53435-54343 _na     302_aa HTH araC/xylS-type domain-containing protein
2734 PPBR01000107.1 GCA002913545_01393 CDS open 54447-55061 _na     204_aa riboflavin synthase
2735 PPBR01000107.1 GCA002913545_01394 CDS open 55072-55791 _na     239_aa Purine nucleoside phosphorylase
2736 PPBR01000107.1 GCA002913545_01395 CDS open 55781-55990 _na     69_aa PARP alpha-helical domain-containing protein
2737 PPBR01000107.1 GCA002913545_01396 CDS open 56001-57143 _na     380_aa iadA beta-aspartyl-peptidase
2738 PPBR01000107.1 GCA002913545_01338 gene open 657-1958
2739 PPBR01000107.1 GCA002913545_01339 gene open 2072-2713
2740 PPBR01000107.1 GCA002913545_01340 gene open 2706-3428
2741 PPBR01000107.1 GCA002913545_01341 gene open 3522-4733
2742 PPBR01000107.1 GCA002913545_01342 gene open 5144-6310
2743 PPBR01000107.1 GCA002913545_01343 gene open 6391-7938 rmuC
2744 PPBR01000107.1 GCA002913545_01344 gene open 8367-10202
2745 PPBR01000107.1 GCA002913545_01345 gene open 10261-10857
2746 PPBR01000107.1 GCA002913545_01346 gene open 10889-11677
2747 PPBR01000107.1 GCA002913545_01347 gene open 11674-12615
2748 PPBR01000107.1 GCA002913545_01348 gene open 12625-13167
2749 PPBR01000107.1 GCA002913545_01349 gene open 13167-14411 glyA
2750 PPBR01000107.1 GCA002913545_01350 gene open 14408-15919 lysS
2751 PPBR01000107.1 GCA002913545_01351 gene open 15921-16388
2752 PPBR01000107.1 GCA002913545_01352 gene open 16391-17002 cvpA
2753 PPBR01000107.1 GCA002913545_01353 gene open 17002-18135 pilT
2754 PPBR01000107.1 GCA002913545_01354 gene open 18140-18427 gatC
2755 PPBR01000107.1 GCA002913545_01355 gene open 18552-19115
2756 PPBR01000107.1 GCA002913545_01356 gene open 19115-20122
2757 PPBR01000107.1 GCA002913545_01357 gene open 20119-20451
2758 PPBR01000107.1 GCA002913545_01358 gene open 20438-21067
2759 PPBR01000107.1 GCA002913545_01359 gene open 21064-21678 hisG
2760 PPBR01000107.1 GCA002913545_01360 gene open 21682-22026
2761 PPBR01000107.1 GCA002913545_01361 gene open 22427-23752
2762 PPBR01000107.1 GCA002913545_01362 gene open 23840-24028
2763 PPBR01000107.1 GCA002913545_01363 gene open 24054-24797
2764 PPBR01000107.1 GCA002913545_01364 gene open 24790-25572 fdhD
2765 PPBR01000107.1 GCA002913545_01365 gene open 25792-26433 fdh3B
2766 PPBR01000107.1 GCA002913545_01366 gene open 26435-28657
2767 PPBR01000107.1 GCA002913545_01367 gene open 28706-29260
2768 PPBR01000107.1 GCA002913545_01368 gene open 29291-29464
2769 PPBR01000107.1 GCA002913545_01369 gene open 29454-30149
2770 PPBR01000107.1 GCA002913545_01370 gene open 30395-31348 tupC
2771 PPBR01000107.1 GCA002913545_01371 gene open 31358-32050 tupB
2772 PPBR01000107.1 GCA002913545_01372 gene open 32126-32944 tupA
2773 PPBR01000107.1 GCA002913545_01375 gene open 33427-39267
2774 PPBR01000107.1 GCA002913545_01376 gene open 39390-40607 murD
2775 PPBR01000107.1 GCA002913545_01377 gene open 40611-41126
2776 PPBR01000107.1 GCA002913545_01378 gene open 41130-42194 mraY
2777 PPBR01000107.1 GCA002913545_01379 gene open 42274-43737 gpmI
2778 PPBR01000107.1 GCA002913545_01380 gene open 43774-44517 fabG
2779 PPBR01000107.1 GCA002913545_01381 gene open 44604-44837 acpP
2780 PPBR01000107.1 GCA002913545_01382 gene open 44872-46083
2781 PPBR01000107.1 GCA002913545_01383 gene open 46085-47020 accA
2782 PPBR01000107.1 GCA002913545_01384 gene open 47225-48079
2783 PPBR01000107.1 GCA002913545_01385 gene open 48091-48933
2784 PPBR01000107.1 GCA002913545_01386 gene open 49444-49668
2785 PPBR01000107.1 GCA002913545_01387 gene open 49964-50419
2786 PPBR01000107.1 GCA002913545_01388 gene open 50538-51107
2787 PPBR01000107.1 GCA002913545_01389 gene open 51254-51742
2788 PPBR01000107.1 GCA002913545_01390 gene open 51746-52105
2789 PPBR01000107.1 GCA002913545_01391 gene open 52160-53242
2790 PPBR01000107.1 GCA002913545_01392 gene open 53435-54343
2791 PPBR01000107.1 GCA002913545_01393 gene open 54447-55061
2792 PPBR01000107.1 GCA002913545_01394 gene open 55072-55791
2793 PPBR01000107.1 GCA002913545_01395 gene open 55781-55990
2794 PPBR01000107.1 GCA002913545_01396 gene open 56001-57143 iadA
2795 PPBR01000107.1 GCA002913545_01373 gene open 33102-33192 trnS
2796 PPBR01000107.1 GCA002913545_01374 gene open 33224-33299 trnF
2797 PPBR01000107.1 GCA002913545_01373 tRNA open 33102-33192 trnS tRNA-Ser(gct)
2798 PPBR01000107.1 GCA002913545_01374 tRNA open 33224-33299 trnF tRNA-Phe(gaa)
2799 PPBR01000110.1 GCA002913545_01397 CDS open 441-1187 _na     248_aa larB nickel pincer cofactor biosynthesis protein LarB
2800 PPBR01000110.1 GCA002913545_01398 CDS open 1184-1957 _na     257_aa larE ATP-dependent sacrificial sulfur transferase LarE
2801 PPBR01000110.1 GCA002913545_01399 CDS open 1929-3125 _na     398_aa larC nickel pincer cofactor biosynthesis protein LarC
2802 PPBR01000110.1 GCA002913545_01400 CDS open 3122-4372 _na     416_aa larA nickel-dependent lactate racemase
2803 PPBR01000110.1 GCA002913545_01401 CDS open 4578-6257 _na     559_aa dcuB C4-dicarboxylate transporter DcuB
2804 PPBR01000110.1 GCA002913545_01402 CDS open 6350-7423 _na     357_aa flhB flagellar biosynthesis protein FlhB
2805 PPBR01000110.1 GCA002913545_01403 CDS open 7567-8529 _na     320_aa hypothetical protein
2806 PPBR01000110.1 GCA002913545_01404 CDS open 8637-8951 _na     104_aa rplU 50S ribosomal protein L21
2807 PPBR01000110.1 GCA002913545_01405 CDS open 8963-9220 _na     85_aa rpmA 50S ribosomal protein L27
2808 PPBR01000110.1 GCA002913545_01406 CDS open 9340-12168 _na     942_aa uvrA excinuclease ABC subunit UvrA
2809 PPBR01000110.1 GCA002913545_01407 CDS open 12342-12626 _na     94_aa 4Fe-4S binding protein
2810 PPBR01000110.1 GCA002913545_01408 CDS open 12729-13142 _na     137_aa ndk nucleoside-diphosphate kinase
2811 PPBR01000110.1 GCA002913545_01409 CDS open 13157-13516 _na     119_aa DNA-binding protein
2812 PPBR01000110.1 GCA002913545_01410 CDS open 13528-13674 _na     48_aa rpmF 50S ribosomal protein L32
2813 PPBR01000110.1 GCA002913545_01411 CDS open 13678-14667 _na     329_aa plsX phosphate acyltransferase PlsX
2814 PPBR01000110.1 GCA002913545_01412 CDS open 14671-15675 _na     334_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
2815 PPBR01000110.1 GCA002913545_01413 CDS open 15873-16472 _na     199_aa Alkyl hydroperoxide reductase protein%2C peroxidase component
2816 PPBR01000110.1 GCA002913545_01414 CDS open 16595-17677 _na     360_aa pilZ PilZ domain-containing protein
2817 PPBR01000110.1 GCA002913545_01415 CDS open 17686-19974 _na     762_aa herA Helicase HerA central domain-containing protein
2818 PPBR01000110.1 GCA002913545_01416 CDS open 20034-20645 _na     203_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
2819 PPBR01000110.1 GCA002913545_01417 CDS open 20642-20968 _na     108_aa Dihydroneopterin aldolase/epimerase domain-containing protein
2820 PPBR01000110.1 GCA002913545_01418 CDS open 21045-21716 _na     223_aa ompR Two-component system response regulator
2821 PPBR01000110.1 GCA002913545_01419 CDS open 21695-22972 _na     425_aa histidine kinase
2822 PPBR01000110.1 GCA002913545_01420 CDS open 22976-24424 _na     482_aa Guanosine-5'-triphosphate%2C 3'-diphosphate pyrophosphatase
2823 PPBR01000110.1 GCA002913545_01421 CDS open 25598-26476 _na     292_aa Excinuclease ABC subunit A
2824 PPBR01000110.1 GCA002913545_01422 CDS open 26473-26790 _na     105_aa fliN flagellar motor switch protein FliN
2825 PPBR01000110.1 GCA002913545_01423 CDS open 26787-27206 _na     139_aa Chemotaxis phosphatase CheX-like domain-containing protein
2826 PPBR01000110.1 GCA002913545_01424 CDS open 27284-28033 _na     249_aa trpA tryptophan synthase subunit alpha
2827 PPBR01000110.1 GCA002913545_01425 CDS open 28026-29207 _na     393_aa trpB tryptophan synthase subunit beta
2828 PPBR01000110.1 GCA002913545_01426 CDS open 29200-29811 _na     203_aa N-(5'-phosphoribosyl)anthranilate isomerase
2829 PPBR01000110.1 GCA002913545_01427 CDS open 29798-31414 _na     538_aa Anthranilate phosphoribosyltransferase
2830 PPBR01000110.1 GCA002913545_01428 CDS open 31498-32070 _na     190_aa recR recombination mediator RecR
2831 PPBR01000110.1 GCA002913545_01429 CDS open 32067-33323 _na     418_aa arsS ArsS family sensor histidine kinase
2832 PPBR01000110.1 GCA002913545_01430 CDS open 33320-33991 _na     223_aa Two-component system response regulator
2833 PPBR01000110.1 GCA002913545_01431 CDS open 34115-35263 _na     382_aa dnaJ molecular chaperone DnaJ
2834 PPBR01000110.1 GCA002913545_01432 CDS open 36038-37489 _na     483_aa pyk pyruvate kinase
2835 PPBR01000110.1 GCA002913545_01433 CDS open 37582-38643 _na     353_aa dctP DctP family TRAP transporter solute receptor
2836 PPBR01000110.1 GCA002913545_01434 CDS open 38716-39915 _na     399_aa Molybdopterin molybdenumtransferase
2837 PPBR01000110.1 GCA002913545_01435 CDS open 40052-41110 _na     352_aa yedE YedE family putative selenium transporter
2838 PPBR01000110.1 GCA002913545_01437 CDS open 41560-41784 _na     74_aa hypothetical protein
2839 PPBR01000110.1 GCA002913545_01438 CDS open 42320-42622 _na     100_aa hypothetical protein
2840 PPBR01000110.1 GCA002913545_01439 CDS open 42600-43145 _na     181_aa Chemotaxis protein
2841 PPBR01000110.1 GCA002913545_01397 gene open 441-1187 larB
2842 PPBR01000110.1 GCA002913545_01398 gene open 1184-1957 larE
2843 PPBR01000110.1 GCA002913545_01399 gene open 1929-3125 larC
2844 PPBR01000110.1 GCA002913545_01400 gene open 3122-4372 larA
2845 PPBR01000110.1 GCA002913545_01401 gene open 4578-6257 dcuB
2846 PPBR01000110.1 GCA002913545_01402 gene open 6350-7423 flhB
2847 PPBR01000110.1 GCA002913545_01403 gene open 7567-8529
2848 PPBR01000110.1 GCA002913545_01404 gene open 8637-8951 rplU
2849 PPBR01000110.1 GCA002913545_01405 gene open 8963-9220 rpmA
2850 PPBR01000110.1 GCA002913545_01406 gene open 9340-12168 uvrA
2851 PPBR01000110.1 GCA002913545_01407 gene open 12342-12626
2852 PPBR01000110.1 GCA002913545_01408 gene open 12729-13142 ndk
2853 PPBR01000110.1 GCA002913545_01409 gene open 13157-13516
2854 PPBR01000110.1 GCA002913545_01410 gene open 13528-13674 rpmF
2855 PPBR01000110.1 GCA002913545_01411 gene open 13678-14667 plsX
2856 PPBR01000110.1 GCA002913545_01412 gene open 14671-15675 fabH
2857 PPBR01000110.1 GCA002913545_01413 gene open 15873-16472
2858 PPBR01000110.1 GCA002913545_01414 gene open 16595-17677 pilZ
2859 PPBR01000110.1 GCA002913545_01415 gene open 17686-19974 herA
2860 PPBR01000110.1 GCA002913545_01416 gene open 20034-20645 plsY
2861 PPBR01000110.1 GCA002913545_01417 gene open 20642-20968
2862 PPBR01000110.1 GCA002913545_01418 gene open 21045-21716 ompR
2863 PPBR01000110.1 GCA002913545_01419 gene open 21695-22972
2864 PPBR01000110.1 GCA002913545_01420 gene open 22976-24424
2865 PPBR01000110.1 GCA002913545_01421 gene open 25598-26476
2866 PPBR01000110.1 GCA002913545_01422 gene open 26473-26790 fliN
2867 PPBR01000110.1 GCA002913545_01423 gene open 26787-27206
2868 PPBR01000110.1 GCA002913545_01424 gene open 27284-28033 trpA
2869 PPBR01000110.1 GCA002913545_01425 gene open 28026-29207 trpB
2870 PPBR01000110.1 GCA002913545_01426 gene open 29200-29811
2871 PPBR01000110.1 GCA002913545_01427 gene open 29798-31414
2872 PPBR01000110.1 GCA002913545_01428 gene open 31498-32070 recR
2873 PPBR01000110.1 GCA002913545_01429 gene open 32067-33323 arsS
2874 PPBR01000110.1 GCA002913545_01430 gene open 33320-33991
2875 PPBR01000110.1 GCA002913545_01431 gene open 34115-35263 dnaJ
2876 PPBR01000110.1 GCA002913545_01432 gene open 36038-37489 pyk
2877 PPBR01000110.1 GCA002913545_01433 gene open 37582-38643 dctP
2878 PPBR01000110.1 GCA002913545_01434 gene open 38716-39915
2879 PPBR01000110.1 GCA002913545_01435 gene open 40052-41110 yedE
2880 PPBR01000110.1 GCA002913545_01437 gene open 41560-41784
2881 PPBR01000110.1 GCA002913545_01438 gene open 42320-42622
2882 PPBR01000110.1 GCA002913545_01439 gene open 42600-43145
2883 PPBR01000110.1 GCA002913545_01436 gene open 41226-41302 trnM
2884 PPBR01000110.1 GCA002913545_01436 tRNA open 41226-41302 trnM tRNA-Met(cat)
2885 PPBR01000111.1 GCA002913545_01440 CDS open 206-2137 _na     643_aa Flagellar Assembly Protein A N-terminal region domain-containing protein
2886 PPBR01000111.1 GCA002913545_01441 CDS open 2137-2691 _na     184_aa ruvA Holliday junction branch migration protein RuvA
2887 PPBR01000111.1 GCA002913545_01442 CDS open 2703-3743 _na     346_aa ddl D-alanine--D-alanine ligase
2888 PPBR01000111.1 GCA002913545_01443 CDS open 3808-4038 _na     76_aa Antitoxin
2889 PPBR01000111.1 GCA002913545_01440 gene open 206-2137
2890 PPBR01000111.1 GCA002913545_01441 gene open 2137-2691 ruvA
2891 PPBR01000111.1 GCA002913545_01442 gene open 2703-3743 ddl
2892 PPBR01000111.1 GCA002913545_01443 gene open 3808-4038
2893 PPBR01000114.1 GCA002913545_01444 CDS open 278-793 _na     171_aa hypothetical protein
2894 PPBR01000114.1 GCA002913545_01444 gene open 278-793
2895 PPBR01000115.1 GCA002913545_01445 CDS open 13-135 _na     40_aa hypothetical protein
2896 PPBR01000115.1 GCA002913545_01445 gene open 13-135
2897 PPBR01000117.1 GCA002913545_01446 CDS open 95-865 _na     256_aa NodB-like y domain-containing protein
2898 PPBR01000117.1 GCA002913545_01447 CDS open 968-2065 _na     365_aa Heptosyltransferase
2899 PPBR01000117.1 GCA002913545_01448 CDS open 2013-3128 _na     371_aa Glycosyl transferase family 1 domain-containing protein
2900 PPBR01000117.1 GCA002913545_01449 CDS open 3125-4198 _na     357_aa ADP-heptose--lipooligosaccharide heptosyltransferase II
2901 PPBR01000117.1 GCA002913545_01450 CDS open 4185-5222 _na     345_aa Glycosyl transferase family 1 domain-containing protein
2902 PPBR01000117.1 GCA002913545_01451 CDS open 5200-6519 _na     439_aa O-antigen ligase-related domain-containing protein
2903 PPBR01000117.1 GCA002913545_01452 CDS open 6482-7417 _na     311_aa Lipopolysaccharide heptosyltransferase III
2904 PPBR01000117.1 GCA002913545_01453 CDS open 7549-8580 _na     343_aa waaG UDP-glucose:(Heptosyl) LPS alpha1%2C3-glucosyltransferase WaaG
2905 PPBR01000117.1 GCA002913545_01454 CDS open 8577-9530 _na     317_aa waaF lipopolysaccharide heptosyltransferase II
2906 PPBR01000117.1 GCA002913545_01455 CDS open 9565-10272 _na     235_aa Phenylalanyl-tRNA synthetase subunit alpha
2907 PPBR01000117.1 GCA002913545_01456 CDS open 10288-13899 _na     1203_aa dnaE DNA polymerase III subunit alpha
2908 PPBR01000117.1 GCA002913545_01446 gene open 95-865
2909 PPBR01000117.1 GCA002913545_01447 gene open 968-2065
2910 PPBR01000117.1 GCA002913545_01448 gene open 2013-3128
2911 PPBR01000117.1 GCA002913545_01449 gene open 3125-4198
2912 PPBR01000117.1 GCA002913545_01450 gene open 4185-5222
2913 PPBR01000117.1 GCA002913545_01451 gene open 5200-6519
2914 PPBR01000117.1 GCA002913545_01452 gene open 6482-7417
2915 PPBR01000117.1 GCA002913545_01453 gene open 7549-8580 waaG
2916 PPBR01000117.1 GCA002913545_01454 gene open 8577-9530 waaF
2917 PPBR01000117.1 GCA002913545_01455 gene open 9565-10272
2918 PPBR01000117.1 GCA002913545_01456 gene open 10288-13899 dnaE
2919 PPBR01000118.1 GCA002913545_01457 CDS open 161-925 _na     254_aa AAA+ ATPase domain-containing protein
2920 PPBR01000118.1 GCA002913545_01457 gene open 161-925
2921 PPBR01000119.1 GCA002913545_01458 CDS open 41-439 _na     132_aa hypothetical protein
2922 PPBR01000119.1 GCA002913545_01458 gene open 41-439
2923 PPBR01000120.1 GCA002913545_01459 CDS open 70-492 _na     140_aa fdhF formate dehydrogenase subunit alpha
2924 PPBR01000120.1 GCA002913545_01460 CDS open 541-2313 _na     590_aa Formate dehydrogenase%2C alpha subunit
2925 PPBR01000120.1 GCA002913545_01461 CDS open 2755-2997 _na     80_aa Pathogenicity locus
2926 PPBR01000120.1 GCA002913545_01462 CDS open 3200-3880 _na     226_aa pyrF orotidine-5'-phosphate decarboxylase
2927 PPBR01000120.1 GCA002913545_01463 CDS open 3877-4272 _na     131_aa nusB transcription antitermination factor NusB
2928 PPBR01000120.1 GCA002913545_01464 CDS open 4274-4744 _na     156_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
2929 PPBR01000120.1 GCA002913545_01465 CDS open 4805-5128 _na     107_aa sugE Quaternary ammonium compound-resistance protein SugE
2930 PPBR01000120.1 GCA002913545_01466 CDS open 5125-5454 _na     109_aa sugE Quaternary ammonium compound-resistance protein sugE
2931 PPBR01000120.1 GCA002913545_01467 CDS open 5444-6250 _na     268_aa kdsA 3-deoxy-8-phosphooctulonate synthase
2932 PPBR01000120.1 GCA002913545_01468 CDS open 6267-7310 _na     347_aa hypothetical protein
2933 PPBR01000120.1 GCA002913545_01469 CDS open 7320-8210 _na     296_aa eamA EamA domain-containing protein
2934 PPBR01000120.1 GCA002913545_01470 CDS open 8363-9751 _na     462_aa der ribosome biogenesis GTPase Der
2935 PPBR01000120.1 GCA002913545_01471 CDS open 9732-10253 _na     173_aa Shikimate kinase
2936 PPBR01000120.1 GCA002913545_01472 CDS open 10798-11763 _na     321_aa trpS tryptophan--tRNA ligase
2937 PPBR01000120.1 GCA002913545_01473 CDS open 11772-12212 _na     146_aa copD Copper resistance protein CopD
2938 PPBR01000120.1 GCA002913545_01474 CDS open 12239-14995 _na     918_aa type III restriction-modification system endonuclease
2939 PPBR01000120.1 GCA002913545_01475 CDS open 14997-15236 _na     79_aa Type III restriction-modification system EcoPI enzyme mod
2940 PPBR01000120.1 GCA002913545_01476 CDS open 15445-16872 _na     475_aa site-specific DNA-methyltransferase
2941 PPBR01000120.1 GCA002913545_01477 CDS open 16952-18196 _na     414_aa serS serine--tRNA ligase
2942 PPBR01000120.1 GCA002913545_01478 CDS open 18196-20562 _na     788_aa GTP pyrophosphokinase
2943 PPBR01000120.1 GCA002913545_01479 CDS open 20618-21871 _na     417_aa DUF2920 domain-containing protein
2944 PPBR01000120.1 GCA002913545_01480 CDS open 21901-22482 _na     193_aa Lipoprotein
2945 PPBR01000120.1 GCA002913545_01481 CDS open 22491-22985 _na     164_aa Putative lipoprotein thioredoxin
2946 PPBR01000120.1 GCA002913545_01482 CDS open 22975-23664 _na     229_aa Ferrirhodotorulic acid ABC transporter%2C ATP-binding protein
2947 PPBR01000120.1 GCA002913545_01483 CDS open 23666-24808 _na     380_aa ftsX Cell division protein FtsX
2948 PPBR01000120.1 GCA002913545_01484 CDS open 24795-26087 _na     430_aa ABC3 transporter permease C-terminal domain-containing protein
2949 PPBR01000120.1 GCA002913545_01485 CDS open 26084-27463 _na     459_aa Membrane iron-sulfur containing protein FtrD-like domain-containing protein
2950 PPBR01000120.1 GCA002913545_01486 CDS open 27515-28036 _na     173_aa Ferrirhodotorulic acid ABC transporter%2C periplasmic binding protein
2951 PPBR01000120.1 GCA002913545_01487 CDS open 28057-30000 _na     647_aa Ferrirhodotorulic acid ABC transporter%2C inner membrane protein
2952 PPBR01000120.1 GCA002913545_01488 CDS open 30316-30876 _na     186_aa fdh3B formate dehydrogenase FDH3 subunit beta
2953 PPBR01000120.1 GCA002913545_01489 CDS open 30887-33280 _na     797_aa Formate dehydrogenase N%2C alpha subunit%2C selenocysteine-containing
2954 PPBR01000120.1 GCA002913545_01490 CDS open 33329-33862 _na     177_aa 4Fe-4S Mo/W bis-MGD-type domain-containing protein
2955 PPBR01000120.1 GCA002913545_01491 CDS open 33874-34080 _na     68_aa Formate dehydrogenase subunit or accessory protein
2956 PPBR01000120.1 GCA002913545_01492 CDS open 34360-35067 _na     235_aa Histidine kinase
2957 PPBR01000120.1 GCA002913545_01493 CDS open 35121-36941 _na     606_aa selB selenocysteine-specific translation elongation factor
2958 PPBR01000120.1 GCA002913545_01494 CDS open 36938-38263 _na     441_aa selA L-seryl-tRNA(Sec) selenium transferase
2959 PPBR01000120.1 GCA002913545_01495 CDS open 38418-40091 _na     557_aa 4Fe-4S ferredoxin-type domain-containing protein
2960 PPBR01000120.1 GCA002913545_01496 CDS open 40084-40797 _na     237_aa Formate dehydrogenase-specific chaperone
2961 PPBR01000120.1 GCA002913545_01497 CDS open 40929-41528 _na     199_aa Cytochrome oxidase biogenesis protein Surf12C
2962 PPBR01000120.1 GCA002913545_01498 CDS open 41533-42249 _na     238_aa Chorismate dehydratase
2963 PPBR01000120.1 GCA002913545_01499 CDS open 42246-42518 _na     90_aa Barstar (barnase inhibitor) domain-containing protein
2964 PPBR01000120.1 GCA002913545_01500 CDS open 42515-43021 _na     168_aa Ribonuclease
2965 PPBR01000120.1 GCA002913545_01501 CDS open 43031-43657 _na     208_aa upp uracil phosphoribosyltransferase
2966 PPBR01000120.1 GCA002913545_01502 CDS open 43748-45001 _na     417_aa Malate oxidoreductase
2967 PPBR01000120.1 GCA002913545_01503 CDS open 44998-46377 _na     459_aa gltX glutamate--tRNA ligase
2968 PPBR01000120.1 GCA002913545_01504 CDS open 46448-47278 _na     276_aa surA SurA N-terminal domain-containing protein
2969 PPBR01000120.1 GCA002913545_01505 CDS open 47506-47745 _na     79_aa hypothetical protein
2970 PPBR01000120.1 GCA002913545_01506 CDS open 48221-49312 _na     363_aa dapE succinyl-diaminopimelate desuccinylase
2971 PPBR01000120.1 GCA002913545_01507 CDS open 49312-51219 _na     635_aa Diguanylate cyclase
2972 PPBR01000120.1 GCA002913545_01508 CDS open 51298-53499 _na     733_aa mutS2 endonuclease MutS2
2973 PPBR01000120.1 GCA002913545_01509 CDS open 53496-53840 _na     114_aa Integral membrane protein
2974 PPBR01000120.1 GCA002913545_01510 CDS open 53834-54151 _na     105_aa hypothetical protein
2975 PPBR01000120.1 GCA002913545_01511 CDS open 54151-55479 _na     442_aa murC UDP-N-acetylmuramate--L-alanine ligase
2976 PPBR01000120.1 GCA002913545_01512 CDS open 55545-55898 _na     117_aa MmcQ-like protein
2977 PPBR01000120.1 GCA002913545_01513 CDS open 55902-56462 _na     186_aa DNA-3-methyladenine glycosylase
2978 PPBR01000120.1 GCA002913545_01514 CDS open 56459-57253 _na     264_aa CN hydrolase domain-containing protein
2979 PPBR01000120.1 GCA002913545_01515 CDS open 57246-57437 _na     63_aa xseB exodeoxyribonuclease VII small subunit
2980 PPBR01000120.1 GCA002913545_01516 CDS open 57441-58547 _na     368_aa homoserine O-acetyltransferase
2981 PPBR01000120.1 GCA002913545_01517 CDS open 58547-59995 _na     482_aa guaB IMP dehydrogenase
2982 PPBR01000120.1 GCA002913545_01518 CDS open 60000-61358 _na     452_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
2983 PPBR01000120.1 GCA002913545_01519 CDS open 61458-64214 _na     918_aa ileS isoleucine--tRNA ligase
2984 PPBR01000120.1 GCA002913545_01520 CDS open 64310-65407 _na     365_aa Competence/damage-inducible domain protein
2985 PPBR01000120.1 GCA002913545_01521 CDS open 65498-66748 _na     416_aa Pectate lyase domain-containing protein
2986 PPBR01000120.1 GCA002913545_01522 CDS open 66731-66844 _na     37_aa hypothetical protein
2987 PPBR01000120.1 GCA002913545_01523 CDS open 66825-67508 _na     227_aa ABC transporter substrate-binding protein
2988 PPBR01000120.1 GCA002913545_01524 CDS open 67691-69805 _na     704_aa topA type I DNA topoisomerase
2989 PPBR01000120.1 GCA002913545_01525 CDS open 69865-70584 _na     239_aa Internalin%2C (LPXTG motif)
2990 PPBR01000120.1 GCA002913545_01526 CDS open 70997-71836 _na     279_aa bioB biotin synthase
2991 PPBR01000120.1 GCA002913545_01527 CDS open 71836-72189 _na     117_aa crcB fluoride efflux transporter CrcB
2992 PPBR01000120.1 GCA002913545_01528 CDS open 72693-73175 _na     160_aa Periplasmic protein
2993 PPBR01000120.1 GCA002913545_01529 CDS open 73291-74454 _na     387_aa Cation/H+ exchanger transmembrane domain-containing protein
2994 PPBR01000120.1 GCA002913545_01530 CDS open 74457-75734 _na     425_aa citrate synthase
2995 PPBR01000120.1 GCA002913545_01531 CDS open 75731-76534 _na     267_aa Adenosine-3'(2')%2C5'-bisphosphate nucleotidase
2996 PPBR01000120.1 GCA002913545_01532 CDS open 76537-77001 _na     154_aa Damage-inducible protein
2997 PPBR01000120.1 GCA002913545_01533 CDS open 77003-78559 _na     518_aa Methyltransferase
2998 PPBR01000120.1 GCA002913545_01534 CDS open 78569-79066 _na     165_aa Redoxin domain-containing protein
2999 PPBR01000120.1 GCA002913545_01535 CDS open 79103-79780 _na     225_aa modB molybdate ABC transporter permease subunit
3000 PPBR01000120.1 GCA002913545_01536 CDS open 79777-80634 _na     285_aa ABC transporter domain-containing protein