HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella atypica (GCA_002959915.1)

Select a Genome:
BAKTA Annotations for GCA_002959915.1
Genome Selected: Veillonella atypica
ContigsBases CDSrRNA tmRNAtRNA
11 2,037,410 1874 8 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3891 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3891 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 PPDE01000008.1 GCA002959915_01670 gene open 702217-702639 mce
3002 PPDE01000008.1 GCA002959915_01671 gene open 702691-703629 meaB
3003 PPDE01000008.1 GCA002959915_01672 gene open 703709-704104 sbm
3004 PPDE01000008.1 GCA002959915_01673 gene open 704132-705778 sbm
3005 PPDE01000008.1 GCA002959915_01674 gene open 705807-707309 aCH1
3006 PPDE01000008.1 GCA002959915_01675 gene open 707680-708948
3007 PPDE01000008.1 GCA002959915_01676 gene open 708958-710265
3008 PPDE01000008.1 GCA002959915_01677 gene open 710275-712932 valS
3009 PPDE01000008.1 GCA002959915_01678 gene open 712955-713839 tatC
3010 PPDE01000008.1 GCA002959915_01679 gene open 713841-714812
3011 PPDE01000008.1 GCA002959915_01680 gene open 714809-715507 yihA
3012 PPDE01000008.1 GCA002959915_01681 gene open 715507-717816 lon
3013 PPDE01000008.1 GCA002959915_01682 gene open 717882-719135 clpX
3014 PPDE01000008.1 GCA002959915_01683 gene open 719148-719741 clpP
3015 PPDE01000008.1 GCA002959915_01684 gene open 719776-721080 tig
3016 PPDE01000008.1 GCA002959915_01685 gene open 721239-721694
3017 PPDE01000008.1 GCA002959915_01686 gene open 721802-722281 rlmH
3018 PPDE01000008.1 GCA002959915_01687 gene open 722295-723104
3019 PPDE01000008.1 GCA002959915_01688 gene open 723196-724386
3020 PPDE01000008.1 GCA002959915_01689 gene open 724515-724934 norV
3021 PPDE01000008.1 GCA002959915_01690 gene open 724945-725532
3022 PPDE01000008.1 GCA002959915_01691 gene open 725642-726268
3023 PPDE01000008.1 GCA002959915_01692 gene open 726318-728006
3024 PPDE01000008.1 GCA002959915_01693 gene open 728052-729050
3025 PPDE01000008.1 GCA002959915_01694 gene open 729224-729691 mscL
3026 PPDE01000008.1 GCA002959915_01695 gene open 729812-731506
3027 PPDE01000008.1 GCA002959915_01696 gene open 731616-732503 eamA
3028 PPDE01000008.1 GCA002959915_01697 gene open 732584-734083 thrC
3029 PPDE01000008.1 GCA002959915_01698 gene open 734223-735164 efeB
3030 PPDE01000008.1 GCA002959915_01699 gene open 735252-735449
3031 PPDE01000008.1 GCA002959915_01700 gene open 736180-736683
3032 PPDE01000008.1 GCA002959915_01701 gene open 736696-737046
3033 PPDE01000008.1 GCA002959915_01702 gene open 737766-738236
3034 PPDE01000008.1 GCA002959915_01703 gene open 738362-738649 tnpA
3035 PPDE01000008.1 GCA002959915_01704 gene open 738876-739007
3036 PPDE01000008.1 GCA002959915_01705 gene open 739070-740053
3037 PPDE01000008.1 GCA002959915_01706 gene open 740583-741044
3038 PPDE01000008.1 GCA002959915_01707 gene open 741288-742604 aspB
3039 PPDE01000008.1 GCA002959915_01708 gene open 742771-744630
3040 PPDE01000008.1 GCA002959915_01709 gene open 744660-745571 fepB
3041 PPDE01000008.1 GCA002959915_01710 gene open 745573-746232
3042 PPDE01000008.1 GCA002959915_01711 gene open 746266-746868
3043 PPDE01000008.1 GCA002959915_01712 gene open 747050-747781
3044 PPDE01000008.1 GCA002959915_01713 gene open 748055-749080
3045 PPDE01000008.1 GCA002959915_01714 gene open 749335-750480
3046 PPDE01000008.1 GCA002959915_01715 gene open 750800-751456
3047 PPDE01000008.1 GCA002959915_01716 gene open 751995-752096
3048 PPDE01000008.1 GCA002959915_01717 gene open 752423-753799
3049 PPDE01000008.1 GCA002959915_01718 gene open 754242-756446
3050 PPDE01000008.1 GCA002959915_01719 gene open 756989-758197
3051 PPDE01000008.1 GCA002959915_01720 gene open 758568-759893
3052 PPDE01000008.1 GCA002959915_01721 gene open 760181-761500
3053 PPDE01000008.1 GCA002959915_01722 gene open 761790-762473 rloB
3054 PPDE01000008.1 GCA002959915_01723 gene open 762476-763822
3055 PPDE01000008.1 GCA002959915_01724 gene open 763945-765147
3056 PPDE01000008.1 GCA002959915_01725 gene open 765324-766454
3057 PPDE01000008.1 GCA002959915_01726 gene open 766848-768860
3058 PPDE01000008.1 GCA002959915_01727 gene open 769018-770196
3059 PPDE01000008.1 GCA002959915_01728 gene open 770466-774962
3060 PPDE01000008.1 GCA002959915_01729 gene open 775090-775806
3061 PPDE01000008.1 GCA002959915_01730 gene open 775803-776207
3062 PPDE01000008.1 GCA002959915_01731 gene open 776213-777871
3063 PPDE01000008.1 GCA002959915_01732 gene open 777937-778845
3064 PPDE01000008.1 GCA002959915_01733 gene open 778921-779562
3065 PPDE01000008.1 GCA002959915_01734 gene open 779570-780424 rfbD
3066 PPDE01000008.1 GCA002959915_01735 gene open 780436-781455 rfbB
3067 PPDE01000008.1 GCA002959915_01736 gene open 781468-782046 rfbC
3068 PPDE01000008.1 GCA002959915_01737 gene open 782059-782937 rfbA
3069 PPDE01000008.1 GCA002959915_01738 gene open 782992-783975
3070 PPDE01000008.1 GCA002959915_01739 gene open 784042-784971
3071 PPDE01000008.1 GCA002959915_01740 gene open 784990-786117
3072 PPDE01000008.1 GCA002959915_01741 gene open 786179-786937 sunS
3073 PPDE01000008.1 GCA002959915_01742 gene open 786949-788946
3074 PPDE01000008.1 GCA002959915_01743 gene open 789044-790978
3075 PPDE01000008.1 GCA002959915_01744 gene open 791094-792044
3076 PPDE01000008.1 GCA002959915_01745 gene open 792539-793138
3077 PPDE01000008.1 GCA002959915_01746 gene open 793406-794878
3078 PPDE01000008.1 GCA002959915_01747 gene open 795444-795731 tnpA
3079 PPDE01000008.1 GCA002959915_00998 gene open 977-1050 trnG
3080 PPDE01000008.1 GCA002959915_01217 gene open 234915-234990 trnD
3081 PPDE01000008.1 GCA002959915_01218 gene open 234996-235071 trnF
3082 PPDE01000008.1 GCA002959915_01219 gene open 235079-235153 trnG
3083 PPDE01000008.1 GCA002959915_01220 gene open 235166-235240 trnC
3084 PPDE01000008.1 GCA002959915_01221 gene open 235257-235345 trnL
3085 PPDE01000008.1 GCA002959915_01448 gene open 468080-468163 trnL
3086 PPDE01000008.1 GCA002959915_01614 gene open 644755-644829 trnI
3087 PPDE01000008.1 GCA002959915_00998 tRNA open 977-1050 trnG tRNA-Gly(ccc)
3088 PPDE01000008.1 GCA002959915_01217 tRNA open 234915-234990 trnD tRNA-Asp(gtc)
3089 PPDE01000008.1 GCA002959915_01218 tRNA open 234996-235071 trnF tRNA-Phe(gaa)
3090 PPDE01000008.1 GCA002959915_01219 tRNA open 235079-235153 trnG tRNA-Gly(gcc)
3091 PPDE01000008.1 GCA002959915_01220 tRNA open 235166-235240 trnC tRNA-Cys(gca)
3092 PPDE01000008.1 GCA002959915_01221 tRNA open 235257-235345 trnL tRNA-Leu(taa)
3093 PPDE01000008.1 GCA002959915_01448 tRNA open 468080-468163 trnL tRNA-Leu(caa)
3094 PPDE01000008.1 GCA002959915_01614 tRNA open 644755-644829 trnI tRNA-Ile2(cat)
3095 PPDE01000009.1 rep_origin open 188893-189196
3096 PPDE01000009.1 regulatory_region open 70699-70805 TPP riboswitch aptamer (THI element)
3097 PPDE01000009.1 regulatory_region open 106213-106388 Cobalamin riboswitch aptamer
3098 PPDE01000009.1 GCA002959915_01748 CDS open 33-524 _na     163_aa istB IS21-like element helper ATPase IstB
3099 PPDE01000009.1 GCA002959915_01749 CDS open 700-1122 _na     140_aa Barstar (barnase inhibitor) domain-containing protein
3100 PPDE01000009.1 GCA002959915_01750 CDS open 1300-1659 _na     119_aa hypothetical protein
3101 PPDE01000009.1 GCA002959915_01751 CDS open 1848-3029 _na     393_aa Calcineurin-like phosphoesterase domain-containing protein
3102 PPDE01000009.1 GCA002959915_01752 CDS open 3099-4190 _na     363_aa mutY A/G-specific adenine glycosylase
3103 PPDE01000009.1 GCA002959915_01753 CDS open 4252-4773 _na     173_aa Oxidized purine nucleoside triphosphate hydrolase
3104 PPDE01000009.1 GCA002959915_01754 CDS open 4883-5653 _na     256_aa Galactose-1-phosphate uridylyltransferase
3105 PPDE01000009.1 GCA002959915_01755 CDS open 5705-6514 _na     269_aa Calcineurin-like phosphoesterase domain-containing protein
3106 PPDE01000009.1 GCA002959915_01756 CDS open 6583-6813 _na     76_aa hypothetical protein
3107 PPDE01000009.1 GCA002959915_01757 CDS open 7021-7398 _na     125_aa DUF350 domain-containing protein
3108 PPDE01000009.1 GCA002959915_01758 CDS open 7411-8709 _na     432_aa hemagglutinin repeat-containing protein
3109 PPDE01000009.1 GCA002959915_01759 CDS open 9198-9617 _na     139_aa hypothetical protein
3110 PPDE01000009.1 GCA002959915_01760 CDS open 9823-10194 _na     123_aa Lipoprotein
3111 PPDE01000009.1 GCA002959915_01761 CDS open 10373-11347 _na     324_aa Molybdopterin molybdenumtransferase
3112 PPDE01000009.1 GCA002959915_01762 CDS open 11447-11824 _na     125_aa crcB fluoride efflux transporter CrcB
3113 PPDE01000009.1 GCA002959915_01763 CDS open 11959-12342 _na     127_aa HTH cro/C1-type domain-containing protein
3114 PPDE01000009.1 GCA002959915_01764 CDS open 12575-13297 _na     240_aa HTH gntR-type domain-containing protein
3115 PPDE01000009.1 GCA002959915_01765 CDS open 13499-14419 _na     306_aa Lipid kinase%2C YegS/Rv2252/BmrU family
3116 PPDE01000009.1 GCA002959915_01766 CDS open 14495-18316 _na     1273_aa addA helicase-exonuclease AddAB subunit AddA
3117 PPDE01000009.1 GCA002959915_01767 CDS open 18306-21836 _na     1176_aa ATP-dependent helicase/deoxyribonuclease subunit B
3118 PPDE01000009.1 GCA002959915_01768 CDS open 22125-23120 _na     331_aa hypothetical protein
3119 PPDE01000009.1 GCA002959915_01769 CDS open 23200-23748 _na     182_aa SGNH hydrolase-type esterase domain-containing protein
3120 PPDE01000009.1 GCA002959915_01770 CDS open 23879-24862 _na     327_aa MucBP domain-containing protein
3121 PPDE01000009.1 GCA002959915_01771 CDS open 24947-26173 _na     408_aa Major facilitator superfamily (MFS) profile domain-containing protein
3122 PPDE01000009.1 GCA002959915_01773 CDS open 26791-27744 _na     317_aa corA Magnesium and cobalt transporter CorA
3123 PPDE01000009.1 GCA002959915_01774 CDS open 27898-30027 _na     709_aa zntA Cd(2+)-exporting ATPase
3124 PPDE01000009.1 GCA002959915_01775 CDS open 30241-30564 _na     107_aa YolD-like protein
3125 PPDE01000009.1 GCA002959915_01776 CDS open 30612-31895 _na     427_aa umuC UmuC domain-containing protein
3126 PPDE01000009.1 GCA002959915_01777 CDS open 32129-33490 _na     453_aa dnaB replicative DNA helicase
3127 PPDE01000009.1 GCA002959915_01778 CDS open 33602-34048 _na     148_aa rplI 50S ribosomal protein L9
3128 PPDE01000009.1 GCA002959915_01779 CDS open 34051-36072 _na     673_aa Cyclic-di-AMP phosphodiesterase
3129 PPDE01000009.1 GCA002959915_01780 CDS open 36089-37048 _na     319_aa DUF2232 domain-containing protein
3130 PPDE01000009.1 GCA002959915_01781 CDS open 37243-39420 _na     725_aa Ribonuclease J
3131 PPDE01000009.1 GCA002959915_01782 CDS open 39844-40920 _na     358_aa DUF805 domain-containing protein
3132 PPDE01000009.1 GCA002959915_01783 CDS open 40952-41743 _na     263_aa Uracil-DNA glycosylase-like domain-containing protein
3133 PPDE01000009.1 GCA002959915_01784 CDS open 41909-42682 _na     257_aa tauB ABC transporter domain-containing protein
3134 PPDE01000009.1 GCA002959915_01785 CDS open 42694-43446 _na     250_aa tauC ABC transmembrane type-1 domain-containing protein
3135 PPDE01000009.1 GCA002959915_01786 CDS open 43457-44410 _na     317_aa tauA SsuA/THI5-like domain-containing protein
3136 PPDE01000009.1 GCA002959915_01787 CDS open 44715-46352 _na     545_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3137 PPDE01000009.1 GCA002959915_01788 CDS open 46363-46956 _na     197_aa VTT domain-containing protein
3138 PPDE01000009.1 GCA002959915_01789 CDS open 47143-47889 _na     248_aa Protein kinase domain-containing protein
3139 PPDE01000009.1 GCA002959915_01790 CDS open 48057-48932 _na     291_aa hdrB Cysteine-rich domain-containing protein
3140 PPDE01000009.1 GCA002959915_01791 CDS open 48932-49894 _na     320_aa sdhB succinate dehydrogenase
3141 PPDE01000009.1 GCA002959915_01792 CDS open 49896-51614 _na     572_aa sdhA FAD-binding protein
3142 PPDE01000009.1 GCA002959915_01793 CDS open 52505-53179 _na     224_aa ompR Response regulator ArlR
3143 PPDE01000009.1 GCA002959915_01794 CDS open 53157-54560 _na     467_aa histidine kinase
3144 PPDE01000009.1 GCA002959915_01795 CDS open 54693-56003 _na     436_aa DUF445 domain-containing protein
3145 PPDE01000009.1 GCA002959915_01796 CDS open 56000-57235 _na     411_aa yjiN DUF445 domain-containing protein
3146 PPDE01000009.1 GCA002959915_01797 CDS open 57340-58041 _na     233_aa ulaG Metallo-beta-lactamase domain-containing protein
3147 PPDE01000009.1 GCA002959915_01798 CDS open 58394-58750 _na     118_aa hxlR HTH hxlR-type domain-containing protein
3148 PPDE01000009.1 GCA002959915_01799 CDS open 59027-59821 _na     264_aa Phage prohead protease%2C HK97 family
3149 PPDE01000009.1 GCA002959915_01800 CDS open 59994-60992 _na     332_aa pta phosphate acetyltransferase
3150 PPDE01000009.1 GCA002959915_01801 CDS open 61049-62263 _na     404_aa AAA domain-containing protein
3151 PPDE01000009.1 GCA002959915_01802 CDS open 62617-63294 _na     225_aa LUD domain-containing protein
3152 PPDE01000009.1 GCA002959915_01803 CDS open 63291-63593 _na     100_aa HTH cro/C1-type domain-containing protein
3153 PPDE01000009.1 GCA002959915_01804 CDS open 63805-65163 _na     452_aa gltD Pyridine nucleotide-disulfide oxidoreductase
3154 PPDE01000009.1 GCA002959915_01805 CDS open 65449-66642 _na     397_aa cysteine-S-conjugate beta-lyase
3155 PPDE01000009.1 GCA002959915_01806 CDS open 66717-68273 _na     518_aa DUF438 domain-containing protein
3156 PPDE01000009.1 GCA002959915_01807 CDS open 68523-69152 _na     209_aa sodA Superoxide dismutase
3157 PPDE01000009.1 GCA002959915_01808 CDS open 69315-70619 _na     434_aa thiC phosphomethylpyrimidine synthase ThiC
3158 PPDE01000009.1 GCA002959915_01809 CDS open 70863-71408 _na     181_aa Isochorismatase-like domain-containing protein
3159 PPDE01000009.1 GCA002959915_01810 CDS open 71412-71924 _na     170_aa YutG/PgpA domain-containing protein
3160 PPDE01000009.1 GCA002959915_01811 CDS open 72024-72368 _na     114_aa phnA Alkylphosphonate utilization operon protein PhnA
3161 PPDE01000009.1 GCA002959915_01812 CDS open 72481-72879 _na     132_aa hicB Toxin-antitoxin system%2C antitoxin component%2C HicB family
3162 PPDE01000009.1 GCA002959915_01813 CDS open 73201-73560 _na     119_aa soxR HTH-type transcriptional regulator AdhR
3163 PPDE01000009.1 GCA002959915_01814 CDS open 73627-74007 _na     126_aa yurZ 4-carboxymuconolactone decarboxylase
3164 PPDE01000009.1 GCA002959915_01815 CDS open 74409-74906 _na     165_aa eCF-S ECF transporter S component
3165 PPDE01000009.1 GCA002959915_01816 CDS open 75019-75312 _na     97_aa DUF2695 domain-containing protein
3166 PPDE01000009.1 GCA002959915_01817 CDS open 75457-75987 _na     176_aa hypothetical protein
3167 PPDE01000009.1 GCA002959915_01818 CDS open 76138-76644 _na     168_aa DUF1877 domain-containing protein
3168 PPDE01000009.1 GCA002959915_01819 CDS open 76667-77260 _na     197_aa DUF1877 domain-containing protein
3169 PPDE01000009.1 GCA002959915_01820 CDS open 77299-78105 _na     268_aa PI-PLC Y-box domain-containing protein
3170 PPDE01000009.1 GCA002959915_01821 CDS open 78131-78673 _na     180_aa SMI1/KNR4 family protein
3171 PPDE01000009.1 GCA002959915_01822 CDS open 78709-79389 _na     226_aa Glutathione reductase
3172 PPDE01000009.1 GCA002959915_01823 CDS open 79461-79892 _na     143_aa DUF2262 domain-containing protein
3173 PPDE01000009.1 GCA002959915_01824 CDS open 79913-80728 _na     271_aa DUF2262 domain-containing protein
3174 PPDE01000009.1 GCA002959915_01825 CDS open 80780-81610 _na     276_aa DUF6630 domain-containing protein
3175 PPDE01000009.1 GCA002959915_01826 CDS open 81748-82959 _na     403_aa AAA domain-containing protein
3176 PPDE01000009.1 GCA002959915_01827 CDS open 83535-86339 _na     934_aa DNA methyltransferase
3177 PPDE01000009.1 GCA002959915_01828 CDS open 86613-87089 _na     158_aa hypothetical protein
3178 PPDE01000009.1 GCA002959915_01829 CDS open 87146-87514 _na     122_aa hypothetical protein
3179 PPDE01000009.1 GCA002959915_01831 CDS open 87724-88608 _na     294_aa Tat pathway signal sequence domain protein
3180 PPDE01000009.1 GCA002959915_01832 CDS open 88694-88978 _na     94_aa hypothetical protein
3181 PPDE01000009.1 GCA002959915_01833 CDS open 89069-90454 _na     461_aa dinB DNA polymerase IV
3182 PPDE01000009.1 GCA002959915_01834 CDS open 90472-90816 _na     114_aa arsR HTH arsR-type domain-containing protein
3183 PPDE01000009.1 GCA002959915_01835 CDS open 91035-92318 _na     427_aa purA adenylosuccinate synthase
3184 PPDE01000009.1 GCA002959915_01836 CDS open 92404-92676 _na     90_aa HTH cro/C1-type domain-containing protein
3185 PPDE01000009.1 GCA002959915_01837 CDS open 92678-92896 _na     72_aa toxin-antitoxin system%2C toxin component
3186 PPDE01000009.1 GCA002959915_01838 CDS open 93310-94461 _na     383_aa Major facilitator superfamily (MFS) profile domain-containing protein
3187 PPDE01000009.1 GCA002959915_01839 CDS open 95025-96320 _na     431_aa purB adenylosuccinate lyase
3188 PPDE01000009.1 GCA002959915_01840 CDS open 96555-96962 _na     135_aa CAAX protease
3189 PPDE01000009.1 GCA002959915_01841 CDS open 97114-97926 _na     270_aa tonB TonB family domain-containing protein
3190 PPDE01000009.1 GCA002959915_01842 CDS open 97931-98335 _na     134_aa exbD Biopolymer transporter ExbD
3191 PPDE01000009.1 GCA002959915_01843 CDS open 98332-98937 _na     201_aa MotA/TolQ/ExbB proton channel domain-containing protein
3192 PPDE01000009.1 GCA002959915_01844 CDS open 99256-100146 _na     296_aa DUF3829 domain-containing protein
3193 PPDE01000009.1 GCA002959915_01845 CDS open 100327-101580 _na     417_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
3194 PPDE01000009.1 GCA002959915_01846 CDS open 101573-103762 _na     729_aa scpA methylmalonyl-CoA mutase
3195 PPDE01000009.1 GCA002959915_01847 CDS open 103767-105929 _na     720_aa sbm methylmalonyl-CoA mutase
3196 PPDE01000009.1 GCA002959915_01848 CDS open 106591-107487 _na     298_aa rarD EamA family transporter RarD
3197 PPDE01000009.1 GCA002959915_01849 CDS open 107589-108488 _na     299_aa DUF3829 domain-containing protein
3198 PPDE01000009.1 GCA002959915_01850 CDS open 108775-109188 _na     137_aa Integral membrane protein
3199 PPDE01000009.1 GCA002959915_01851 CDS open 109240-110070 _na     276_aa tetratricopeptide repeat protein
3200 PPDE01000009.1 GCA002959915_01852 CDS open 110119-112941 _na     940_aa glcD D-lactate dehydrogenase (cytochrome)
3201 PPDE01000009.1 GCA002959915_01853 CDS open 113467-113748 _na     93_aa Addiction module antitoxin%2C RelB/DinJ family
3202 PPDE01000009.1 GCA002959915_01854 CDS open 114144-114941 _na     265_aa putative membrane transporter protein
3203 PPDE01000009.1 GCA002959915_01855 CDS open 115002-116276 _na     424_aa larA nickel-dependent lactate racemase
3204 PPDE01000009.1 GCA002959915_01856 CDS open 116697-118241 _na     514_aa clcA RCK C-terminal domain-containing protein
3205 PPDE01000009.1 GCA002959915_01857 CDS open 118299-120041 _na     580_aa DNA binding domain-containing protein
3206 PPDE01000009.1 GCA002959915_01858 CDS open 120198-121349 _na     383_aa fucO lactaldehyde reductase
3207 PPDE01000009.1 GCA002959915_01859 CDS open 121491-122639 _na     382_aa beta-N-acetylhexosaminidase
3208 PPDE01000009.1 GCA002959915_01860 CDS open 122799-123032 _na     77_aa nirB BFD-like [2Fe-2S]-binding domain-containing protein
3209 PPDE01000009.1 GCA002959915_01861 CDS open 123180-123812 _na     210_aa Peptidase M50 domain-containing protein
3210 PPDE01000009.1 GCA002959915_01862 CDS open 123911-124681 _na     256_aa Carboxymuconolactone decarboxylase-like domain-containing protein
3211 PPDE01000009.1 GCA002959915_01863 CDS open 124865-125296 _na     143_aa DUF4822 domain-containing protein
3212 PPDE01000009.1 GCA002959915_01864 CDS open 125382-125903 _na     173_aa HTH marR-type domain-containing protein
3213 PPDE01000009.1 GCA002959915_01865 CDS open 126361-126576 _na     71_aa hypothetical protein
3214 PPDE01000009.1 GCA002959915_01866 CDS open 126754-127344 _na     196_aa Nitroreductase domain-containing protein
3215 PPDE01000009.1 GCA002959915_01867 CDS open 127413-127640 _na     75_aa hypothetical protein
3216 PPDE01000009.1 GCA002959915_01868 CDS open 128111-128536 _na     141_aa RDD family protein
3217 PPDE01000009.1 GCA002959915_01869 CDS open 128696-129679 _na     327_aa Inverse autotransporter beta-domain domain-containing protein
3218 PPDE01000009.1 GCA002959915_01870 CDS open 129863-130216 _na     117_aa mgsR Regulatory protein MgsR
3219 PPDE01000009.1 GCA002959915_01871 CDS open 130335-130913 _na     192_aa TonB-dependent receptor
3220 PPDE01000009.1 GCA002959915_01872 CDS open 130982-131428 _na     148_aa hypothetical protein
3221 PPDE01000009.1 GCA002959915_01873 CDS open 131809-132933 _na     374_aa hypothetical protein
3222 PPDE01000009.1 GCA002959915_01874 CDS open 133149-134123 _na     324_aa DUF3298 domain-containing protein
3223 PPDE01000009.1 GCA002959915_01875 CDS open 134617-135237 _na     206_aa DUF2939 domain-containing protein
3224 PPDE01000009.1 GCA002959915_01876 CDS open 135371-135937 _na     188_aa hypothetical protein
3225 PPDE01000009.1 GCA002959915_01877 CDS open 135946-136518 _na     190_aa DUF3298 domain-containing protein
3226 PPDE01000009.1 GCA002959915_01878 CDS open 136609-137517 _na     302_aa Hemagglutinin
3227 PPDE01000009.1 GCA002959915_01879 CDS open 137717-138304 _na     195_aa Lipoprotein
3228 PPDE01000009.1 GCA002959915_01880 CDS open 138407-138961 _na     184_aa Lipoprotein
3229 PPDE01000009.1 GCA002959915_01881 CDS open 138970-139536 _na     188_aa pdaC Deacetylase PdaC domain-containing protein
3230 PPDE01000009.1 GCA002959915_01882 CDS open 139611-140846 _na     411_aa hypothetical protein
3231 PPDE01000009.1 GCA002959915_01883 CDS open 141070-141414 _na     114_aa hypothetical protein
3232 PPDE01000009.1 GCA002959915_01884 CDS open 141607-141708 _na     33_aa Holin-like toxin
3233 PPDE01000009.1 GCA002959915_01885 CDS open 141891-144548 _na     885_aa Phospholipase D-like domain-containing protein
3234 PPDE01000009.1 GCA002959915_01886 CDS open 144844-146322 _na     492_aa Nuclease
3235 PPDE01000009.1 GCA002959915_01887 CDS open 146852-148282 _na     476_aa nar1 Iron hydrogenase 1
3236 PPDE01000009.1 GCA002959915_01888 CDS open 148429-149850 _na     473_aa ATP-binding protein
3237 PPDE01000009.1 GCA002959915_01889 CDS open 150119-150511 _na     130_aa hypothetical protein
3238 PPDE01000009.1 GCA002959915_01890 CDS open 150558-151634 _na     358_aa Fido domain-containing protein
3239 PPDE01000009.1 GCA002959915_01891 CDS open 152124-152495 _na     123_aa F5/8 type C domain-containing protein
3240 PPDE01000009.1 GCA002959915_01892 CDS open 152722-155187 _na     821_aa gyrA DNA gyrase subunit A
3241 PPDE01000009.1 GCA002959915_01893 CDS open 155655-156659 _na     334_aa Bro-N domain-containing protein
3242 PPDE01000009.1 GCA002959915_01894 CDS open 156712-157575 _na     287_aa higA HigA family addiction module antitoxin
3243 PPDE01000009.1 GCA002959915_01895 CDS open 157593-157889 _na     98_aa relE Toxin-antitoxin system%2C toxin component%2C RelE family
3244 PPDE01000009.1 GCA002959915_01896 CDS open 158163-159407 _na     414_aa sfsA DNA/RNA nuclease SfsA
3245 PPDE01000009.1 GCA002959915_01897 CDS open 159607-159828 _na     73_aa DUF2922 domain-containing protein
3246 PPDE01000009.1 GCA002959915_01898 CDS open 159953-160159 _na     68_aa DUF1659 domain-containing protein
3247 PPDE01000009.1 GCA002959915_01899 CDS open 160567-161523 _na     318_aa Hybrid cluster protein-associated redox disulfide domain
3248 PPDE01000009.1 GCA002959915_01900 CDS open 161544-162209 _na     221_aa DUF2612 domain-containing protein
3249 PPDE01000009.1 GCA002959915_01901 CDS open 162692-162979 _na     95_aa qdoI Cupin 2 conserved barrel domain-containing protein
3250 PPDE01000009.1 GCA002959915_01902 CDS open 163209-163565 _na     118_aa MmcQ/YjbR family DNA-binding protein
3251 PPDE01000009.1 GCA002959915_01903 CDS open 163686-164279 _na     197_aa Yip1 domain-containing protein
3252 PPDE01000009.1 GCA002959915_01904 CDS open 164230-164355 _na     41_aa hypothetical protein
3253 PPDE01000009.1 GCA002959915_01905 CDS open 164611-165069 _na     152_aa Outer membrane protein
3254 PPDE01000009.1 GCA002959915_01906 CDS open 165275-165652 _na     125_aa ytfJ Sporulation protein YtfJ
3255 PPDE01000009.1 GCA002959915_01907 CDS open 165676-166806 _na     376_aa DUF2953 domain-containing protein
3256 PPDE01000009.1 GCA002959915_01908 CDS open 166849-167427 _na     192_aa btuR Cob(I)yrinic acid a%2Cc-diamide adenosyltransferase
3257 PPDE01000009.1 GCA002959915_01909 CDS open 168437-169414 _na     325_aa Peptidase M23 domain-containing protein
3258 PPDE01000009.1 GCA002959915_01910 CDS open 169468-169989 _na     173_aa DUF4446 domain-containing protein
3259 PPDE01000009.1 GCA002959915_01911 CDS open 169983-171260 _na     425_aa hydF [FeFe] hydrogenase H-cluster maturation GTPase HydF
3260 PPDE01000009.1 GCA002959915_01912 CDS open 171260-172171 _na     303_aa Chromosome-partitioning protein Spo0J
3261 PPDE01000009.1 GCA002959915_01913 CDS open 172287-173060 _na     257_aa Sporulation initiation inhibitor protein Soj
3262 PPDE01000009.1 GCA002959915_01914 CDS open 173460-174212 _na     250_aa AdoMet activation domain-containing protein
3263 PPDE01000009.1 GCA002959915_01915 CDS open 174473-176905 _na     810_aa metH2 Methionine synthase
3264 PPDE01000009.1 GCA002959915_01916 CDS open 177017-177874 _na     285_aa metF Methylenetetrahydrofolate reductase
3265 PPDE01000009.1 GCA002959915_01917 CDS open 178274-179026 _na     250_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
3266 PPDE01000009.1 GCA002959915_01918 CDS open 179595-179708 _na     37_aa hypothetical protein
3267 PPDE01000009.1 GCA002959915_01919 CDS open 179765-181636 _na     623_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
3268 PPDE01000009.1 GCA002959915_01920 CDS open 181785-183170 _na     461_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
3269 PPDE01000009.1 GCA002959915_01921 CDS open 183440-184225 _na     261_aa jag RNA-binding cell elongation regulator Jag/EloR
3270 PPDE01000009.1 GCA002959915_01922 CDS open 184234-184890 _na     218_aa YidC/Oxa1 family membrane protein insertase
3271 PPDE01000009.1 GCA002959915_01923 CDS open 185439-185786 _na     115_aa rnpA ribonuclease P protein component
3272 PPDE01000009.1 GCA002959915_01924 CDS open 185866-186000 _na     44_aa rpmH 50S ribosomal protein L34
3273 PPDE01000009.1 GCA002959915_01925 CDS open 187273-188892 _na     539_aa dnaA chromosomal replication initiator protein DnaA
3274 PPDE01000009.1 GCA002959915_01926 CDS open 189197-190318 _na     373_aa dnaN DNA polymerase III subunit beta
3275 PPDE01000009.1 GCA002959915_01927 CDS open 190350-190580 _na     76_aa RNA-binding S4 domain-containing protein
3276 PPDE01000009.1 GCA002959915_01928 CDS open 190584-191684 _na     366_aa recF DNA replication/repair protein RecF
3277 PPDE01000009.1 GCA002959915_01929 CDS open 191671-192570 _na     299_aa DUF721 domain-containing protein
3278 PPDE01000009.1 GCA002959915_01930 CDS open 192705-192956 _na     83_aa DUF370 domain-containing protein
3279 PPDE01000009.1 GCA002959915_01931 CDS open 193066-194967 _na     633_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3280 PPDE01000009.1 GCA002959915_01932 CDS open 194978-196459 _na     493_aa lysP Amino acid permease/ SLC12A domain-containing protein
3281 PPDE01000009.1 GCA002959915_01933 CDS open 196635-196952 _na     105_aa ybjQ UPF0145 protein HMPREF1477_01262
3282 PPDE01000009.1 GCA002959915_01934 CDS open 197612-200674 _na     1020_aa Hydrophobe/amphiphile efflux-1 (HAE1) family RND transporter
3283 PPDE01000009.1 GCA002959915_01935 CDS open 200671-201735 _na     354_aa Efflux transporter%2C RND family%2C MFP subunit
3284 PPDE01000009.1 GCA002959915_01936 CDS open 202234-202371 _na     45_aa hypothetical protein
3285 PPDE01000009.1 GCA002959915_01937 CDS open 202848-204197 _na     449_aa Hemolysin
3286 PPDE01000009.1 GCA002959915_01748 gene open 33-524 istB
3287 PPDE01000009.1 GCA002959915_01749 gene open 700-1122
3288 PPDE01000009.1 GCA002959915_01750 gene open 1300-1659
3289 PPDE01000009.1 GCA002959915_01751 gene open 1848-3029
3290 PPDE01000009.1 GCA002959915_01752 gene open 3099-4190 mutY
3291 PPDE01000009.1 GCA002959915_01753 gene open 4252-4773
3292 PPDE01000009.1 GCA002959915_01754 gene open 4883-5653
3293 PPDE01000009.1 GCA002959915_01755 gene open 5705-6514
3294 PPDE01000009.1 GCA002959915_01756 gene open 6583-6813
3295 PPDE01000009.1 GCA002959915_01757 gene open 7021-7398
3296 PPDE01000009.1 GCA002959915_01758 gene open 7411-8709
3297 PPDE01000009.1 GCA002959915_01759 gene open 9198-9617
3298 PPDE01000009.1 GCA002959915_01760 gene open 9823-10194
3299 PPDE01000009.1 GCA002959915_01761 gene open 10373-11347
3300 PPDE01000009.1 GCA002959915_01762 gene open 11447-11824 crcB
3301 PPDE01000009.1 GCA002959915_01763 gene open 11959-12342
3302 PPDE01000009.1 GCA002959915_01764 gene open 12575-13297
3303 PPDE01000009.1 GCA002959915_01765 gene open 13499-14419
3304 PPDE01000009.1 GCA002959915_01766 gene open 14495-18316 addA
3305 PPDE01000009.1 GCA002959915_01767 gene open 18306-21836
3306 PPDE01000009.1 GCA002959915_01768 gene open 22125-23120
3307 PPDE01000009.1 GCA002959915_01769 gene open 23200-23748
3308 PPDE01000009.1 GCA002959915_01770 gene open 23879-24862
3309 PPDE01000009.1 GCA002959915_01771 gene open 24947-26173
3310 PPDE01000009.1 GCA002959915_01773 gene open 26791-27744 corA
3311 PPDE01000009.1 GCA002959915_01774 gene open 27898-30027 zntA
3312 PPDE01000009.1 GCA002959915_01775 gene open 30241-30564
3313 PPDE01000009.1 GCA002959915_01776 gene open 30612-31895 umuC
3314 PPDE01000009.1 GCA002959915_01777 gene open 32129-33490 dnaB
3315 PPDE01000009.1 GCA002959915_01778 gene open 33602-34048 rplI
3316 PPDE01000009.1 GCA002959915_01779 gene open 34051-36072
3317 PPDE01000009.1 GCA002959915_01780 gene open 36089-37048
3318 PPDE01000009.1 GCA002959915_01781 gene open 37243-39420
3319 PPDE01000009.1 GCA002959915_01782 gene open 39844-40920
3320 PPDE01000009.1 GCA002959915_01783 gene open 40952-41743
3321 PPDE01000009.1 GCA002959915_01784 gene open 41909-42682 tauB
3322 PPDE01000009.1 GCA002959915_01785 gene open 42694-43446 tauC
3323 PPDE01000009.1 GCA002959915_01786 gene open 43457-44410 tauA
3324 PPDE01000009.1 GCA002959915_01787 gene open 44715-46352
3325 PPDE01000009.1 GCA002959915_01788 gene open 46363-46956
3326 PPDE01000009.1 GCA002959915_01789 gene open 47143-47889
3327 PPDE01000009.1 GCA002959915_01790 gene open 48057-48932 hdrB
3328 PPDE01000009.1 GCA002959915_01791 gene open 48932-49894 sdhB
3329 PPDE01000009.1 GCA002959915_01792 gene open 49896-51614 sdhA
3330 PPDE01000009.1 GCA002959915_01793 gene open 52505-53179 ompR
3331 PPDE01000009.1 GCA002959915_01794 gene open 53157-54560
3332 PPDE01000009.1 GCA002959915_01795 gene open 54693-56003
3333 PPDE01000009.1 GCA002959915_01796 gene open 56000-57235 yjiN
3334 PPDE01000009.1 GCA002959915_01797 gene open 57340-58041 ulaG
3335 PPDE01000009.1 GCA002959915_01798 gene open 58394-58750 hxlR
3336 PPDE01000009.1 GCA002959915_01799 gene open 59027-59821
3337 PPDE01000009.1 GCA002959915_01800 gene open 59994-60992 pta
3338 PPDE01000009.1 GCA002959915_01801 gene open 61049-62263
3339 PPDE01000009.1 GCA002959915_01802 gene open 62617-63294
3340 PPDE01000009.1 GCA002959915_01803 gene open 63291-63593
3341 PPDE01000009.1 GCA002959915_01804 gene open 63805-65163 gltD
3342 PPDE01000009.1 GCA002959915_01805 gene open 65449-66642
3343 PPDE01000009.1 GCA002959915_01806 gene open 66717-68273
3344 PPDE01000009.1 GCA002959915_01807 gene open 68523-69152 sodA
3345 PPDE01000009.1 GCA002959915_01808 gene open 69315-70619 thiC
3346 PPDE01000009.1 GCA002959915_01809 gene open 70863-71408
3347 PPDE01000009.1 GCA002959915_01810 gene open 71412-71924
3348 PPDE01000009.1 GCA002959915_01811 gene open 72024-72368 phnA
3349 PPDE01000009.1 GCA002959915_01812 gene open 72481-72879 hicB
3350 PPDE01000009.1 GCA002959915_01813 gene open 73201-73560 soxR
3351 PPDE01000009.1 GCA002959915_01814 gene open 73627-74007 yurZ
3352 PPDE01000009.1 GCA002959915_01815 gene open 74409-74906 eCF-S
3353 PPDE01000009.1 GCA002959915_01816 gene open 75019-75312
3354 PPDE01000009.1 GCA002959915_01817 gene open 75457-75987
3355 PPDE01000009.1 GCA002959915_01818 gene open 76138-76644
3356 PPDE01000009.1 GCA002959915_01819 gene open 76667-77260
3357 PPDE01000009.1 GCA002959915_01820 gene open 77299-78105
3358 PPDE01000009.1 GCA002959915_01821 gene open 78131-78673
3359 PPDE01000009.1 GCA002959915_01822 gene open 78709-79389
3360 PPDE01000009.1 GCA002959915_01823 gene open 79461-79892
3361 PPDE01000009.1 GCA002959915_01824 gene open 79913-80728
3362 PPDE01000009.1 GCA002959915_01825 gene open 80780-81610
3363 PPDE01000009.1 GCA002959915_01826 gene open 81748-82959
3364 PPDE01000009.1 GCA002959915_01827 gene open 83535-86339
3365 PPDE01000009.1 GCA002959915_01828 gene open 86613-87089
3366 PPDE01000009.1 GCA002959915_01829 gene open 87146-87514
3367 PPDE01000009.1 GCA002959915_01831 gene open 87724-88608
3368 PPDE01000009.1 GCA002959915_01832 gene open 88694-88978
3369 PPDE01000009.1 GCA002959915_01833 gene open 89069-90454 dinB
3370 PPDE01000009.1 GCA002959915_01834 gene open 90472-90816 arsR
3371 PPDE01000009.1 GCA002959915_01835 gene open 91035-92318 purA
3372 PPDE01000009.1 GCA002959915_01836 gene open 92404-92676
3373 PPDE01000009.1 GCA002959915_01837 gene open 92678-92896
3374 PPDE01000009.1 GCA002959915_01838 gene open 93310-94461
3375 PPDE01000009.1 GCA002959915_01839 gene open 95025-96320 purB
3376 PPDE01000009.1 GCA002959915_01840 gene open 96555-96962
3377 PPDE01000009.1 GCA002959915_01841 gene open 97114-97926 tonB
3378 PPDE01000009.1 GCA002959915_01842 gene open 97931-98335 exbD
3379 PPDE01000009.1 GCA002959915_01843 gene open 98332-98937
3380 PPDE01000009.1 GCA002959915_01844 gene open 99256-100146
3381 PPDE01000009.1 GCA002959915_01845 gene open 100327-101580 meaB
3382 PPDE01000009.1 GCA002959915_01846 gene open 101573-103762 scpA
3383 PPDE01000009.1 GCA002959915_01847 gene open 103767-105929 sbm
3384 PPDE01000009.1 GCA002959915_01848 gene open 106591-107487 rarD
3385 PPDE01000009.1 GCA002959915_01849 gene open 107589-108488
3386 PPDE01000009.1 GCA002959915_01850 gene open 108775-109188
3387 PPDE01000009.1 GCA002959915_01851 gene open 109240-110070
3388 PPDE01000009.1 GCA002959915_01852 gene open 110119-112941 glcD
3389 PPDE01000009.1 GCA002959915_01853 gene open 113467-113748
3390 PPDE01000009.1 GCA002959915_01854 gene open 114144-114941
3391 PPDE01000009.1 GCA002959915_01855 gene open 115002-116276 larA
3392 PPDE01000009.1 GCA002959915_01856 gene open 116697-118241 clcA
3393 PPDE01000009.1 GCA002959915_01857 gene open 118299-120041
3394 PPDE01000009.1 GCA002959915_01858 gene open 120198-121349 fucO
3395 PPDE01000009.1 GCA002959915_01859 gene open 121491-122639
3396 PPDE01000009.1 GCA002959915_01860 gene open 122799-123032 nirB
3397 PPDE01000009.1 GCA002959915_01861 gene open 123180-123812
3398 PPDE01000009.1 GCA002959915_01862 gene open 123911-124681
3399 PPDE01000009.1 GCA002959915_01863 gene open 124865-125296
3400 PPDE01000009.1 GCA002959915_01864 gene open 125382-125903
3401 PPDE01000009.1 GCA002959915_01865 gene open 126361-126576
3402 PPDE01000009.1 GCA002959915_01866 gene open 126754-127344
3403 PPDE01000009.1 GCA002959915_01867 gene open 127413-127640
3404 PPDE01000009.1 GCA002959915_01868 gene open 128111-128536
3405 PPDE01000009.1 GCA002959915_01869 gene open 128696-129679
3406 PPDE01000009.1 GCA002959915_01870 gene open 129863-130216 mgsR
3407 PPDE01000009.1 GCA002959915_01871 gene open 130335-130913
3408 PPDE01000009.1 GCA002959915_01872 gene open 130982-131428
3409 PPDE01000009.1 GCA002959915_01873 gene open 131809-132933
3410 PPDE01000009.1 GCA002959915_01874 gene open 133149-134123
3411 PPDE01000009.1 GCA002959915_01875 gene open 134617-135237
3412 PPDE01000009.1 GCA002959915_01876 gene open 135371-135937
3413 PPDE01000009.1 GCA002959915_01877 gene open 135946-136518
3414 PPDE01000009.1 GCA002959915_01878 gene open 136609-137517
3415 PPDE01000009.1 GCA002959915_01879 gene open 137717-138304
3416 PPDE01000009.1 GCA002959915_01880 gene open 138407-138961
3417 PPDE01000009.1 GCA002959915_01881 gene open 138970-139536 pdaC
3418 PPDE01000009.1 GCA002959915_01882 gene open 139611-140846
3419 PPDE01000009.1 GCA002959915_01883 gene open 141070-141414
3420 PPDE01000009.1 GCA002959915_01884 gene open 141607-141708
3421 PPDE01000009.1 GCA002959915_01885 gene open 141891-144548
3422 PPDE01000009.1 GCA002959915_01886 gene open 144844-146322
3423 PPDE01000009.1 GCA002959915_01887 gene open 146852-148282 nar1
3424 PPDE01000009.1 GCA002959915_01888 gene open 148429-149850
3425 PPDE01000009.1 GCA002959915_01889 gene open 150119-150511
3426 PPDE01000009.1 GCA002959915_01890 gene open 150558-151634
3427 PPDE01000009.1 GCA002959915_01891 gene open 152124-152495
3428 PPDE01000009.1 GCA002959915_01892 gene open 152722-155187 gyrA
3429 PPDE01000009.1 GCA002959915_01893 gene open 155655-156659
3430 PPDE01000009.1 GCA002959915_01894 gene open 156712-157575 higA
3431 PPDE01000009.1 GCA002959915_01895 gene open 157593-157889 relE
3432 PPDE01000009.1 GCA002959915_01896 gene open 158163-159407 sfsA
3433 PPDE01000009.1 GCA002959915_01897 gene open 159607-159828
3434 PPDE01000009.1 GCA002959915_01898 gene open 159953-160159
3435 PPDE01000009.1 GCA002959915_01899 gene open 160567-161523
3436 PPDE01000009.1 GCA002959915_01900 gene open 161544-162209
3437 PPDE01000009.1 GCA002959915_01901 gene open 162692-162979 qdoI
3438 PPDE01000009.1 GCA002959915_01902 gene open 163209-163565
3439 PPDE01000009.1 GCA002959915_01903 gene open 163686-164279
3440 PPDE01000009.1 GCA002959915_01904 gene open 164230-164355
3441 PPDE01000009.1 GCA002959915_01905 gene open 164611-165069
3442 PPDE01000009.1 GCA002959915_01906 gene open 165275-165652 ytfJ
3443 PPDE01000009.1 GCA002959915_01907 gene open 165676-166806
3444 PPDE01000009.1 GCA002959915_01908 gene open 166849-167427 btuR
3445 PPDE01000009.1 GCA002959915_01909 gene open 168437-169414
3446 PPDE01000009.1 GCA002959915_01910 gene open 169468-169989
3447 PPDE01000009.1 GCA002959915_01911 gene open 169983-171260 hydF
3448 PPDE01000009.1 GCA002959915_01912 gene open 171260-172171
3449 PPDE01000009.1 GCA002959915_01913 gene open 172287-173060
3450 PPDE01000009.1 GCA002959915_01914 gene open 173460-174212
3451 PPDE01000009.1 GCA002959915_01915 gene open 174473-176905 metH2
3452 PPDE01000009.1 GCA002959915_01916 gene open 177017-177874 metF
3453 PPDE01000009.1 GCA002959915_01917 gene open 178274-179026 rsmG
3454 PPDE01000009.1 GCA002959915_01918 gene open 179595-179708
3455 PPDE01000009.1 GCA002959915_01919 gene open 179765-181636 mnmG
3456 PPDE01000009.1 GCA002959915_01920 gene open 181785-183170 mnmE
3457 PPDE01000009.1 GCA002959915_01921 gene open 183440-184225 jag
3458 PPDE01000009.1 GCA002959915_01922 gene open 184234-184890
3459 PPDE01000009.1 GCA002959915_01923 gene open 185439-185786 rnpA
3460 PPDE01000009.1 GCA002959915_01924 gene open 185866-186000 rpmH
3461 PPDE01000009.1 GCA002959915_01925 gene open 187273-188892 dnaA
3462 PPDE01000009.1 GCA002959915_01926 gene open 189197-190318 dnaN
3463 PPDE01000009.1 GCA002959915_01927 gene open 190350-190580
3464 PPDE01000009.1 GCA002959915_01928 gene open 190584-191684 recF
3465 PPDE01000009.1 GCA002959915_01929 gene open 191671-192570
3466 PPDE01000009.1 GCA002959915_01930 gene open 192705-192956
3467 PPDE01000009.1 GCA002959915_01931 gene open 193066-194967 gyrB
3468 PPDE01000009.1 GCA002959915_01932 gene open 194978-196459 lysP
3469 PPDE01000009.1 GCA002959915_01933 gene open 196635-196952 ybjQ
3470 PPDE01000009.1 GCA002959915_01934 gene open 197612-200674
3471 PPDE01000009.1 GCA002959915_01935 gene open 200671-201735
3472 PPDE01000009.1 GCA002959915_01936 gene open 202234-202371
3473 PPDE01000009.1 GCA002959915_01937 gene open 202848-204197
3474 PPDE01000009.1 GCA002959915_01772 gene open 26554-26642 trnS
3475 PPDE01000009.1 GCA002959915_01830 gene open 87543-87619 trnR
3476 PPDE01000009.1 GCA002959915_01772 tRNA open 26554-26642 trnS tRNA-Ser(tga)
3477 PPDE01000009.1 GCA002959915_01830 tRNA open 87543-87619 trnR tRNA-Arg(cct)
3478 PPDE01000010.1 regulatory_region open 77653-77823 Cobalamin riboswitch aptamer
3479 PPDE01000010.1 repeat_region open 578-2498 CRISPR array with 25 repeats of length 34%2C consensus sequence TTTCCGTCCCCATCAGGGGATTATTTAATTTAAC and spacer length 44
3480 PPDE01000010.1 repeat_region open 12516-13345 CRISPR array with 11 repeats of length 35%2C consensus sequence GTTTCCGTCCCCATCAGGGGATTATTTAATTTAAC and spacer length 43
3481 PPDE01000010.1 GCA002959915_00001 CDS open 2781-3056 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
3482 PPDE01000010.1 GCA002959915_00002 CDS open 3058-3282 _na     74_aa hypothetical protein
3483 PPDE01000010.1 GCA002959915_00003 CDS open 3349-4053 _na     234_aa cas1 CRISPR-associated endonuclease Cas1
3484 PPDE01000010.1 GCA002959915_00004 CDS open 4081-5400 _na     439_aa csm6 type III-A CRISPR-associated CARF protein Csm6
3485 PPDE01000010.1 GCA002959915_00005 CDS open 5397-6167 _na     256_aa cas6a CRISPR-associated protein Cas6 C-terminal domain-containing protein
3486 PPDE01000010.1 GCA002959915_00006 CDS open 6157-7347 _na     396_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
3487 PPDE01000010.1 GCA002959915_00007 CDS open 7340-8338 _na     332_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
3488 PPDE01000010.1 GCA002959915_00008 CDS open 8348-9031 _na     227_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
3489 PPDE01000010.1 GCA002959915_00009 CDS open 9047-9547 _na     166_aa CRISPR system Cms protein Csm2
3490 PPDE01000010.1 GCA002959915_00010 CDS open 9558-12113 _na     851_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
3491 PPDE01000010.1 GCA002959915_00011 CDS open 13616-14971 _na     451_aa dcuC C4-dicarboxylate transporter DcuC
3492 PPDE01000010.1 GCA002959915_00012 CDS open 15103-16281 _na     392_aa yxeP Putative hydrolase YxeP
3493 PPDE01000010.1 GCA002959915_00013 CDS open 16410-16592 _na     60_aa Lipoprotein
3494 PPDE01000010.1 GCA002959915_00014 CDS open 16724-17911 _na     395_aa Acetylornithine aminotransferase
3495 PPDE01000010.1 GCA002959915_00015 CDS open 18001-18858 _na     285_aa Acetylglutamate kinase
3496 PPDE01000010.1 GCA002959915_00016 CDS open 18855-19805 _na     316_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
3497 PPDE01000010.1 GCA002959915_00017 CDS open 19866-20876 _na     336_aa argF ornithine carbamoyltransferase
3498 PPDE01000010.1 GCA002959915_00018 CDS open 20938-22125 _na     395_aa yxeP Putative hydrolase YxeP
3499 PPDE01000010.1 GCA002959915_00019 CDS open 22391-22978 _na     195_aa cynT Carbonic anhydrase
3500 PPDE01000010.1 GCA002959915_00020 CDS open 23280-23792 _na     170_aa ilvN acetolactate synthase small subunit