BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_003048845.1)
Select a Genome:
|
BAKTA Annotations for GCA_003048845.1
|
Search & Sort all 3856 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | PIRB01000012.1 | GCA003048845_00071 | CDS | open | 2681-3943 | _na 420_aa | tetratricopeptide repeat protein | |
| 3502 | PIRB01000012.1 | GCA003048845_00072 | CDS | open | 3922-4287 | _na 121_aa | Zinc/iron-chelating domain-containing protein | |
| 3503 | PIRB01000012.1 | GCA003048845_00073 | CDS | open | 4284-4991 | _na 235_aa | Methyltransferase small domain-containing protein | |
| 3504 | PIRB01000012.1 | GCA003048845_00074 | CDS | open | 4988-7240 | _na 750_aa | Cell division initiation protein DivIVA | |
| 3505 | PIRB01000012.1 | GCA003048845_00075 | CDS | open | 7237-8199 | _na 320_aa | ccoS | Cbb3-type cytochrome oxidase assembly protein CcoS |
| 3506 | PIRB01000012.1 | GCA003048845_00076 | CDS | open | 8224-9564 | _na 446_aa | class II 3-deoxy-7-phosphoheptulonate synthase | |
| 3507 | PIRB01000012.1 | GCA003048845_00077 | CDS | open | 9707-10594 | _na 295_aa | rarD | EamA family transporter RarD |
| 3508 | PIRB01000012.1 | GCA003048845_00078 | CDS | open | 10635-11465 | _na 276_aa | rarD | EamA family transporter RarD |
| 3509 | PIRB01000012.1 | GCA003048845_00079 | CDS | open | 11458-11910 | _na 150_aa | Aryl-sulfate sulfotransferase | |
| 3510 | PIRB01000012.1 | GCA003048845_00080 | CDS | open | 11950-13692 | _na 580_aa | AAA family ATPase | |
| 3511 | PIRB01000012.1 | GCA003048845_00081 | CDS | open | 13664-14857 | _na 397_aa | McrBC 5-methylcytosine restriction system component | |
| 3512 | PIRB01000012.1 | GCA003048845_00082 | CDS | open | 14873-15928 | _na 351_aa | beta-N-acetylhexosaminidase | |
| 3513 | PIRB01000012.1 | GCA003048845_00083 | CDS | open | 15925-16815 | _na 296_aa | NAD(P)H-dependent glycerol-3-phosphate dehydrogenase | |
| 3514 | PIRB01000012.1 | GCA003048845_00084 | CDS | open | 16828-18249 | _na 473_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 3515 | PIRB01000012.1 | GCA003048845_00085 | CDS | open | 18414-19097 | _na 227_aa | atpB | F0F1 ATP synthase subunit A |
| 3516 | PIRB01000012.1 | GCA003048845_00086 | CDS | open | 19163-19924 | _na 253_aa | putative membrane transporter protein | |
| 3517 | PIRB01000012.1 | GCA003048845_00087 | CDS | open | 20068-20604 | _na 178_aa | Superoxide dismutase (Cu/Zn) | |
| 3518 | PIRB01000012.1 | GCA003048845_00088 | CDS | open | 20671-21438 | _na 255_aa | TIGR02757 family protein | |
| 3519 | PIRB01000012.1 | GCA003048845_00089 | CDS | open | 21435-23306 | _na 623_aa | flgK | flagellar hook-associated protein FlgK |
| 3520 | PIRB01000012.1 | GCA003048845_00090 | CDS | open | 23310-23741 | _na 143_aa | flgN | Flagellar biosynthesis protein FlgN |
| 3521 | PIRB01000012.1 | GCA003048845_00091 | CDS | open | 23758-23961 | _na 67_aa | flgM | flagellar biosynthesis anti-sigma factor FlgM |
| 3522 | PIRB01000012.1 | GCA003048845_00092 | CDS | open | 24020-24319 | _na 99_aa | flgJ | Flagellar protein FlgJ N-terminal domain-containing protein |
| 3523 | PIRB01000012.1 | GCA003048845_00093 | CDS | open | 24319-25371 | _na 350_aa | Flagellar P-ring protein | |
| 3524 | PIRB01000012.1 | GCA003048845_00094 | CDS | open | 25428-25994 | _na 188_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 3525 | PIRB01000012.1 | GCA003048845_00095 | CDS | open | 25991-26335 | _na 114_aa | Ornithine carbamoyltransferase | |
| 3526 | PIRB01000012.1 | GCA003048845_00096 | CDS | open | 26455-26850 | _na 131_aa | flaG | FlaG family protein |
| 3527 | PIRB01000012.1 | GCA003048845_00097 | CDS | open | 26853-28613 | _na 586_aa | fliD | flagellar filament capping protein FliD |
| 3528 | PIRB01000012.1 | GCA003048845_00098 | CDS | open | 28623-28994 | _na 123_aa | fliS | flagellar export chaperone FliS |
| 3529 | PIRB01000012.1 | GCA003048845_00099 | CDS | open | 28987-29214 | _na 75_aa | hypothetical protein | |
| 3530 | PIRB01000012.1 | GCA003048845_00068 | gene | open | 420-1427 | mnmH | ||
| 3531 | PIRB01000012.1 | GCA003048845_00069 | gene | open | 1414-1899 | |||
| 3532 | PIRB01000012.1 | GCA003048845_00070 | gene | open | 1899-2684 | trpC | ||
| 3533 | PIRB01000012.1 | GCA003048845_00071 | gene | open | 2681-3943 | |||
| 3534 | PIRB01000012.1 | GCA003048845_00072 | gene | open | 3922-4287 | |||
| 3535 | PIRB01000012.1 | GCA003048845_00073 | gene | open | 4284-4991 | |||
| 3536 | PIRB01000012.1 | GCA003048845_00074 | gene | open | 4988-7240 | |||
| 3537 | PIRB01000012.1 | GCA003048845_00075 | gene | open | 7237-8199 | ccoS | ||
| 3538 | PIRB01000012.1 | GCA003048845_00076 | gene | open | 8224-9564 | |||
| 3539 | PIRB01000012.1 | GCA003048845_00077 | gene | open | 9707-10594 | rarD | ||
| 3540 | PIRB01000012.1 | GCA003048845_00078 | gene | open | 10635-11465 | rarD | ||
| 3541 | PIRB01000012.1 | GCA003048845_00079 | gene | open | 11458-11910 | |||
| 3542 | PIRB01000012.1 | GCA003048845_00080 | gene | open | 11950-13692 | |||
| 3543 | PIRB01000012.1 | GCA003048845_00081 | gene | open | 13664-14857 | |||
| 3544 | PIRB01000012.1 | GCA003048845_00082 | gene | open | 14873-15928 | |||
| 3545 | PIRB01000012.1 | GCA003048845_00083 | gene | open | 15925-16815 | |||
| 3546 | PIRB01000012.1 | GCA003048845_00084 | gene | open | 16828-18249 | gatB | ||
| 3547 | PIRB01000012.1 | GCA003048845_00085 | gene | open | 18414-19097 | atpB | ||
| 3548 | PIRB01000012.1 | GCA003048845_00086 | gene | open | 19163-19924 | |||
| 3549 | PIRB01000012.1 | GCA003048845_00087 | gene | open | 20068-20604 | |||
| 3550 | PIRB01000012.1 | GCA003048845_00088 | gene | open | 20671-21438 | |||
| 3551 | PIRB01000012.1 | GCA003048845_00089 | gene | open | 21435-23306 | flgK | ||
| 3552 | PIRB01000012.1 | GCA003048845_00090 | gene | open | 23310-23741 | flgN | ||
| 3553 | PIRB01000012.1 | GCA003048845_00091 | gene | open | 23758-23961 | flgM | ||
| 3554 | PIRB01000012.1 | GCA003048845_00092 | gene | open | 24020-24319 | flgJ | ||
| 3555 | PIRB01000012.1 | GCA003048845_00093 | gene | open | 24319-25371 | |||
| 3556 | PIRB01000012.1 | GCA003048845_00094 | gene | open | 25428-25994 | rsmD | ||
| 3557 | PIRB01000012.1 | GCA003048845_00095 | gene | open | 25991-26335 | |||
| 3558 | PIRB01000012.1 | GCA003048845_00096 | gene | open | 26455-26850 | flaG | ||
| 3559 | PIRB01000012.1 | GCA003048845_00097 | gene | open | 26853-28613 | fliD | ||
| 3560 | PIRB01000012.1 | GCA003048845_00098 | gene | open | 28623-28994 | fliS | ||
| 3561 | PIRB01000012.1 | GCA003048845_00099 | gene | open | 28987-29214 | |||
| 3562 | PIRB01000013.1 | GCA003048845_00101 | CDS | open | 389-1060 | _na 223_aa | Transposase | |
| 3563 | PIRB01000013.1 | GCA003048845_00102 | CDS | open | 1113-1352 | _na 79_aa | Type III restriction enzyme C-terminal endonuclease domain-containing protein | |
| 3564 | PIRB01000013.1 | GCA003048845_00103 | CDS | open | 1656-2870 | _na 404_aa | AAA+ ATPase domain-containing protein | |
| 3565 | PIRB01000013.1 | GCA003048845_00104 | CDS | open | 2929-5379 | _na 816_aa | Aminotransferase | |
| 3566 | PIRB01000013.1 | GCA003048845_00105 | CDS | open | 5369-5731 | _na 120_aa | mobC | Plasmid mobilization relaxosome protein MobC |
| 3567 | PIRB01000013.1 | GCA003048845_00106 | CDS | open | 5884-6429 | _na 181_aa | Chemotaxis protein | |
| 3568 | PIRB01000013.1 | GCA003048845_00107 | CDS | open | 6407-6709 | _na 100_aa | hypothetical protein | |
| 3569 | PIRB01000013.1 | GCA003048845_00108 | CDS | open | 8016-9797 | _na 593_aa | Tyr recombinase domain-containing protein | |
| 3570 | PIRB01000013.1 | GCA003048845_00109 | CDS | open | 9879-10130 | _na 83_aa | Antitoxin | |
| 3571 | PIRB01000013.1 | GCA003048845_00110 | CDS | open | 10141-10407 | _na 88_aa | relE | Toxin-antitoxin system%2C toxin component%2C RelE family |
| 3572 | PIRB01000013.1 | GCA003048845_00111 | CDS | open | 10774-11103 | _na 109_aa | Bacterial mobilisation domain-containing protein | |
| 3573 | PIRB01000013.1 | GCA003048845_00112 | CDS | open | 11151-12743 | _na 530_aa | Relaxase/mobilization nuclease domain-containing protein | |
| 3574 | PIRB01000013.1 | GCA003048845_00113 | CDS | open | 13410-13583 | _na 57_aa | Transposase | |
| 3575 | PIRB01000013.1 | GCA003048845_00114 | CDS | open | 13646-13771 | _na 41_aa | Putative DNA replication protein | |
| 3576 | PIRB01000013.1 | GCA003048845_00115 | CDS | open | 13943-14302 | _na 119_aa | dnaI | Helicase loader DnaI |
| 3577 | PIRB01000013.1 | GCA003048845_00116 | CDS | open | 14256-14480 | _na 74_aa | Phage protein | |
| 3578 | PIRB01000013.1 | GCA003048845_00117 | CDS | open | 14681-15025 | _na 114_aa | hypothetical protein | |
| 3579 | PIRB01000013.1 | GCA003048845_00118 | CDS | open | 15095-15253 | _na 52_aa | hypothetical protein | |
| 3580 | PIRB01000013.1 | GCA003048845_00119 | CDS | open | 16485-16838 | _na 117_aa | Cupin | |
| 3581 | PIRB01000013.1 | GCA003048845_00120 | CDS | open | 16916-17833 | _na 305_aa | Restriction endonuclease | |
| 3582 | PIRB01000013.1 | GCA003048845_00121 | CDS | open | 17962-19143 | _na 393_aa | Cytosine-specific methyltransferase | |
| 3583 | PIRB01000013.1 | GCA003048845_00122 | CDS | open | 19146-19460 | _na 104_aa | DUF4368 domain-containing protein | |
| 3584 | PIRB01000013.1 | GCA003048845_00123 | CDS | open | 19402-19713 | _na 103_aa | Site-specific recombinase%2C resolvase family%2C putative | |
| 3585 | PIRB01000013.1 | GCA003048845_00124 | CDS | open | 19805-20989 | _na 394_aa | TrsK-like protein | |
| 3586 | PIRB01000013.1 | GCA003048845_00125 | CDS | open | 21196-22059 | _na 287_aa | flgG | Flagellar biosynthesis protein FlgG |
| 3587 | PIRB01000013.1 | GCA003048845_00126 | CDS | open | 22175-23011 | _na 278_aa | Polyribonucleotide nucleotidyltransferase | |
| 3588 | PIRB01000013.1 | GCA003048845_00127 | CDS | open | 23176-23895 | _na 239_aa | Cell surface protein | |
| 3589 | PIRB01000013.1 | GCA003048845_00128 | CDS | open | 23908-25074 | _na 388_aa | DUF4885 domain-containing protein | |
| 3590 | PIRB01000013.1 | GCA003048845_00129 | CDS | open | 25091-25882 | _na 263_aa | Cell surface protein | |
| 3591 | PIRB01000013.1 | GCA003048845_00130 | CDS | open | 25895-27028 | _na 377_aa | DUF4856 domain-containing protein | |
| 3592 | PIRB01000013.1 | GCA003048845_00131 | CDS | open | 27120-28874 | _na 584_aa | Response regulator | |
| 3593 | PIRB01000013.1 | GCA003048845_00132 | CDS | open | 28979-29596 | _na 205_aa | hypothetical protein | |
| 3594 | PIRB01000013.1 | GCA003048845_00101 | gene | open | 389-1060 | |||
| 3595 | PIRB01000013.1 | GCA003048845_00102 | gene | open | 1113-1352 | |||
| 3596 | PIRB01000013.1 | GCA003048845_00103 | gene | open | 1656-2870 | |||
| 3597 | PIRB01000013.1 | GCA003048845_00104 | gene | open | 2929-5379 | |||
| 3598 | PIRB01000013.1 | GCA003048845_00105 | gene | open | 5369-5731 | mobC | ||
| 3599 | PIRB01000013.1 | GCA003048845_00106 | gene | open | 5884-6429 | |||
| 3600 | PIRB01000013.1 | GCA003048845_00107 | gene | open | 6407-6709 | |||
| 3601 | PIRB01000013.1 | GCA003048845_00108 | gene | open | 8016-9797 | |||
| 3602 | PIRB01000013.1 | GCA003048845_00109 | gene | open | 9879-10130 | |||
| 3603 | PIRB01000013.1 | GCA003048845_00110 | gene | open | 10141-10407 | relE | ||
| 3604 | PIRB01000013.1 | GCA003048845_00111 | gene | open | 10774-11103 | |||
| 3605 | PIRB01000013.1 | GCA003048845_00112 | gene | open | 11151-12743 | |||
| 3606 | PIRB01000013.1 | GCA003048845_00113 | gene | open | 13410-13583 | |||
| 3607 | PIRB01000013.1 | GCA003048845_00114 | gene | open | 13646-13771 | |||
| 3608 | PIRB01000013.1 | GCA003048845_00115 | gene | open | 13943-14302 | dnaI | ||
| 3609 | PIRB01000013.1 | GCA003048845_00116 | gene | open | 14256-14480 | |||
| 3610 | PIRB01000013.1 | GCA003048845_00117 | gene | open | 14681-15025 | |||
| 3611 | PIRB01000013.1 | GCA003048845_00118 | gene | open | 15095-15253 | |||
| 3612 | PIRB01000013.1 | GCA003048845_00119 | gene | open | 16485-16838 | |||
| 3613 | PIRB01000013.1 | GCA003048845_00120 | gene | open | 16916-17833 | |||
| 3614 | PIRB01000013.1 | GCA003048845_00121 | gene | open | 17962-19143 | |||
| 3615 | PIRB01000013.1 | GCA003048845_00122 | gene | open | 19146-19460 | |||
| 3616 | PIRB01000013.1 | GCA003048845_00123 | gene | open | 19402-19713 | |||
| 3617 | PIRB01000013.1 | GCA003048845_00124 | gene | open | 19805-20989 | |||
| 3618 | PIRB01000013.1 | GCA003048845_00125 | gene | open | 21196-22059 | flgG | ||
| 3619 | PIRB01000013.1 | GCA003048845_00126 | gene | open | 22175-23011 | |||
| 3620 | PIRB01000013.1 | GCA003048845_00127 | gene | open | 23176-23895 | |||
| 3621 | PIRB01000013.1 | GCA003048845_00128 | gene | open | 23908-25074 | |||
| 3622 | PIRB01000013.1 | GCA003048845_00129 | gene | open | 25091-25882 | |||
| 3623 | PIRB01000013.1 | GCA003048845_00130 | gene | open | 25895-27028 | |||
| 3624 | PIRB01000013.1 | GCA003048845_00131 | gene | open | 27120-28874 | |||
| 3625 | PIRB01000013.1 | GCA003048845_00132 | gene | open | 28979-29596 | |||
| 3626 | PIRB01000014.1 | GCA003048845_00133 | CDS | open | 840-1346 | _na 168_aa | hypothetical protein | |
| 3627 | PIRB01000014.1 | GCA003048845_00134 | CDS | open | 1441-1839 | _na 132_aa | DUF6984 domain-containing protein | |
| 3628 | PIRB01000014.1 | GCA003048845_00135 | CDS | open | 1851-2213 | _na 120_aa | Cyclic nucleotide-binding domain-containing protein | |
| 3629 | PIRB01000014.1 | GCA003048845_00136 | CDS | open | 2176-2304 | _na 42_aa | hypothetical protein | |
| 3630 | PIRB01000014.1 | GCA003048845_00137 | CDS | open | 2367-2828 | _na 153_aa | hypothetical protein | |
| 3631 | PIRB01000014.1 | GCA003048845_00138 | CDS | open | 3113-3688 | _na 191_aa | hypothetical protein | |
| 3632 | PIRB01000014.1 | GCA003048845_00139 | CDS | open | 4032-4316 | _na 94_aa | hypothetical protein | |
| 3633 | PIRB01000014.1 | GCA003048845_00140 | CDS | open | 4370-4813 | _na 147_aa | hypothetical protein | |
| 3634 | PIRB01000014.1 | GCA003048845_00141 | CDS | open | 4827-5192 | _na 121_aa | hypothetical protein | |
| 3635 | PIRB01000014.1 | GCA003048845_00142 | CDS | open | 5270-5608 | _na 112_aa | Zinc ribbon domain-containing protein | |
| 3636 | PIRB01000014.1 | GCA003048845_00143 | CDS | open | 6422-6706 | _na 94_aa | Putative membrane protein | |
| 3637 | PIRB01000014.1 | GCA003048845_00144 | CDS | open | 6703-14070 | _na 2455_aa | Filamentous hemagglutinin N-terminal domain-containing protein | |
| 3638 | PIRB01000014.1 | GCA003048845_00145 | CDS | open | 14080-15852 | _na 590_aa | Hemolysin secretion/activation protein%2C ShlB/FhaC/HecB family | |
| 3639 | PIRB01000014.1 | GCA003048845_00147 | CDS | open | 16547-18061 | _na 504_aa | DUF6538 domain-containing protein | |
| 3640 | PIRB01000014.1 | GCA003048845_00148 | CDS | open | 18079-18687 | _na 202_aa | tyrosine-type recombinase/integrase | |
| 3641 | PIRB01000014.1 | GCA003048845_00149 | CDS | open | 19147-19659 | _na 170_aa | Formylmethanofuran dehydrogenase subunit E domain-containing protein | |
| 3642 | PIRB01000014.1 | GCA003048845_00150 | CDS | open | 19779-20888 | _na 369_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 3643 | PIRB01000014.1 | GCA003048845_00151 | CDS | open | 20906-21853 | _na 315_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 3644 | PIRB01000014.1 | GCA003048845_00152 | CDS | open | 21877-22662 | _na 261_aa | ABC transporter | |
| 3645 | PIRB01000014.1 | GCA003048845_00153 | CDS | open | 22659-23681 | _na 340_aa | Iron ABC transporter permease | |
| 3646 | PIRB01000014.1 | GCA003048845_00154 | CDS | open | 23734-24036 | _na 100_aa | hypothetical protein | |
| 3647 | PIRB01000014.1 | GCA003048845_00155 | CDS | open | 24391-24489 | _na 32_aa | L(+)-tartrate dehydratase subunit beta | |
| 3648 | PIRB01000014.1 | GCA003048845_00156 | CDS | open | 24486-25082 | _na 198_aa | ttdA | L(+)-tartrate dehydratase subunit alpha |
| 3649 | PIRB01000014.1 | GCA003048845_00157 | CDS | open | 25060-25386 | _na 108_aa | L(+)-tartrate dehydratase subunit alpha | |
| 3650 | PIRB01000014.1 | GCA003048845_00158 | CDS | open | 25400-25813 | _na 137_aa | DUF2809 domain-containing protein | |
| 3651 | PIRB01000014.1 | GCA003048845_00159 | CDS | open | 25865-26611 | _na 248_aa | larB | nickel pincer cofactor biosynthesis protein LarB |
| 3652 | PIRB01000014.1 | GCA003048845_00160 | CDS | open | 26608-27381 | _na 257_aa | larE | ATP-dependent sacrificial sulfur transferase LarE |
| 3653 | PIRB01000014.1 | GCA003048845_00161 | CDS | open | 27353-28777 | _na 474_aa | larC | nickel pincer cofactor biosynthesis protein LarC |
| 3654 | PIRB01000014.1 | GCA003048845_00162 | CDS | open | 28774-29016 | _na 80_aa | hypothetical protein | |
| 3655 | PIRB01000014.1 | GCA003048845_00133 | gene | open | 840-1346 | |||
| 3656 | PIRB01000014.1 | GCA003048845_00134 | gene | open | 1441-1839 | |||
| 3657 | PIRB01000014.1 | GCA003048845_00135 | gene | open | 1851-2213 | |||
| 3658 | PIRB01000014.1 | GCA003048845_00136 | gene | open | 2176-2304 | |||
| 3659 | PIRB01000014.1 | GCA003048845_00137 | gene | open | 2367-2828 | |||
| 3660 | PIRB01000014.1 | GCA003048845_00138 | gene | open | 3113-3688 | |||
| 3661 | PIRB01000014.1 | GCA003048845_00139 | gene | open | 4032-4316 | |||
| 3662 | PIRB01000014.1 | GCA003048845_00140 | gene | open | 4370-4813 | |||
| 3663 | PIRB01000014.1 | GCA003048845_00141 | gene | open | 4827-5192 | |||
| 3664 | PIRB01000014.1 | GCA003048845_00142 | gene | open | 5270-5608 | |||
| 3665 | PIRB01000014.1 | GCA003048845_00143 | gene | open | 6422-6706 | |||
| 3666 | PIRB01000014.1 | GCA003048845_00144 | gene | open | 6703-14070 | |||
| 3667 | PIRB01000014.1 | GCA003048845_00145 | gene | open | 14080-15852 | |||
| 3668 | PIRB01000014.1 | GCA003048845_00147 | gene | open | 16547-18061 | |||
| 3669 | PIRB01000014.1 | GCA003048845_00148 | gene | open | 18079-18687 | |||
| 3670 | PIRB01000014.1 | GCA003048845_00149 | gene | open | 19147-19659 | |||
| 3671 | PIRB01000014.1 | GCA003048845_00150 | gene | open | 19779-20888 | |||
| 3672 | PIRB01000014.1 | GCA003048845_00151 | gene | open | 20906-21853 | |||
| 3673 | PIRB01000014.1 | GCA003048845_00152 | gene | open | 21877-22662 | |||
| 3674 | PIRB01000014.1 | GCA003048845_00153 | gene | open | 22659-23681 | |||
| 3675 | PIRB01000014.1 | GCA003048845_00154 | gene | open | 23734-24036 | |||
| 3676 | PIRB01000014.1 | GCA003048845_00155 | gene | open | 24391-24489 | |||
| 3677 | PIRB01000014.1 | GCA003048845_00156 | gene | open | 24486-25082 | ttdA | ||
| 3678 | PIRB01000014.1 | GCA003048845_00157 | gene | open | 25060-25386 | |||
| 3679 | PIRB01000014.1 | GCA003048845_00158 | gene | open | 25400-25813 | |||
| 3680 | PIRB01000014.1 | GCA003048845_00159 | gene | open | 25865-26611 | larB | ||
| 3681 | PIRB01000014.1 | GCA003048845_00160 | gene | open | 26608-27381 | larE | ||
| 3682 | PIRB01000014.1 | GCA003048845_00161 | gene | open | 27353-28777 | larC | ||
| 3683 | PIRB01000014.1 | GCA003048845_00162 | gene | open | 28774-29016 | |||
| 3684 | PIRB01000014.1 | GCA003048845_00146 | gene | open | 16394-16455 | |||
| 3685 | PIRB01000014.1 | GCA003048845_00146 | tRNA | open | 16394-16455 | tRNA-Xxx | ||
| 3686 | PIRB01000015.1 | GCA003048845_00163 | CDS | open | 498-1994 | _na 498_aa | C69 family dipeptidase | |
| 3687 | PIRB01000015.1 | GCA003048845_00164 | CDS | open | 2196-2387 | _na 63_aa | rpmI | 50S ribosomal protein L35 |
| 3688 | PIRB01000015.1 | GCA003048845_00165 | CDS | open | 2488-2844 | _na 118_aa | rplT | 50S ribosomal protein L20 |
| 3689 | PIRB01000015.1 | GCA003048845_00166 | CDS | open | 2991-3734 | _na 247_aa | dapF | diaminopimelate epimerase |
| 3690 | PIRB01000015.1 | GCA003048845_00167 | CDS | open | 3810-4430 | _na 206_aa | Phosphomethylpyrimidine kinase | |
| 3691 | PIRB01000015.1 | GCA003048845_00168 | CDS | open | 4420-5022 | _na 200_aa | coaE | dephospho-CoA kinase |
| 3692 | PIRB01000015.1 | GCA003048845_00169 | CDS | open | 5102-6085 | _na 327_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 3693 | PIRB01000015.1 | GCA003048845_00170 | CDS | open | 6085-6270 | _na 61_aa | hypothetical protein | |
| 3694 | PIRB01000015.1 | GCA003048845_00171 | CDS | open | 6286-6705 | _na 139_aa | RDD domain-containing protein | |
| 3695 | PIRB01000015.1 | GCA003048845_00172 | CDS | open | 6708-7442 | _na 244_aa | hydroxymethylpyrimidine kinase | |
| 3696 | PIRB01000015.1 | GCA003048845_00173 | CDS | open | 7528-8064 | _na 178_aa | Retention module-containing protein | |
| 3697 | PIRB01000015.1 | GCA003048845_00174 | CDS | open | 8214-12353 | _na 1379_aa | PA14 domain-containing protein | |
| 3698 | PIRB01000015.1 | GCA003048845_00175 | CDS | open | 12417-13094 | _na 225_aa | Putative two-component response regulator | |
| 3699 | PIRB01000015.1 | GCA003048845_00176 | CDS | open | 13098-14747 | _na 549_aa | Histidine kinase domain-containing protein | |
| 3700 | PIRB01000015.1 | GCA003048845_00177 | CDS | open | 14788-15411 | _na 207_aa | dsbI | protein-disulfide oxidoreductase DsbI |
| 3701 | PIRB01000015.1 | GCA003048845_00178 | CDS | open | 15421-16077 | _na 218_aa | dsbA | Thiol:disulfide interchange protein DsbA |
| 3702 | PIRB01000015.1 | GCA003048845_00179 | CDS | open | 16472-18307 | _na 611_aa | Arylsulfotransferase N-terminal domain-containing protein | |
| 3703 | PIRB01000015.1 | GCA003048845_00180 | CDS | open | 18467-18652 | _na 61_aa | Integral membrane protein | |
| 3704 | PIRB01000015.1 | GCA003048845_00181 | CDS | open | 18687-19079 | _na 130_aa | Immunity protein 41 | |
| 3705 | PIRB01000015.1 | GCA003048845_00182 | CDS | open | 19076-19243 | _na 55_aa | hypothetical protein | |
| 3706 | PIRB01000015.1 | GCA003048845_00183 | CDS | open | 19346-19459 | _na 37_aa | hypothetical protein | |
| 3707 | PIRB01000015.1 | GCA003048845_00184 | CDS | open | 19525-19623 | _na 32_aa | hypothetical protein | |
| 3708 | PIRB01000015.1 | GCA003048845_00185 | CDS | open | 19830-20462 | _na 210_aa | Tetratricopeptide repeat protein | |
| 3709 | PIRB01000015.1 | GCA003048845_00186 | CDS | open | 20595-20846 | _na 83_aa | hypothetical protein | |
| 3710 | PIRB01000015.1 | GCA003048845_00187 | CDS | open | 20870-21658 | _na 262_aa | Capsular biosynthesis protein | |
| 3711 | PIRB01000015.1 | GCA003048845_00188 | CDS | open | 21724-21960 | _na 78_aa | Colicin E5 ribonuclease domain-containing protein | |
| 3712 | PIRB01000015.1 | GCA003048845_00189 | CDS | open | 22155-22553 | _na 132_aa | hypothetical protein | |
| 3713 | PIRB01000015.1 | GCA003048845_00190 | CDS | open | 22570-23388 | _na 272_aa | Lipoprotein | |
| 3714 | PIRB01000015.1 | GCA003048845_00191 | CDS | open | 23390-24265 | _na 291_aa | Lipoprotein | |
| 3715 | PIRB01000015.1 | GCA003048845_00192 | CDS | open | 24459-24581 | _na 40_aa | hypothetical protein | |
| 3716 | PIRB01000015.1 | GCA003048845_00193 | CDS | open | 24603-24896 | _na 97_aa | Lipoprotein | |
| 3717 | PIRB01000015.1 | GCA003048845_00194 | CDS | open | 24971-25735 | _na 254_aa | Lipoprotein | |
| 3718 | PIRB01000015.1 | GCA003048845_00195 | CDS | open | 25720-26784 | _na 354_aa | hypothetical protein | |
| 3719 | PIRB01000015.1 | GCA003048845_00163 | gene | open | 498-1994 | |||
| 3720 | PIRB01000015.1 | GCA003048845_00164 | gene | open | 2196-2387 | rpmI | ||
| 3721 | PIRB01000015.1 | GCA003048845_00165 | gene | open | 2488-2844 | rplT | ||
| 3722 | PIRB01000015.1 | GCA003048845_00166 | gene | open | 2991-3734 | dapF | ||
| 3723 | PIRB01000015.1 | GCA003048845_00167 | gene | open | 3810-4430 | |||
| 3724 | PIRB01000015.1 | GCA003048845_00168 | gene | open | 4420-5022 | coaE | ||
| 3725 | PIRB01000015.1 | GCA003048845_00169 | gene | open | 5102-6085 | |||
| 3726 | PIRB01000015.1 | GCA003048845_00170 | gene | open | 6085-6270 | |||
| 3727 | PIRB01000015.1 | GCA003048845_00171 | gene | open | 6286-6705 | |||
| 3728 | PIRB01000015.1 | GCA003048845_00172 | gene | open | 6708-7442 | |||
| 3729 | PIRB01000015.1 | GCA003048845_00173 | gene | open | 7528-8064 | |||
| 3730 | PIRB01000015.1 | GCA003048845_00174 | gene | open | 8214-12353 | |||
| 3731 | PIRB01000015.1 | GCA003048845_00175 | gene | open | 12417-13094 | |||
| 3732 | PIRB01000015.1 | GCA003048845_00176 | gene | open | 13098-14747 | |||
| 3733 | PIRB01000015.1 | GCA003048845_00177 | gene | open | 14788-15411 | dsbI | ||
| 3734 | PIRB01000015.1 | GCA003048845_00178 | gene | open | 15421-16077 | dsbA | ||
| 3735 | PIRB01000015.1 | GCA003048845_00179 | gene | open | 16472-18307 | |||
| 3736 | PIRB01000015.1 | GCA003048845_00180 | gene | open | 18467-18652 | |||
| 3737 | PIRB01000015.1 | GCA003048845_00181 | gene | open | 18687-19079 | |||
| 3738 | PIRB01000015.1 | GCA003048845_00182 | gene | open | 19076-19243 | |||
| 3739 | PIRB01000015.1 | GCA003048845_00183 | gene | open | 19346-19459 | |||
| 3740 | PIRB01000015.1 | GCA003048845_00184 | gene | open | 19525-19623 | |||
| 3741 | PIRB01000015.1 | GCA003048845_00185 | gene | open | 19830-20462 | |||
| 3742 | PIRB01000015.1 | GCA003048845_00186 | gene | open | 20595-20846 | |||
| 3743 | PIRB01000015.1 | GCA003048845_00187 | gene | open | 20870-21658 | |||
| 3744 | PIRB01000015.1 | GCA003048845_00188 | gene | open | 21724-21960 | |||
| 3745 | PIRB01000015.1 | GCA003048845_00189 | gene | open | 22155-22553 | |||
| 3746 | PIRB01000015.1 | GCA003048845_00190 | gene | open | 22570-23388 | |||
| 3747 | PIRB01000015.1 | GCA003048845_00191 | gene | open | 23390-24265 | |||
| 3748 | PIRB01000015.1 | GCA003048845_00192 | gene | open | 24459-24581 | |||
| 3749 | PIRB01000015.1 | GCA003048845_00193 | gene | open | 24603-24896 | |||
| 3750 | PIRB01000015.1 | GCA003048845_00194 | gene | open | 24971-25735 | |||
| 3751 | PIRB01000015.1 | GCA003048845_00195 | gene | open | 25720-26784 | |||
| 3752 | PIRB01000016.1 | GCA003048845_00196 | CDS | open | 155-1078 | _na 307_aa | GNAT family N-acetyltransferase | |
| 3753 | PIRB01000016.1 | GCA003048845_00197 | CDS | open | 1079-2395 | _na 438_aa | lipopolysaccharide biosynthesis protein | |
| 3754 | PIRB01000016.1 | GCA003048845_00198 | CDS | open | 2392-3918 | _na 508_aa | hypothetical protein | |
| 3755 | PIRB01000016.1 | GCA003048845_00199 | CDS | open | 3963-5792 | _na 609_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 3756 | PIRB01000016.1 | GCA003048845_00200 | CDS | open | 5776-6924 | _na 382_aa | glycosyltransferase family 4 protein | |
| 3757 | PIRB01000016.1 | GCA003048845_00201 | CDS | open | 6914-8026 | _na 370_aa | Glycosyltransferase family 4 protein | |
| 3758 | PIRB01000016.1 | GCA003048845_00202 | CDS | open | 8023-9087 | _na 354_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 3759 | PIRB01000016.1 | GCA003048845_00203 | CDS | open | 9080-10285 | _na 401_aa | Glycosyltransferase%2C family 1 | |
| 3760 | PIRB01000016.1 | GCA003048845_00204 | CDS | open | 10286-11221 | _na 311_aa | Sugar transferase | |
| 3761 | PIRB01000016.1 | GCA003048845_00205 | CDS | open | 11325-12308 | _na 327_aa | madM | Malonate/sodium symporter MadM subunit N-terminal domain-containing protein |
| 3762 | PIRB01000016.1 | GCA003048845_00206 | CDS | open | 12292-13173 | _na 293_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 3763 | PIRB01000016.1 | GCA003048845_00207 | CDS | open | 13253-14251 | _na 332_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 3764 | PIRB01000016.1 | GCA003048845_00208 | CDS | open | 14268-15467 | _na 399_aa | pgk | Phosphoglycerate kinase |
| 3765 | PIRB01000016.1 | GCA003048845_00209 | CDS | open | 15471-16154 | _na 227_aa | tpiA | triose-phosphate isomerase |
| 3766 | PIRB01000016.1 | GCA003048845_00210 | CDS | open | 16323-17141 | _na 272_aa | fabI | enoyl-ACP reductase FabI |
| 3767 | PIRB01000016.1 | GCA003048845_00211 | CDS | open | 17220-17888 | _na 222_aa | DUF2625 domain-containing protein | |
| 3768 | PIRB01000016.1 | GCA003048845_00196 | gene | open | 155-1078 | |||
| 3769 | PIRB01000016.1 | GCA003048845_00197 | gene | open | 1079-2395 | |||
| 3770 | PIRB01000016.1 | GCA003048845_00198 | gene | open | 2392-3918 | |||
| 3771 | PIRB01000016.1 | GCA003048845_00199 | gene | open | 3963-5792 | asnB | ||
| 3772 | PIRB01000016.1 | GCA003048845_00200 | gene | open | 5776-6924 | |||
| 3773 | PIRB01000016.1 | GCA003048845_00201 | gene | open | 6914-8026 | |||
| 3774 | PIRB01000016.1 | GCA003048845_00202 | gene | open | 8023-9087 | wecB | ||
| 3775 | PIRB01000016.1 | GCA003048845_00203 | gene | open | 9080-10285 | |||
| 3776 | PIRB01000016.1 | GCA003048845_00204 | gene | open | 10286-11221 | |||
| 3777 | PIRB01000016.1 | GCA003048845_00205 | gene | open | 11325-12308 | madM | ||
| 3778 | PIRB01000016.1 | GCA003048845_00206 | gene | open | 12292-13173 | nadD | ||
| 3779 | PIRB01000016.1 | GCA003048845_00207 | gene | open | 13253-14251 | gap | ||
| 3780 | PIRB01000016.1 | GCA003048845_00208 | gene | open | 14268-15467 | pgk | ||
| 3781 | PIRB01000016.1 | GCA003048845_00209 | gene | open | 15471-16154 | tpiA | ||
| 3782 | PIRB01000016.1 | GCA003048845_00210 | gene | open | 16323-17141 | fabI | ||
| 3783 | PIRB01000016.1 | GCA003048845_00211 | gene | open | 17220-17888 | |||
| 3784 | PIRB01000017.1 | repeat_region | open | 8679-11286 | CRISPR array with 40 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 35 | |||
| 3785 | PIRB01000017.1 | GCA003048845_00212 | CDS | open | 264-956 | _na 230_aa | CRISPR associated protein Cas6 C-terminal domain-containing protein | |
| 3786 | PIRB01000017.1 | GCA003048845_00213 | CDS | open | 1125-2891 | _na 588_aa | CRISPR/Cas system-associated protein Cas8%2C type I-B/HMARI | |
| 3787 | PIRB01000017.1 | GCA003048845_00214 | CDS | open | 2902-3843 | _na 313_aa | cas7b | type I-B CRISPR-associated protein Cas7/Csh2 |
| 3788 | PIRB01000017.1 | GCA003048845_00215 | CDS | open | 3845-4555 | _na 236_aa | CRISPR/Cas system-associated RAMP protein Cas5%2C type I-B/HMARI | |
| 3789 | PIRB01000017.1 | GCA003048845_00216 | CDS | open | 4533-6731 | _na 732_aa | CRISPR/Cas system-associated endonuclease/helicase Cas3%2C type I-B/HMARI | |
| 3790 | PIRB01000017.1 | GCA003048845_00217 | CDS | open | 6731-7231 | _na 166_aa | CRISPR-associated exonuclease Cas4 | |
| 3791 | PIRB01000017.1 | GCA003048845_00218 | CDS | open | 7240-7518 | _na 92_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3792 | PIRB01000017.1 | GCA003048845_00219 | CDS | open | 7528-8526 | _na 332_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 3793 | PIRB01000017.1 | GCA003048845_00212 | gene | open | 264-956 | |||
| 3794 | PIRB01000017.1 | GCA003048845_00213 | gene | open | 1125-2891 | |||
| 3795 | PIRB01000017.1 | GCA003048845_00214 | gene | open | 2902-3843 | cas7b | ||
| 3796 | PIRB01000017.1 | GCA003048845_00215 | gene | open | 3845-4555 | |||
| 3797 | PIRB01000017.1 | GCA003048845_00216 | gene | open | 4533-6731 | |||
| 3798 | PIRB01000017.1 | GCA003048845_00217 | gene | open | 6731-7231 | |||
| 3799 | PIRB01000017.1 | GCA003048845_00218 | gene | open | 7240-7518 | cas2 | ||
| 3800 | PIRB01000017.1 | GCA003048845_00219 | gene | open | 7528-8526 | cas1 | ||
| 3801 | PIRB01000018.1 | GCA003048845_00220 | CDS | open | 170-2008 | _na 612_aa | sdhA | 8-methylmenaquinol:fumarate reductase flavoprotein subunit |
| 3802 | PIRB01000018.1 | GCA003048845_00221 | CDS | open | 2018-2983 | _na 321_aa | sdhB | 8-methylmenaquinol:fumarate reductase iron-sulfur subunit |
| 3803 | PIRB01000018.1 | GCA003048845_00222 | CDS | open | 2986-3843 | _na 285_aa | sdhE | 8-methylmenaquinol:fumarate reductase membrane anchor subunit |
| 3804 | PIRB01000018.1 | GCA003048845_00223 | CDS | open | 4165-8865 | _na 1566_aa | PA14 domain-containing protein | |
| 3805 | PIRB01000018.1 | GCA003048845_00224 | CDS | open | 8919-10775 | _na 618_aa | htpG | molecular chaperone HtpG |
| 3806 | PIRB01000018.1 | GCA003048845_00220 | gene | open | 170-2008 | sdhA | ||
| 3807 | PIRB01000018.1 | GCA003048845_00221 | gene | open | 2018-2983 | sdhB | ||
| 3808 | PIRB01000018.1 | GCA003048845_00222 | gene | open | 2986-3843 | sdhE | ||
| 3809 | PIRB01000018.1 | GCA003048845_00223 | gene | open | 4165-8865 | |||
| 3810 | PIRB01000018.1 | GCA003048845_00224 | gene | open | 8919-10775 | htpG | ||
| 3811 | PIRB01000019.1 | GCA003048845_00225 | CDS | open | 180-641 | _na 153_aa | Serine hydroxymethyltransferase | |
| 3812 | PIRB01000019.1 | GCA003048845_00226 | CDS | open | 638-862 | _na 74_aa | hypothetical protein | |
| 3813 | PIRB01000019.1 | GCA003048845_00227 | CDS | open | 932-1303 | _na 123_aa | hypothetical protein | |
| 3814 | PIRB01000019.1 | GCA003048845_00228 | CDS | open | 1641-1961 | _na 106_aa | hypothetical protein | |
| 3815 | PIRB01000019.1 | GCA003048845_00229 | CDS | open | 1968-2174 | _na 68_aa | hypothetical protein | |
| 3816 | PIRB01000019.1 | GCA003048845_00230 | CDS | open | 2116-2823 | _na 235_aa | hypothetical protein | |
| 3817 | PIRB01000019.1 | GCA003048845_00231 | CDS | open | 3199-3660 | _na 153_aa | Serine hydroxymethyltransferase | |
| 3818 | PIRB01000019.1 | GCA003048845_00232 | CDS | open | 3869-4264 | _na 131_aa | Zinc ribbon domain-containing protein | |
| 3819 | PIRB01000019.1 | GCA003048845_00233 | CDS | open | 4268-4696 | _na 142_aa | Zinc ribbon domain-containing protein | |
| 3820 | PIRB01000019.1 | GCA003048845_00234 | CDS | open | 4752-5069 | _na 105_aa | Immunity protein 40 domain-containing protein | |
| 3821 | PIRB01000019.1 | GCA003048845_00235 | CDS | open | 5071-5421 | _na 116_aa | hypothetical protein | |
| 3822 | PIRB01000019.1 | GCA003048845_00236 | CDS | open | 5501-6595 | _na 364_aa | DUF637 domain-containing protein | |
| 3823 | PIRB01000019.1 | GCA003048845_00237 | CDS | open | 7254-7613 | _na 119_aa | hypothetical protein | |
| 3824 | PIRB01000019.1 | GCA003048845_00238 | CDS | open | 7645-7920 | _na 91_aa | Phage associated protein | |
| 3825 | PIRB01000019.1 | GCA003048845_00239 | CDS | open | 8109-8561 | _na 150_aa | DUF4065 domain-containing protein | |
| 3826 | PIRB01000019.1 | GCA003048845_00225 | gene | open | 180-641 | |||
| 3827 | PIRB01000019.1 | GCA003048845_00226 | gene | open | 638-862 | |||
| 3828 | PIRB01000019.1 | GCA003048845_00227 | gene | open | 932-1303 | |||
| 3829 | PIRB01000019.1 | GCA003048845_00228 | gene | open | 1641-1961 | |||
| 3830 | PIRB01000019.1 | GCA003048845_00229 | gene | open | 1968-2174 | |||
| 3831 | PIRB01000019.1 | GCA003048845_00230 | gene | open | 2116-2823 | |||
| 3832 | PIRB01000019.1 | GCA003048845_00231 | gene | open | 3199-3660 | |||
| 3833 | PIRB01000019.1 | GCA003048845_00232 | gene | open | 3869-4264 | |||
| 3834 | PIRB01000019.1 | GCA003048845_00233 | gene | open | 4268-4696 | |||
| 3835 | PIRB01000019.1 | GCA003048845_00234 | gene | open | 4752-5069 | |||
| 3836 | PIRB01000019.1 | GCA003048845_00235 | gene | open | 5071-5421 | |||
| 3837 | PIRB01000019.1 | GCA003048845_00236 | gene | open | 5501-6595 | |||
| 3838 | PIRB01000019.1 | GCA003048845_00237 | gene | open | 7254-7613 | |||
| 3839 | PIRB01000019.1 | GCA003048845_00238 | gene | open | 7645-7920 | |||
| 3840 | PIRB01000019.1 | GCA003048845_00239 | gene | open | 8109-8561 | |||
| 3841 | PIRB01000020.1 | GCA003048845_00841 | gene | open | 44-162 | rrf | ||
| 3842 | PIRB01000020.1 | GCA003048845_00842 | gene | open | 296-3200 | rrl | ||
| 3843 | PIRB01000020.1 | GCA003048845_00845 | gene | open | 3893-5403 | rrs | ||
| 3844 | PIRB01000020.1 | GCA003048845_00841 | rRNA | open | 44-162 | rrf | 5S ribosomal RNA | |
| 3845 | PIRB01000020.1 | GCA003048845_00842 | rRNA | open | 296-3200 | rrl | 23S ribosomal RNA | |
| 3846 | PIRB01000020.1 | GCA003048845_00845 | rRNA | open | 3893-5403 | rrs | 16S ribosomal RNA | |
| 3847 | PIRB01000020.1 | GCA003048845_00843 | gene | open | 3634-3709 | trnA | ||
| 3848 | PIRB01000020.1 | GCA003048845_00844 | gene | open | 3722-3798 | trnI | ||
| 3849 | PIRB01000020.1 | GCA003048845_00843 | tRNA | open | 3634-3709 | trnA | tRNA-Ala(tgc) | |
| 3850 | PIRB01000020.1 | GCA003048845_00844 | tRNA | open | 3722-3798 | trnI | tRNA-Ile(gat) | |
| 3851 | PIRB01000021.1 | GCA003048845_00846 | CDS | open | 46-1953 | _na 635_aa | Methyl-accepting chemotaxis protein | |
| 3852 | PIRB01000021.1 | GCA003048845_00846 | gene | open | 46-1953 | |||
| 3853 | PIRB01000022.1 | GCA003048845_00847 | CDS | open | 176-775 | _na 199_aa | replication protein | |
| 3854 | PIRB01000022.1 | GCA003048845_00848 | CDS | open | 1122-1316 | _na 64_aa | hypothetical protein | |
| 3855 | PIRB01000022.1 | GCA003048845_00847 | gene | open | 176-775 | |||
| 3856 | PIRB01000022.1 | GCA003048845_00848 | gene | open | 1122-1316 |
