HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_003048985.1)

Select a Genome:
BAKTA Annotations for GCA_003048985.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
26 2001690 1968 3 1 41
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4037 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4037 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 PIRS01000002.1 GCA003048985_01042 gene open 208432-208662
1002 PIRS01000002.1 GCA003048985_01043 gene open 208701-208991
1003 PIRS01000002.1 GCA003048985_01044 gene open 209102-209746
1004 PIRS01000002.1 GCA003048985_01045 gene open 209883-210080
1005 PIRS01000002.1 GCA003048985_01046 gene open 210073-210267 yafQ
1006 PIRS01000002.1 GCA003048985_01047 gene open 210476-211132 dsbA
1007 PIRS01000002.1 GCA003048985_01048 gene open 211141-211761 dsbI
1008 PIRS01000002.1 GCA003048985_01049 gene open 211809-213458
1009 PIRS01000002.1 GCA003048985_01050 gene open 213462-214124
1010 PIRS01000002.1 GCA003048985_01051 gene open 214196-218278
1011 PIRS01000002.1 GCA003048985_01052 gene open 218429-218965
1012 PIRS01000002.1 GCA003048985_01053 gene open 219053-219787
1013 PIRS01000002.1 GCA003048985_01054 gene open 219850-220545
1014 PIRS01000002.1 GCA003048985_01055 gene open 220545-221576
1015 PIRS01000002.1 GCA003048985_01056 gene open 221554-222678
1016 PIRS01000002.1 GCA003048985_01057 gene open 222716-224389 ilvD
1017 PIRS01000002.1 GCA003048985_01058 gene open 224713-227844
1018 PIRS01000002.1 GCA003048985_01059 gene open 228033-228383
1019 PIRS01000002.1 GCA003048985_01060 gene open 228420-230186
1020 PIRS01000002.1 GCA003048985_01061 gene open 230341-230442
1021 PIRS01000002.1 GCA003048985_01062 gene open 230452-231576
1022 PIRS01000002.1 GCA003048985_01063 gene open 231569-233104
1023 PIRS01000002.1 GCA003048985_01064 gene open 233106-233321
1024 PIRS01000002.1 GCA003048985_01065 gene open 233447-235081
1025 PIRS01000002.1 GCA003048985_01066 gene open 235163-235735
1026 PIRS01000002.1 GCA003048985_01067 gene open 236048-237622 recJ
1027 PIRS01000002.1 GCA003048985_01068 gene open 237802-237960
1028 PIRS01000002.1 GCA003048985_01069 gene open 238091-238582
1029 PIRS01000002.1 GCA003048985_01070 gene open 238601-239233
1030 PIRS01000002.1 GCA003048985_01071 gene open 239294-240061
1031 PIRS01000002.1 GCA003048985_01072 gene open 240062-240553
1032 PIRS01000002.1 GCA003048985_01073 gene open 240543-241565
1033 PIRS01000002.1 GCA003048985_01074 gene open 241637-242761
1034 PIRS01000002.1 GCA003048985_01075 gene open 242842-243582
1035 PIRS01000002.1 GCA003048985_01076 gene open 244015-244281
1036 PIRS01000002.1 GCA003048985_01077 gene open 244275-244499
1037 PIRS01000002.1 GCA003048985_01078 gene open 244898-245212 hrcA
1038 PIRS01000002.1 GCA003048985_01079 gene open 245310-245648
1039 PIRS01000002.1 GCA003048985_01080 gene open 245645-245881
1040 PIRS01000002.1 GCA003048985_01081 gene open 245878-246243
1041 PIRS01000002.1 GCA003048985_01082 gene open 246396-246617
1042 PIRS01000002.1 GCA003048985_01083 gene open 247543-248337
1043 PIRS01000002.1 GCA003048985_01084 gene open 248352-249101
1044 PIRS01000002.1 GCA003048985_01085 gene open 249079-249315
1045 PIRS01000002.1 GCA003048985_01086 gene open 249320-249589
1046 PIRS01000002.1 GCA003048985_01087 gene open 249586-249798
1047 PIRS01000002.1 GCA003048985_01088 gene open 250341-250778
1048 PIRS01000002.1 GCA003048985_01089 gene open 250779-251999
1049 PIRS01000002.1 GCA003048985_01094 gene open 252660-252815
1050 PIRS01000002.1 GCA003048985_01096 gene open 253211-253699
1051 PIRS01000002.1 GCA003048985_01097 gene open 253706-254236 tpx
1052 PIRS01000002.1 GCA003048985_01098 gene open 254246-255388
1053 PIRS01000002.1 GCA003048985_01099 gene open 255606-256061
1054 PIRS01000002.1 GCA003048985_01100 gene open 256150-257316
1055 PIRS01000002.1 GCA003048985_01101 gene open 258102-258719 sodB
1056 PIRS01000002.1 GCA003048985_00831 gene open 1-65 trnK
1057 PIRS01000002.1 GCA003048985_00906 gene open 75339-75423 trnL
1058 PIRS01000002.1 GCA003048985_00907 gene open 75438-75514 trnR
1059 PIRS01000002.1 GCA003048985_00908 gene open 75530-75606 trnR
1060 PIRS01000002.1 GCA003048985_00909 gene open 75613-75689 trnH
1061 PIRS01000002.1 GCA003048985_00910 gene open 75699-75776 trnP
1062 PIRS01000002.1 GCA003048985_00914 gene open 80254-80328 trnE
1063 PIRS01000002.1 GCA003048985_00968 gene open 131553-131628 trnV
1064 PIRS01000002.1 GCA003048985_01090 gene open 252191-252266 trnA
1065 PIRS01000002.1 GCA003048985_01091 gene open 252373-252447 trnG
1066 PIRS01000002.1 GCA003048985_01092 gene open 252457-252543 trnL
1067 PIRS01000002.1 GCA003048985_01093 gene open 252553-252626 trnC
1068 PIRS01000002.1 GCA003048985_01095 gene open 252874-252963 trnS
1069 PIRS01000002.1 GCA003048985_00831 tRNA open 1-65 trnK tRNA-Lys(ttt)
1070 PIRS01000002.1 GCA003048985_00906 tRNA open 75339-75423 trnL tRNA-Leu(tag)
1071 PIRS01000002.1 GCA003048985_00907 tRNA open 75438-75514 trnR tRNA-Arg(tct)
1072 PIRS01000002.1 GCA003048985_00908 tRNA open 75530-75606 trnR tRNA-Arg(tcg)
1073 PIRS01000002.1 GCA003048985_00909 tRNA open 75613-75689 trnH tRNA-His(gtg)
1074 PIRS01000002.1 GCA003048985_00910 tRNA open 75699-75776 trnP tRNA-Pro(tgg)
1075 PIRS01000002.1 GCA003048985_00914 tRNA open 80254-80328 trnE tRNA-Glu(ttc)
1076 PIRS01000002.1 GCA003048985_00968 tRNA open 131553-131628 trnV tRNA-Val(gac)
1077 PIRS01000002.1 GCA003048985_01090 tRNA open 252191-252266 trnA tRNA-Ala(ggc)
1078 PIRS01000002.1 GCA003048985_01091 tRNA open 252373-252447 trnG tRNA-Gly(gcc)
1079 PIRS01000002.1 GCA003048985_01092 tRNA open 252457-252543 trnL tRNA-Leu(taa)
1080 PIRS01000002.1 GCA003048985_01093 tRNA open 252553-252626 trnC tRNA-Cys(gca)
1081 PIRS01000002.1 GCA003048985_01095 tRNA open 252874-252963 trnS tRNA-Ser(tga)
1082 PIRS01000003.1 GCA003048985_01102 CDS open 446-1141 _na     231_aa Carbamoyl-phosphate synthase large subunit
1083 PIRS01000003.1 GCA003048985_01103 CDS open 1145-2362 _na     405_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
1084 PIRS01000003.1 GCA003048985_01104 CDS open 2372-2812 _na     146_aa Phosphoribosyltransferase domain-containing protein
1085 PIRS01000003.1 GCA003048985_01105 CDS open 2825-4117 _na     430_aa Xanthine
1086 PIRS01000003.1 GCA003048985_01106 CDS open 4129-5190 _na     353_aa mqnE aminofutalosine synthase MqnE
1087 PIRS01000003.1 GCA003048985_01107 CDS open 5304-7802 _na     832_aa [protein-PII] uridylyltransferase
1088 PIRS01000003.1 GCA003048985_01108 CDS open 7806-9617 _na     603_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1089 PIRS01000003.1 GCA003048985_01109 CDS open 9764-10552 _na     262_aa Peptidoglycan-binding protein
1090 PIRS01000003.1 GCA003048985_01110 CDS open 10554-10979 _na     141_aa Gamma-glutamyl phosphate reductase
1091 PIRS01000003.1 GCA003048985_01111 CDS open 11011-11283 _na     90_aa DUF4172 domain-containing protein
1092 PIRS01000003.1 GCA003048985_01112 CDS open 11891-12385 _na     164_aa DJ-1/PfpI domain-containing protein
1093 PIRS01000003.1 GCA003048985_01113 CDS open 12399-13598 _na     399_aa Tetrahydrodipicolinate succinylase
1094 PIRS01000003.1 GCA003048985_01114 CDS open 13759-13944 _na     61_aa hypothetical protein
1095 PIRS01000003.1 GCA003048985_01115 CDS open 14498-14950 _na     150_aa DUF2262 domain-containing protein
1096 PIRS01000003.1 GCA003048985_01116 CDS open 15106-15795 _na     229_aa Cytochrome-c oxidase
1097 PIRS01000003.1 GCA003048985_01117 CDS open 15898-17235 _na     445_aa UPF0210 protein Ccon26_06850
1098 PIRS01000003.1 GCA003048985_01118 CDS open 17245-17511 _na     88_aa ACT domain-containing protein
1099 PIRS01000003.1 GCA003048985_01119 CDS open 17654-18754 _na     366_aa Iron-sulfur cluster carrier protein
1100 PIRS01000003.1 GCA003048985_01120 CDS open 18748-20043 _na     431_aa thiC phosphomethylpyrimidine synthase ThiC
1101 PIRS01000003.1 GCA003048985_01121 CDS open 20190-21308 _na     372_aa ispDF bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
1102 PIRS01000003.1 GCA003048985_01122 CDS open 21305-22195 _na     296_aa Response regulatory domain-containing protein
1103 PIRS01000003.1 GCA003048985_01123 CDS open 22173-23354 _na     393_aa Sulfate adenylyltransferase
1104 PIRS01000003.1 GCA003048985_01124 CDS open 23363-23830 _na     155_aa Phosphatidylglycerophosphatase A
1105 PIRS01000003.1 GCA003048985_01125 CDS open 23899-24453 _na     184_aa Integral membrane protein
1106 PIRS01000003.1 GCA003048985_01126 CDS open 24532-24966 _na     144_aa Fatty-acid--CoA ligase
1107 PIRS01000003.1 GCA003048985_01127 CDS open 24967-28062 _na     1031_aa Cytochrome C biogenesis protein
1108 PIRS01000003.1 GCA003048985_01128 CDS open 28108-28665 _na     185_aa Cytochrome c domain-containing protein
1109 PIRS01000003.1 GCA003048985_01129 CDS open 28759-29988 _na     409_aa major outer membrane protein
1110 PIRS01000003.1 GCA003048985_01130 CDS open 30257-30694 _na     145_aa Lipoprotein
1111 PIRS01000003.1 GCA003048985_01131 CDS open 30818-31405 _na     195_aa Hydrogenase-4 component G
1112 PIRS01000003.1 GCA003048985_01132 CDS open 31489-31923 _na     144_aa Ferritin/DPS protein domain-containing protein
1113 PIRS01000003.1 GCA003048985_01133 CDS open 32076-32453 _na     125_aa Rhodanese domain-containing protein
1114 PIRS01000003.1 GCA003048985_01135 CDS open 32840-34918 _na     692_aa fusA elongation factor G
1115 PIRS01000003.1 GCA003048985_01136 CDS open 34931-35401 _na     156_aa rpsG 30S ribosomal protein S7
1116 PIRS01000003.1 GCA003048985_01137 CDS open 35480-35875 _na     131_aa rpsL 30S ribosomal protein S12
1117 PIRS01000003.1 GCA003048985_01138 CDS open 35956-37089 _na     377_aa iadA beta-aspartyl-peptidase
1118 PIRS01000003.1 GCA003048985_01139 CDS open 37086-38441 _na     451_aa nhaC Na+/H+ antiporter NhaC
1119 PIRS01000003.1 GCA003048985_01140 CDS open 38641-39030 _na     129_aa doxX DoxX family protein
1120 PIRS01000003.1 GCA003048985_01141 CDS open 39163-43677 _na     1504_aa rpoC DNA-directed RNA polymerase subunit beta'
1121 PIRS01000003.1 GCA003048985_01142 CDS open 43664-47809 _na     1381_aa rpoB DNA-directed RNA polymerase subunit beta
1122 PIRS01000003.1 GCA003048985_01143 CDS open 47927-48304 _na     125_aa rplL 50S ribosomal protein L7/L12
1123 PIRS01000003.1 GCA003048985_01144 CDS open 48334-48819 _na     161_aa rplJ 50S ribosomal protein L10
1124 PIRS01000003.1 GCA003048985_01145 CDS open 48923-49624 _na     233_aa rplA 50S ribosomal protein L1
1125 PIRS01000003.1 GCA003048985_01146 CDS open 49684-50109 _na     141_aa rplK 50S ribosomal protein L11
1126 PIRS01000003.1 GCA003048985_01147 CDS open 50120-50650 _na     176_aa nusG transcription termination/antitermination protein NusG
1127 PIRS01000003.1 GCA003048985_01148 CDS open 50666-50845 _na     59_aa secE preprotein translocase subunit SecE
1128 PIRS01000003.1 GCA003048985_01150 CDS open 50958-51116 _na     52_aa rpmG 50S ribosomal protein L33
1129 PIRS01000003.1 GCA003048985_01151 CDS open 51170-52369 _na     399_aa tuf elongation factor Tu
1130 PIRS01000003.1 GCA003048985_01156 CDS open 53196-53444 _na     82_aa Flagellar biosynthesis protein
1131 PIRS01000003.1 GCA003048985_01157 CDS open 53441-54067 _na     208_aa Transglutaminase-like domain-containing protein
1132 PIRS01000003.1 GCA003048985_01158 CDS open 54060-54695 _na     211_aa HTH luxR-type domain-containing protein
1133 PIRS01000003.1 GCA003048985_01159 CDS open 54713-55210 _na     165_aa DUF5416 domain-containing protein
1134 PIRS01000003.1 GCA003048985_01160 CDS open 55210-56676 _na     488_aa Membrane fusion protein biotin-lipoyl like domain-containing protein
1135 PIRS01000003.1 GCA003048985_01161 CDS open 56679-58817 _na     712_aa ABC transporter%2C ATP-binding/permease protein
1136 PIRS01000003.1 GCA003048985_01162 CDS open 58821-60770 _na     649_aa Diguanylate cyclase (GGDEF) domain-containing protein
1137 PIRS01000003.1 GCA003048985_01163 CDS open 60767-61426 _na     219_aa Transglutaminase-like domain-containing protein
1138 PIRS01000003.1 GCA003048985_01164 CDS open 61447-63126 _na     559_aa Agglutination protein
1139 PIRS01000003.1 GCA003048985_01165 CDS open 63240-64601 _na     453_aa hemN oxygen-independent coproporphyrinogen III oxidase
1140 PIRS01000003.1 GCA003048985_01166 CDS open 64594-65079 _na     161_aa UPF0763 protein Ccon26_06450
1141 PIRS01000003.1 GCA003048985_01167 CDS open 65076-65993 _na     305_aa argF ornithine carbamoyltransferase
1142 PIRS01000003.1 GCA003048985_01168 CDS open 65995-66966 _na     323_aa hemB porphobilinogen synthase
1143 PIRS01000003.1 GCA003048985_01169 CDS open 67035-67598 _na     187_aa GTP cyclohydrolase-2
1144 PIRS01000003.1 GCA003048985_01170 CDS open 67598-68164 _na     188_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
1145 PIRS01000003.1 GCA003048985_01171 CDS open 68161-68355 _na     64_aa Periplasmic protein
1146 PIRS01000003.1 GCA003048985_01172 CDS open 68352-68717 _na     121_aa Indole-3-glycerol-phosphate synthase
1147 PIRS01000003.1 GCA003048985_01173 CDS open 68726-69592 _na     288_aa htpX zinc metalloprotease HtpX
1148 PIRS01000003.1 GCA003048985_01174 CDS open 70089-70490 _na     133_aa flaH Flagellar protein FlaH
1149 PIRS01000003.1 GCA003048985_01175 CDS open 70481-70912 _na     143_aa Peptide deformylase
1150 PIRS01000003.1 GCA003048985_01176 CDS open 70922-71935 _na     337_aa alr alanine racemase
1151 PIRS01000003.1 GCA003048985_01177 CDS open 71928-72167 _na     79_aa Chain-length determining protein
1152 PIRS01000003.1 GCA003048985_01178 CDS open 72170-73135 _na     321_aa L%2CD-TPase catalytic domain-containing protein
1153 PIRS01000003.1 GCA003048985_01179 CDS open 73273-73695 _na     140_aa Copper chaperone PCu(A)C
1154 PIRS01000003.1 GCA003048985_01180 CDS open 73695-74159 _na     154_aa Periplasmic protein
1155 PIRS01000003.1 GCA003048985_01181 CDS open 74169-74711 _na     180_aa Cytochrome oxidase biogenesis protein%2C Sco1/SenC/PrrC family
1156 PIRS01000003.1 GCA003048985_01182 CDS open 74829-76778 _na     649_aa Methyl-accepting chemotaxis signal transduction protein
1157 PIRS01000003.1 GCA003048985_01183 CDS open 77096-77554 _na     152_aa Methylated-DNA--protein-cysteine methyltransferase
1158 PIRS01000003.1 GCA003048985_01184 CDS open 77677-80262 _na     861_aa bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
1159 PIRS01000003.1 GCA003048985_01185 CDS open 80299-81510 _na     403_aa Ankyrin repeat domain-containing protein
1160 PIRS01000003.1 GCA003048985_01186 CDS open 81519-82265 _na     248_aa Oxidoreductase
1161 PIRS01000003.1 GCA003048985_01187 CDS open 82275-83978 _na     567_aa Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
1162 PIRS01000003.1 GCA003048985_01188 CDS open 83981-85090 _na     369_aa trmA tRNA (uridine(54)-C5)-methyltransferase TrmA
1163 PIRS01000003.1 GCA003048985_01189 CDS open 85105-86316 _na     403_aa ilvA threonine ammonia-lyase
1164 PIRS01000003.1 GCA003048985_01190 CDS open 86409-87242 _na     277_aa Metallo-beta-lactamase domain-containing protein
1165 PIRS01000003.1 GCA003048985_01191 CDS open 87299-87994 _na     231_aa DUF4230 domain-containing protein
1166 PIRS01000003.1 GCA003048985_01192 CDS open 88018-88941 _na     307_aa Dyp-type peroxidase family protein
1167 PIRS01000003.1 GCA003048985_01193 CDS open 88993-89415 _na     140_aa eamA EamA domain-containing protein
1168 PIRS01000003.1 GCA003048985_01194 CDS open 89514-90089 _na     191_aa Molybdopterin-containing oxidoreductase II%2C DMSO/TMAO/BSO reductase family%2C monoheme c-type cytochrome
1169 PIRS01000003.1 GCA003048985_01195 CDS open 90099-92666 _na     855_aa Anaerobic dimethyl sulfoxide reductase chain A
1170 PIRS01000003.1 GCA003048985_01196 CDS open 92987-94957 _na     656_aa DNA polymerase III
1171 PIRS01000003.1 GCA003048985_01197 CDS open 95602-96435 _na     277_aa modD Putative pyrophosphorylase ModD
1172 PIRS01000003.1 GCA003048985_01198 CDS open 96437-96694 _na     85_aa Helicase
1173 PIRS01000003.1 GCA003048985_01199 CDS open 96705-98165 _na     486_aa Na+/alanine symporter family protein
1174 PIRS01000003.1 GCA003048985_01200 CDS open 98183-100273 _na     696_aa Lead%2C cadmium%2C zinc and mercury transporting ATPase
1175 PIRS01000003.1 GCA003048985_01201 CDS open 100242-100562 _na     106_aa Oxidoreductase
1176 PIRS01000003.1 GCA003048985_01202 CDS open 100562-100876 _na     104_aa Cys/Met metabolism pyridoxal-phosphate-dependent enzyme
1177 PIRS01000003.1 GCA003048985_01203 CDS open 100886-101236 _na     116_aa Periplasmic protein
1178 PIRS01000003.1 GCA003048985_01204 CDS open 101229-101879 _na     216_aa Aminotransferase
1179 PIRS01000003.1 GCA003048985_01205 CDS open 101872-102195 _na     107_aa HMA domain-containing protein
1180 PIRS01000003.1 GCA003048985_01206 CDS open 102298-102744 _na     148_aa Transcriptional regulator%2C Fur family
1181 PIRS01000003.1 GCA003048985_01207 CDS open 102895-103104 _na     69_aa hypothetical protein
1182 PIRS01000003.1 GCA003048985_01208 CDS open 103211-103876 _na     221_aa Ysc84 actin-binding domain-containing protein
1183 PIRS01000003.1 GCA003048985_01209 CDS open 103994-104602 _na     202_aa Glycine transporter domain-containing protein
1184 PIRS01000003.1 GCA003048985_01210 CDS open 104599-105585 _na     328_aa Dihydrodipicolinate reductase
1185 PIRS01000003.1 GCA003048985_01211 CDS open 105574-106056 _na     160_aa ybaK Cys-tRNA(Pro) deacylase
1186 PIRS01000003.1 GCA003048985_01212 CDS open 106115-106651 _na     178_aa fliL flagellar basal body-associated protein FliL
1187 PIRS01000003.1 GCA003048985_01213 CDS open 106648-106992 _na     114_aa acpS Holo-[acyl-carrier-protein] synthase
1188 PIRS01000003.1 GCA003048985_01214 CDS open 107127-107930 _na     267_aa hypothetical protein
1189 PIRS01000003.1 GCA003048985_01215 CDS open 107947-108735 _na     262_aa Cell surface protein
1190 PIRS01000003.1 GCA003048985_01216 CDS open 108798-108920 _na     40_aa hypothetical protein
1191 PIRS01000003.1 GCA003048985_01217 CDS open 108931-109362 _na     143_aa hypothetical protein
1192 PIRS01000003.1 GCA003048985_01218 CDS open 109631-110731 _na     366_aa flgG Flagellar biosynthesis protein FlgG
1193 PIRS01000003.1 GCA003048985_01220 CDS open 111024-111326 _na     100_aa DNA-binding protein HU
1194 PIRS01000003.1 GCA003048985_01221 CDS open 111451-112197 _na     248_aa yaaA YaaA family protein
1195 PIRS01000003.1 GCA003048985_01222 CDS open 112339-114654 _na     771_aa flgL flagellar hook-associated protein FlgL
1196 PIRS01000003.1 GCA003048985_01223 CDS open 114834-116891 _na     685_aa DUF87 domain-containing protein
1197 PIRS01000003.1 GCA003048985_01224 CDS open 117008-118126 _na     372_aa GGDEF family protein
1198 PIRS01000003.1 GCA003048985_01225 CDS open 118388-118579 _na     63_aa hypothetical protein
1199 PIRS01000003.1 GCA003048985_01226 CDS open 118632-119063 _na     143_aa tyrosine-type recombinase/integrase
1200 PIRS01000003.1 GCA003048985_01229 CDS open 119403-119609 _na     68_aa DUF465 domain-containing protein
1201 PIRS01000003.1 GCA003048985_01230 CDS open 119742-120872 _na     376_aa Potassium channel protein
1202 PIRS01000003.1 GCA003048985_01231 CDS open 120895-121086 _na     63_aa rpmB 50S ribosomal protein L28
1203 PIRS01000003.1 GCA003048985_01232 CDS open 121238-121984 _na     248_aa hypothetical protein
1204 PIRS01000003.1 GCA003048985_01233 CDS open 121981-123354 _na     457_aa STAS domain-containing protein
1205 PIRS01000003.1 GCA003048985_01234 CDS open 123364-124011 _na     215_aa rpe ribulose-phosphate 3-epimerase
1206 PIRS01000003.1 GCA003048985_01235 CDS open 124008-124811 _na     267_aa 3'-5' exonuclease
1207 PIRS01000003.1 GCA003048985_01236 CDS open 125245-127338 _na     697_aa RNA degradosome polyphosphate kinase
1208 PIRS01000003.1 GCA003048985_01237 CDS open 127526-128110 _na     194_aa Uridine diphosphate glucose pyrophosphatase
1209 PIRS01000003.1 GCA003048985_01238 CDS open 128095-129462 _na     455_aa mgtE magnesium transporter
1210 PIRS01000003.1 GCA003048985_01239 CDS open 129472-130641 _na     389_aa Endopeptidase
1211 PIRS01000003.1 GCA003048985_01240 CDS open 130756-131478 _na     240_aa pgbA Plasminogen-binding protein PgbA N-terminal domain-containing protein
1212 PIRS01000003.1 GCA003048985_01241 CDS open 131530-132303 _na     257_aa brkB Virulence factor%2C BrkB family protein
1213 PIRS01000003.1 GCA003048985_01242 CDS open 132378-133406 _na     342_aa hypothetical protein
1214 PIRS01000003.1 GCA003048985_01243 CDS open 133387-134109 _na     240_aa Calcineurin-like phosphoesterase domain-containing protein
1215 PIRS01000003.1 GCA003048985_01244 CDS open 134238-135713 _na     491_aa Aldehyde dehydrogenase B
1216 PIRS01000003.1 GCA003048985_01245 CDS open 135840-137021 _na     393_aa histidine kinase
1217 PIRS01000003.1 GCA003048985_01246 CDS open 137002-137664 _na     220_aa Two-component system response regulator
1218 PIRS01000003.1 GCA003048985_01247 CDS open 137674-137916 _na     80_aa Pyruvate kinase
1219 PIRS01000003.1 GCA003048985_01248 CDS open 137979-138884 _na     301_aa Auxin efflux carrier
1220 PIRS01000003.1 GCA003048985_01249 CDS open 138979-140739 _na     586_aa Response regulator
1221 PIRS01000003.1 GCA003048985_01250 CDS open 140848-141483 _na     211_aa Pyridoxal phosphate homeostasis protein
1222 PIRS01000003.1 GCA003048985_01251 CDS open 141483-142592 _na     369_aa rseP RIP metalloprotease RseP
1223 PIRS01000003.1 GCA003048985_01252 CDS open 142669-143565 _na     298_aa hypothetical protein
1224 PIRS01000003.1 GCA003048985_01253 CDS open 143568-144113 _na     181_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1225 PIRS01000003.1 GCA003048985_01254 CDS open 144145-144933 _na     262_aa enoyl-ACP reductase
1226 PIRS01000003.1 GCA003048985_01255 CDS open 144933-145826 _na     297_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
1227 PIRS01000003.1 GCA003048985_01256 CDS open 145829-147070 _na     413_aa Zn-dependent peptidase%2C M16 family
1228 PIRS01000003.1 GCA003048985_01257 CDS open 147082-148155 _na     357_aa quinone-dependent dihydroorotate dehydrogenase
1229 PIRS01000003.1 GCA003048985_01258 CDS open 148209-149957 _na     582_aa Lipid A export ATP-binding/permease protein
1230 PIRS01000003.1 GCA003048985_01259 CDS open 149926-151320 _na     464_aa cysS cysteine--tRNA ligase
1231 PIRS01000003.1 GCA003048985_01260 CDS open 151307-152707 _na     466_aa murJ murein biosynthesis integral membrane protein MurJ
1232 PIRS01000003.1 GCA003048985_01261 CDS open 152830-154761 _na     643_aa Flagellar Assembly Protein A N-terminal region domain-containing protein
1233 PIRS01000003.1 GCA003048985_01262 CDS open 154761-155315 _na     184_aa ruvA Holliday junction branch migration protein RuvA
1234 PIRS01000003.1 GCA003048985_01263 CDS open 155327-156367 _na     346_aa ddl D-alanine--D-alanine ligase
1235 PIRS01000003.1 GCA003048985_01264 CDS open 156432-156662 _na     76_aa Antitoxin
1236 PIRS01000003.1 GCA003048985_01265 CDS open 156652-157437 _na     261_aa AB hydrolase-1 domain-containing protein
1237 PIRS01000003.1 GCA003048985_01266 CDS open 157434-158858 _na     474_aa UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanine ligase
1238 PIRS01000003.1 GCA003048985_01267 CDS open 158855-159307 _na     150_aa Beta-lactamase
1239 PIRS01000003.1 GCA003048985_01268 CDS open 159482-159976 _na     164_aa TM2 domain-containing protein
1240 PIRS01000003.1 GCA003048985_01269 CDS open 160028-161089 _na     353_aa xerH Tyrosine recombinase XerH
1241 PIRS01000003.1 GCA003048985_01270 CDS open 161092-162285 _na     397_aa ackA Acetate kinase
1242 PIRS01000003.1 GCA003048985_01271 CDS open 162287-163654 _na     455_aa pta phosphate acetyltransferase
1243 PIRS01000003.1 GCA003048985_01272 CDS open 163722-164429 _na     235_aa flgH flagellar basal body L-ring protein FlgH
1244 PIRS01000003.1 GCA003048985_01102 gene open 446-1141
1245 PIRS01000003.1 GCA003048985_01103 gene open 1145-2362
1246 PIRS01000003.1 GCA003048985_01104 gene open 2372-2812
1247 PIRS01000003.1 GCA003048985_01105 gene open 2825-4117
1248 PIRS01000003.1 GCA003048985_01106 gene open 4129-5190 mqnE
1249 PIRS01000003.1 GCA003048985_01107 gene open 5304-7802
1250 PIRS01000003.1 GCA003048985_01108 gene open 7806-9617 glmS
1251 PIRS01000003.1 GCA003048985_01109 gene open 9764-10552
1252 PIRS01000003.1 GCA003048985_01110 gene open 10554-10979
1253 PIRS01000003.1 GCA003048985_01111 gene open 11011-11283
1254 PIRS01000003.1 GCA003048985_01112 gene open 11891-12385
1255 PIRS01000003.1 GCA003048985_01113 gene open 12399-13598
1256 PIRS01000003.1 GCA003048985_01114 gene open 13759-13944
1257 PIRS01000003.1 GCA003048985_01115 gene open 14498-14950
1258 PIRS01000003.1 GCA003048985_01116 gene open 15106-15795
1259 PIRS01000003.1 GCA003048985_01117 gene open 15898-17235
1260 PIRS01000003.1 GCA003048985_01118 gene open 17245-17511
1261 PIRS01000003.1 GCA003048985_01119 gene open 17654-18754
1262 PIRS01000003.1 GCA003048985_01120 gene open 18748-20043 thiC
1263 PIRS01000003.1 GCA003048985_01121 gene open 20190-21308 ispDF
1264 PIRS01000003.1 GCA003048985_01122 gene open 21305-22195
1265 PIRS01000003.1 GCA003048985_01123 gene open 22173-23354
1266 PIRS01000003.1 GCA003048985_01124 gene open 23363-23830
1267 PIRS01000003.1 GCA003048985_01125 gene open 23899-24453
1268 PIRS01000003.1 GCA003048985_01126 gene open 24532-24966
1269 PIRS01000003.1 GCA003048985_01127 gene open 24967-28062
1270 PIRS01000003.1 GCA003048985_01128 gene open 28108-28665
1271 PIRS01000003.1 GCA003048985_01129 gene open 28759-29988
1272 PIRS01000003.1 GCA003048985_01130 gene open 30257-30694
1273 PIRS01000003.1 GCA003048985_01131 gene open 30818-31405
1274 PIRS01000003.1 GCA003048985_01132 gene open 31489-31923
1275 PIRS01000003.1 GCA003048985_01133 gene open 32076-32453
1276 PIRS01000003.1 GCA003048985_01135 gene open 32840-34918 fusA
1277 PIRS01000003.1 GCA003048985_01136 gene open 34931-35401 rpsG
1278 PIRS01000003.1 GCA003048985_01137 gene open 35480-35875 rpsL
1279 PIRS01000003.1 GCA003048985_01138 gene open 35956-37089 iadA
1280 PIRS01000003.1 GCA003048985_01139 gene open 37086-38441 nhaC
1281 PIRS01000003.1 GCA003048985_01140 gene open 38641-39030 doxX
1282 PIRS01000003.1 GCA003048985_01141 gene open 39163-43677 rpoC
1283 PIRS01000003.1 GCA003048985_01142 gene open 43664-47809 rpoB
1284 PIRS01000003.1 GCA003048985_01143 gene open 47927-48304 rplL
1285 PIRS01000003.1 GCA003048985_01144 gene open 48334-48819 rplJ
1286 PIRS01000003.1 GCA003048985_01145 gene open 48923-49624 rplA
1287 PIRS01000003.1 GCA003048985_01146 gene open 49684-50109 rplK
1288 PIRS01000003.1 GCA003048985_01147 gene open 50120-50650 nusG
1289 PIRS01000003.1 GCA003048985_01148 gene open 50666-50845 secE
1290 PIRS01000003.1 GCA003048985_01150 gene open 50958-51116 rpmG
1291 PIRS01000003.1 GCA003048985_01151 gene open 51170-52369 tuf
1292 PIRS01000003.1 GCA003048985_01156 gene open 53196-53444
1293 PIRS01000003.1 GCA003048985_01157 gene open 53441-54067
1294 PIRS01000003.1 GCA003048985_01158 gene open 54060-54695
1295 PIRS01000003.1 GCA003048985_01159 gene open 54713-55210
1296 PIRS01000003.1 GCA003048985_01160 gene open 55210-56676
1297 PIRS01000003.1 GCA003048985_01161 gene open 56679-58817
1298 PIRS01000003.1 GCA003048985_01162 gene open 58821-60770
1299 PIRS01000003.1 GCA003048985_01163 gene open 60767-61426
1300 PIRS01000003.1 GCA003048985_01164 gene open 61447-63126
1301 PIRS01000003.1 GCA003048985_01165 gene open 63240-64601 hemN
1302 PIRS01000003.1 GCA003048985_01166 gene open 64594-65079
1303 PIRS01000003.1 GCA003048985_01167 gene open 65076-65993 argF
1304 PIRS01000003.1 GCA003048985_01168 gene open 65995-66966 hemB
1305 PIRS01000003.1 GCA003048985_01169 gene open 67035-67598
1306 PIRS01000003.1 GCA003048985_01170 gene open 67598-68164 rsmG
1307 PIRS01000003.1 GCA003048985_01171 gene open 68161-68355
1308 PIRS01000003.1 GCA003048985_01172 gene open 68352-68717
1309 PIRS01000003.1 GCA003048985_01173 gene open 68726-69592 htpX
1310 PIRS01000003.1 GCA003048985_01174 gene open 70089-70490 flaH
1311 PIRS01000003.1 GCA003048985_01175 gene open 70481-70912
1312 PIRS01000003.1 GCA003048985_01176 gene open 70922-71935 alr
1313 PIRS01000003.1 GCA003048985_01177 gene open 71928-72167
1314 PIRS01000003.1 GCA003048985_01178 gene open 72170-73135
1315 PIRS01000003.1 GCA003048985_01179 gene open 73273-73695
1316 PIRS01000003.1 GCA003048985_01180 gene open 73695-74159
1317 PIRS01000003.1 GCA003048985_01181 gene open 74169-74711
1318 PIRS01000003.1 GCA003048985_01182 gene open 74829-76778
1319 PIRS01000003.1 GCA003048985_01183 gene open 77096-77554
1320 PIRS01000003.1 GCA003048985_01184 gene open 77677-80262
1321 PIRS01000003.1 GCA003048985_01185 gene open 80299-81510
1322 PIRS01000003.1 GCA003048985_01186 gene open 81519-82265
1323 PIRS01000003.1 GCA003048985_01187 gene open 82275-83978
1324 PIRS01000003.1 GCA003048985_01188 gene open 83981-85090 trmA
1325 PIRS01000003.1 GCA003048985_01189 gene open 85105-86316 ilvA
1326 PIRS01000003.1 GCA003048985_01190 gene open 86409-87242
1327 PIRS01000003.1 GCA003048985_01191 gene open 87299-87994
1328 PIRS01000003.1 GCA003048985_01192 gene open 88018-88941
1329 PIRS01000003.1 GCA003048985_01193 gene open 88993-89415 eamA
1330 PIRS01000003.1 GCA003048985_01194 gene open 89514-90089
1331 PIRS01000003.1 GCA003048985_01195 gene open 90099-92666
1332 PIRS01000003.1 GCA003048985_01196 gene open 92987-94957
1333 PIRS01000003.1 GCA003048985_01197 gene open 95602-96435 modD
1334 PIRS01000003.1 GCA003048985_01198 gene open 96437-96694
1335 PIRS01000003.1 GCA003048985_01199 gene open 96705-98165
1336 PIRS01000003.1 GCA003048985_01200 gene open 98183-100273
1337 PIRS01000003.1 GCA003048985_01201 gene open 100242-100562
1338 PIRS01000003.1 GCA003048985_01202 gene open 100562-100876
1339 PIRS01000003.1 GCA003048985_01203 gene open 100886-101236
1340 PIRS01000003.1 GCA003048985_01204 gene open 101229-101879
1341 PIRS01000003.1 GCA003048985_01205 gene open 101872-102195
1342 PIRS01000003.1 GCA003048985_01206 gene open 102298-102744
1343 PIRS01000003.1 GCA003048985_01207 gene open 102895-103104
1344 PIRS01000003.1 GCA003048985_01208 gene open 103211-103876
1345 PIRS01000003.1 GCA003048985_01209 gene open 103994-104602
1346 PIRS01000003.1 GCA003048985_01210 gene open 104599-105585
1347 PIRS01000003.1 GCA003048985_01211 gene open 105574-106056 ybaK
1348 PIRS01000003.1 GCA003048985_01212 gene open 106115-106651 fliL
1349 PIRS01000003.1 GCA003048985_01213 gene open 106648-106992 acpS
1350 PIRS01000003.1 GCA003048985_01214 gene open 107127-107930
1351 PIRS01000003.1 GCA003048985_01215 gene open 107947-108735
1352 PIRS01000003.1 GCA003048985_01216 gene open 108798-108920
1353 PIRS01000003.1 GCA003048985_01217 gene open 108931-109362
1354 PIRS01000003.1 GCA003048985_01218 gene open 109631-110731 flgG
1355 PIRS01000003.1 GCA003048985_01220 gene open 111024-111326
1356 PIRS01000003.1 GCA003048985_01221 gene open 111451-112197 yaaA
1357 PIRS01000003.1 GCA003048985_01222 gene open 112339-114654 flgL
1358 PIRS01000003.1 GCA003048985_01223 gene open 114834-116891
1359 PIRS01000003.1 GCA003048985_01224 gene open 117008-118126
1360 PIRS01000003.1 GCA003048985_01225 gene open 118388-118579
1361 PIRS01000003.1 GCA003048985_01226 gene open 118632-119063
1362 PIRS01000003.1 GCA003048985_01229 gene open 119403-119609
1363 PIRS01000003.1 GCA003048985_01230 gene open 119742-120872
1364 PIRS01000003.1 GCA003048985_01231 gene open 120895-121086 rpmB
1365 PIRS01000003.1 GCA003048985_01232 gene open 121238-121984
1366 PIRS01000003.1 GCA003048985_01233 gene open 121981-123354
1367 PIRS01000003.1 GCA003048985_01234 gene open 123364-124011 rpe
1368 PIRS01000003.1 GCA003048985_01235 gene open 124008-124811
1369 PIRS01000003.1 GCA003048985_01236 gene open 125245-127338
1370 PIRS01000003.1 GCA003048985_01237 gene open 127526-128110
1371 PIRS01000003.1 GCA003048985_01238 gene open 128095-129462 mgtE
1372 PIRS01000003.1 GCA003048985_01239 gene open 129472-130641
1373 PIRS01000003.1 GCA003048985_01240 gene open 130756-131478 pgbA
1374 PIRS01000003.1 GCA003048985_01241 gene open 131530-132303 brkB
1375 PIRS01000003.1 GCA003048985_01242 gene open 132378-133406
1376 PIRS01000003.1 GCA003048985_01243 gene open 133387-134109
1377 PIRS01000003.1 GCA003048985_01244 gene open 134238-135713
1378 PIRS01000003.1 GCA003048985_01245 gene open 135840-137021
1379 PIRS01000003.1 GCA003048985_01246 gene open 137002-137664
1380 PIRS01000003.1 GCA003048985_01247 gene open 137674-137916
1381 PIRS01000003.1 GCA003048985_01248 gene open 137979-138884
1382 PIRS01000003.1 GCA003048985_01249 gene open 138979-140739
1383 PIRS01000003.1 GCA003048985_01250 gene open 140848-141483
1384 PIRS01000003.1 GCA003048985_01251 gene open 141483-142592 rseP
1385 PIRS01000003.1 GCA003048985_01252 gene open 142669-143565
1386 PIRS01000003.1 GCA003048985_01253 gene open 143568-144113 pgsA
1387 PIRS01000003.1 GCA003048985_01254 gene open 144145-144933
1388 PIRS01000003.1 GCA003048985_01255 gene open 144933-145826 dapA
1389 PIRS01000003.1 GCA003048985_01256 gene open 145829-147070
1390 PIRS01000003.1 GCA003048985_01257 gene open 147082-148155
1391 PIRS01000003.1 GCA003048985_01258 gene open 148209-149957
1392 PIRS01000003.1 GCA003048985_01259 gene open 149926-151320 cysS
1393 PIRS01000003.1 GCA003048985_01260 gene open 151307-152707 murJ
1394 PIRS01000003.1 GCA003048985_01261 gene open 152830-154761
1395 PIRS01000003.1 GCA003048985_01262 gene open 154761-155315 ruvA
1396 PIRS01000003.1 GCA003048985_01263 gene open 155327-156367 ddl
1397 PIRS01000003.1 GCA003048985_01264 gene open 156432-156662
1398 PIRS01000003.1 GCA003048985_01265 gene open 156652-157437
1399 PIRS01000003.1 GCA003048985_01266 gene open 157434-158858
1400 PIRS01000003.1 GCA003048985_01267 gene open 158855-159307
1401 PIRS01000003.1 GCA003048985_01268 gene open 159482-159976
1402 PIRS01000003.1 GCA003048985_01269 gene open 160028-161089 xerH
1403 PIRS01000003.1 GCA003048985_01270 gene open 161092-162285 ackA
1404 PIRS01000003.1 GCA003048985_01271 gene open 162287-163654 pta
1405 PIRS01000003.1 GCA003048985_01272 gene open 163722-164429 flgH
1406 PIRS01000003.1 GCA003048985_01134 gene open 32684-32760 trnR
1407 PIRS01000003.1 GCA003048985_01149 gene open 50863-50938 trnW
1408 PIRS01000003.1 GCA003048985_01152 gene open 52442-52516 trnT
1409 PIRS01000003.1 GCA003048985_01153 gene open 52641-52717 trnG
1410 PIRS01000003.1 GCA003048985_01154 gene open 52725-52809 trnY
1411 PIRS01000003.1 GCA003048985_01155 gene open 52862-52937 trnT
1412 PIRS01000003.1 GCA003048985_01219 gene open 110866-110952 trnL
1413 PIRS01000003.1 GCA003048985_01227 gene open 119092-119166 trnfM
1414 PIRS01000003.1 GCA003048985_01228 gene open 119194-119268 trnQ
1415 PIRS01000003.1 GCA003048985_01134 tRNA open 32684-32760 trnR tRNA-Arg(cct)
1416 PIRS01000003.1 GCA003048985_01149 tRNA open 50863-50938 trnW tRNA-Trp(cca)
1417 PIRS01000003.1 GCA003048985_01152 tRNA open 52442-52516 trnT tRNA-Thr(ggt)
1418 PIRS01000003.1 GCA003048985_01153 tRNA open 52641-52717 trnG tRNA-Gly(tcc)
1419 PIRS01000003.1 GCA003048985_01154 tRNA open 52725-52809 trnY tRNA-Tyr(gta)
1420 PIRS01000003.1 GCA003048985_01155 tRNA open 52862-52937 trnT tRNA-Thr(tgt)
1421 PIRS01000003.1 GCA003048985_01219 tRNA open 110866-110952 trnL tRNA-Leu(caa)
1422 PIRS01000003.1 GCA003048985_01227 tRNA open 119092-119166 trnfM tRNA-fMet(cat)
1423 PIRS01000003.1 GCA003048985_01228 tRNA open 119194-119268 trnQ tRNA-Gln(ttg)
1424 PIRS01000004.1 repeat_region open 8697-10197 CRISPR array with 23 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 36
1425 PIRS01000004.1 GCA003048985_01274 CDS open 280-972 _na     230_aa CRISPR associated protein Cas6 C-terminal domain-containing protein
1426 PIRS01000004.1 GCA003048985_01275 CDS open 1143-2909 _na     588_aa CRISPR/Cas system-associated protein Cas8%2C type I-B/HMARI
1427 PIRS01000004.1 GCA003048985_01276 CDS open 2920-3861 _na     313_aa cas7b type I-B CRISPR-associated protein Cas7/Csh2
1428 PIRS01000004.1 GCA003048985_01277 CDS open 3863-4573 _na     236_aa CRISPR/Cas system-associated RAMP protein Cas5%2C type I-B/HMARI
1429 PIRS01000004.1 GCA003048985_01278 CDS open 4548-6749 _na     733_aa CRISPR/Cas system-associated endonuclease/helicase Cas3%2C type I-B/HMARI
1430 PIRS01000004.1 GCA003048985_01279 CDS open 6749-7249 _na     166_aa cas4 CRISPR-associated protein Cas4
1431 PIRS01000004.1 GCA003048985_01280 CDS open 7258-7536 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
1432 PIRS01000004.1 GCA003048985_01281 CDS open 7546-8544 _na     332_aa cas1 CRISPR-associated endonuclease Cas1
1433 PIRS01000004.1 GCA003048985_01282 CDS open 10329-10925 _na     198_aa hypothetical protein
1434 PIRS01000004.1 GCA003048985_01283 CDS open 10989-12107 _na     372_aa hypothetical protein
1435 PIRS01000004.1 GCA003048985_01284 CDS open 12248-12556 _na     102_aa hypothetical protein
1436 PIRS01000004.1 GCA003048985_01285 CDS open 13043-13564 _na     173_aa hypothetical protein
1437 PIRS01000004.1 GCA003048985_01286 CDS open 13701-14057 _na     118_aa rplS 50S ribosomal protein L19
1438 PIRS01000004.1 GCA003048985_01287 CDS open 14066-14758 _na     230_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
1439 PIRS01000004.1 GCA003048985_01288 CDS open 14755-15285 _na     176_aa rimM ribosome maturation factor RimM
1440 PIRS01000004.1 GCA003048985_01289 CDS open 15278-15520 _na     80_aa RNA-binding protein (KH domain)
1441 PIRS01000004.1 GCA003048985_01290 CDS open 15520-15747 _na     75_aa rpsP 30S ribosomal protein S16
1442 PIRS01000004.1 GCA003048985_01291 CDS open 15819-17159 _na     446_aa ffh signal recognition particle protein
1443 PIRS01000004.1 GCA003048985_01292 CDS open 17222-17980 _na     252_aa RNA pseudouridylate synthase
1444 PIRS01000004.1 GCA003048985_01293 CDS open 17977-19113 _na     378_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
1445 PIRS01000004.1 GCA003048985_01294 CDS open 19122-19829 _na     235_aa C4-type zinc ribbon domain-containing protein
1446 PIRS01000004.1 GCA003048985_01295 CDS open 19847-20569 _na     240_aa Nif3-like dinuclear metal center hexameric protein
1447 PIRS01000004.1 GCA003048985_01296 CDS open 20576-21436 _na     286_aa glyQ glycine--tRNA ligase subunit alpha
1448 PIRS01000004.1 GCA003048985_01297 CDS open 21506-21622 _na     38_aa hypothetical protein
1449 PIRS01000004.1 GCA003048985_01298 CDS open 21626-22099 _na     157_aa DUF3972 domain-containing protein
1450 PIRS01000004.1 GCA003048985_01299 CDS open 22111-22605 _na     164_aa N5-carboxyaminoimidazole ribonucleotide mutase
1451 PIRS01000004.1 GCA003048985_01300 CDS open 22602-23861 _na     419_aa Peptidase family U32 C-terminal domain-containing protein
1452 PIRS01000004.1 GCA003048985_01301 CDS open 23861-24619 _na     252_aa Chemotaxis protein
1453 PIRS01000004.1 GCA003048985_01302 CDS open 24756-25535 _na     259_aa Histidinol-phosphatase
1454 PIRS01000004.1 GCA003048985_01303 CDS open 25623-27053 _na     476_aa glnA type I glutamate--ammonia ligase
1455 PIRS01000004.1 GCA003048985_01304 CDS open 27582-29243 _na     553_aa DNA polymerase III subunit gamma/tau
1456 PIRS01000004.1 GCA003048985_01305 CDS open 29647-29967 _na     106_aa LysE/ArgO family amino acid transporter
1457 PIRS01000004.1 GCA003048985_01306 CDS open 29902-30171 _na     89_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
1458 PIRS01000004.1 GCA003048985_01307 CDS open 30171-32549 _na     792_aa Copper-transporting ATPase
1459 PIRS01000004.1 GCA003048985_01308 CDS open 32546-33166 _na     206_aa PAC domain-containing protein
1460 PIRS01000004.1 GCA003048985_01309 CDS open 33317-33700 _na     127_aa ridA Enamine deaminase RidA
1461 PIRS01000004.1 GCA003048985_01310 CDS open 33721-34806 _na     361_aa Threonine synthase
1462 PIRS01000004.1 GCA003048985_01311 CDS open 34970-36313 _na     447_aa rho transcription termination factor Rho
1463 PIRS01000004.1 GCA003048985_01312 CDS open 36482-36985 _na     167_aa membrane lipoprotein lipid attachment site-containing protein
1464 PIRS01000004.1 GCA003048985_01313 CDS open 37710-38189 _na     159_aa N-acetyltransferase domain-containing protein
1465 PIRS01000004.1 GCA003048985_01314 CDS open 38189-39292 _na     367_aa nusA Transcription termination/antitermination protein NusA
1466 PIRS01000004.1 GCA003048985_01315 CDS open 39465-39707 _na     80_aa HP0268 domain-containing protein
1467 PIRS01000004.1 GCA003048985_01316 CDS open 39707-41008 _na     433_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
1468 PIRS01000004.1 GCA003048985_01317 CDS open 40989-41768 _na     259_aa DUF374 domain-containing protein
1469 PIRS01000004.1 GCA003048985_01318 CDS open 41758-42204 _na     148_aa Tetratricopeptide repeat protein
1470 PIRS01000004.1 GCA003048985_01319 CDS open 42265-43269 _na     334_aa Clan AA aspartic protease
1471 PIRS01000004.1 GCA003048985_01320 CDS open 43266-43787 _na     173_aa pilN Pilus assembly protein PilN
1472 PIRS01000004.1 GCA003048985_01321 CDS open 43780-44316 _na     178_aa Transformation system protein
1473 PIRS01000004.1 GCA003048985_01322 CDS open 44321-45385 _na     354_aa SGNH/GDSL hydrolase family protein
1474 PIRS01000004.1 GCA003048985_01323 CDS open 45354-46730 _na     458_aa MBOAT family protein
1475 PIRS01000004.1 GCA003048985_01324 CDS open 46743-47366 _na     207_aa beta-lactamase
1476 PIRS01000004.1 GCA003048985_01325 CDS open 47379-48038 _na     219_aa beta-lactamase
1477 PIRS01000004.1 GCA003048985_01326 CDS open 48049-49389 _na     446_aa Dihydrolipoamide dehydrogenase
1478 PIRS01000004.1 GCA003048985_01327 CDS open 49386-49703 _na     105_aa Type II secretion system protein
1479 PIRS01000004.1 GCA003048985_01328 CDS open 49781-50332 _na     183_aa beta-lactamase
1480 PIRS01000004.1 GCA003048985_01329 CDS open 50354-51454 _na     366_aa prfB peptide chain release factor 2
1481 PIRS01000004.1 GCA003048985_01330 CDS open 51574-52395 _na     273_aa panC pantoate--beta-alanine ligase
1482 PIRS01000004.1 GCA003048985_01331 CDS open 52398-53708 _na     436_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
1483 PIRS01000004.1 GCA003048985_01332 CDS open 53705-54697 _na     330_aa tRNA(Ile)-lysidine synthase
1484 PIRS01000004.1 GCA003048985_01333 CDS open 55749-56144 _na     131_aa sseB SseB protein N-terminal domain-containing protein
1485 PIRS01000004.1 GCA003048985_01334 CDS open 56146-56715 _na     189_aa gmhA D-sedoheptulose 7-phosphate isomerase
1486 PIRS01000004.1 GCA003048985_01335 CDS open 56690-58108 _na     472_aa hldE Bifunctional protein HldE
1487 PIRS01000004.1 GCA003048985_01336 CDS open 58101-59090 _na     329_aa rfaD ADP-glyceromanno-heptose 6-epimerase
1488 PIRS01000004.1 GCA003048985_01337 CDS open 59087-59602 _na     171_aa gmhB D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase
1489 PIRS01000004.1 GCA003048985_01338 CDS open 59695-59997 _na     100_aa Cytochrome C553 (Soluble cytochrome f)
1490 PIRS01000004.1 GCA003048985_01339 CDS open 60022-60300 _na     92_aa DUF559 domain-containing protein
1491 PIRS01000004.1 GCA003048985_01340 CDS open 60510-61061 _na     183_aa epsC serine O-acetyltransferase EpsC
1492 PIRS01000004.1 GCA003048985_01341 CDS open 61066-61971 _na     301_aa cysK cysteine synthase A
1493 PIRS01000004.1 GCA003048985_01342 CDS open 62066-62734 _na     222_aa Endonuclease III
1494 PIRS01000004.1 GCA003048985_01343 CDS open 62731-63495 _na     254_aa AAA+ ATPase domain-containing protein
1495 PIRS01000004.1 GCA003048985_01344 CDS open 63492-66437 _na     981_aa mfd transcription-repair coupling factor
1496 PIRS01000004.1 GCA003048985_01345 CDS open 66418-67620 _na     400_aa tetrahydrofolate synthase
1497 PIRS01000004.1 GCA003048985_01346 CDS open 67617-69191 _na     524_aa GGDEF domain-containing protein
1498 PIRS01000004.1 GCA003048985_01347 CDS open 69172-69711 _na     179_aa Lipoprotein
1499 PIRS01000004.1 GCA003048985_01348 CDS open 69715-72180 _na     821_aa leuS leucine--tRNA ligase
1500 PIRS01000004.1 GCA003048985_01349 CDS open 72189-72527 _na     112_aa macA MacA