HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hoylesella shahii (GCA_003201715.1)

Select a Genome:
BAKTA Annotations for GCA_003201715.1
Genome Selected: Hoylesella shahii
ContigsBases CDSrRNA tmRNAtRNA
98 3,511,526 2803 2 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5720 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:11]    |    Number of Records Found: 5720 [12 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
5001 QJJX01000043.1 GCA003201715_02494 gene open 9982-11397 alkP
5002 QJJX01000043.1 GCA003201715_02495 gene open 11479-14889 secA
5003 QJJX01000043.1 GCA003201715_02496 gene open 14982-15686
5004 QJJX01000043.1 GCA003201715_02497 gene open 15787-16212
5005 QJJX01000043.1 GCA003201715_02498 gene open 16374-17012
5006 QJJX01000043.1 GCA003201715_02499 gene open 16984-17844
5007 QJJX01000043.1 GCA003201715_02500 gene open 18019-18315
5008 QJJX01000043.1 GCA003201715_02501 gene open 18326-21595
5009 QJJX01000044.1 regulatory_region open 11541-11725 Cobalamin riboswitch aptamer
5010 QJJX01000044.1 GCA003201715_02502 CDS open 2201-5452 _na     1083_aa YD repeat-containing protein
5011 QJJX01000044.1 GCA003201715_02503 CDS open 5528-6595 _na     355_aa Secreted protein (Por secretion system target)
5012 QJJX01000044.1 GCA003201715_02504 CDS open 7232-8410 _na     392_aa Na+/H+-dicarboxylate symporter
5013 QJJX01000044.1 GCA003201715_02505 CDS open 8854-10041 _na     395_aa Metallo-beta-lactamase domain protein
5014 QJJX01000044.1 GCA003201715_02506 CDS open 10232-11152 _na     306_aa Fructokinase
5015 QJJX01000044.1 GCA003201715_02507 CDS open 11899-16113 _na     1404_aa Secreted protein (Por secretion system target)
5016 QJJX01000044.1 GCA003201715_02508 CDS open 16276-17328 _na     350_aa Bleomycin hydrolase
5017 QJJX01000044.1 GCA003201715_02509 CDS open 17396-18637 _na     413_aa Collagenase
5018 QJJX01000044.1 GCA003201715_02510 CDS open 18716-19147 _na     143_aa Fe-S metabolism associated domain protein
5019 QJJX01000044.1 GCA003201715_02511 CDS open 19704-19925 _na     73_aa transposase
5020 QJJX01000044.1 GCA003201715_02502 gene open 2201-5452
5021 QJJX01000044.1 GCA003201715_02503 gene open 5528-6595
5022 QJJX01000044.1 GCA003201715_02504 gene open 7232-8410
5023 QJJX01000044.1 GCA003201715_02505 gene open 8854-10041
5024 QJJX01000044.1 GCA003201715_02506 gene open 10232-11152
5025 QJJX01000044.1 GCA003201715_02507 gene open 11899-16113
5026 QJJX01000044.1 GCA003201715_02508 gene open 16276-17328
5027 QJJX01000044.1 GCA003201715_02509 gene open 17396-18637
5028 QJJX01000044.1 GCA003201715_02510 gene open 18716-19147
5029 QJJX01000044.1 GCA003201715_02511 gene open 19704-19925
5030 QJJX01000045.1 GCA003201715_02512 CDS open 668-1246 _na     192_aa Lipocalin-like protein
5031 QJJX01000045.1 GCA003201715_02513 CDS open 1454-2083 _na     209_aa Glutathione peroxidase
5032 QJJX01000045.1 GCA003201715_02514 CDS open 2365-3318 _na     317_aa trxB thioredoxin-disulfide reductase
5033 QJJX01000045.1 GCA003201715_02515 CDS open 3518-3868 _na     116_aa merR Transcriptional regulator%2C MerR family
5034 QJJX01000045.1 GCA003201715_02516 CDS open 4280-6901 _na     873_aa alaS alanine--tRNA ligase
5035 QJJX01000045.1 GCA003201715_02517 CDS open 6895-6996 _na     33_aa hypothetical protein
5036 QJJX01000045.1 GCA003201715_02518 CDS open 7252-7689 _na     145_aa SUKH superfamily protein
5037 QJJX01000045.1 GCA003201715_02519 CDS open 7816-10092 _na     758_aa Putative secreted protein (Por secretion system target)
5038 QJJX01000045.1 GCA003201715_02520 CDS open 10067-10198 _na     43_aa hypothetical protein
5039 QJJX01000045.1 GCA003201715_02521 CDS open 10476-11987 _na     503_aa Arylsulfatase A-like enzyme
5040 QJJX01000045.1 GCA003201715_02522 CDS open 12108-13208 _na     366_aa mutY A/G-specific adenine glycosylase
5041 QJJX01000045.1 GCA003201715_02523 CDS open 13470-14645 _na     391_aa Tetratricopeptide repeat protein
5042 QJJX01000045.1 GCA003201715_02524 CDS open 14714-15880 _na     388_aa Miniconductance mechanosensitive channel
5043 QJJX01000045.1 GCA003201715_02525 CDS open 15925-17211 _na     428_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
5044 QJJX01000045.1 GCA003201715_02526 CDS open 17208-17732 _na     174_aa PH (Pleckstrin-like y) domain-containing protein
5045 QJJX01000045.1 GCA003201715_02527 CDS open 17801-18082 _na     93_aa hypothetical protein
5046 QJJX01000045.1 GCA003201715_02528 CDS open 19025-19132 _na     35_aa hypothetical protein
5047 QJJX01000045.1 GCA003201715_02529 CDS open 19240-19422 _na     60_aa Lipoprotein
5048 QJJX01000045.1 GCA003201715_02512 gene open 668-1246
5049 QJJX01000045.1 GCA003201715_02513 gene open 1454-2083
5050 QJJX01000045.1 GCA003201715_02514 gene open 2365-3318 trxB
5051 QJJX01000045.1 GCA003201715_02515 gene open 3518-3868 merR
5052 QJJX01000045.1 GCA003201715_02516 gene open 4280-6901 alaS
5053 QJJX01000045.1 GCA003201715_02517 gene open 6895-6996
5054 QJJX01000045.1 GCA003201715_02518 gene open 7252-7689
5055 QJJX01000045.1 GCA003201715_02519 gene open 7816-10092
5056 QJJX01000045.1 GCA003201715_02520 gene open 10067-10198
5057 QJJX01000045.1 GCA003201715_02521 gene open 10476-11987
5058 QJJX01000045.1 GCA003201715_02522 gene open 12108-13208 mutY
5059 QJJX01000045.1 GCA003201715_02523 gene open 13470-14645
5060 QJJX01000045.1 GCA003201715_02524 gene open 14714-15880
5061 QJJX01000045.1 GCA003201715_02525 gene open 15925-17211 dacB
5062 QJJX01000045.1 GCA003201715_02526 gene open 17208-17732
5063 QJJX01000045.1 GCA003201715_02527 gene open 17801-18082
5064 QJJX01000045.1 GCA003201715_02528 gene open 19025-19132
5065 QJJX01000045.1 GCA003201715_02529 gene open 19240-19422
5066 QJJX01000046.1 GCA003201715_02530 CDS open 686-1159 _na     157_aa Signal transducing protein
5067 QJJX01000046.1 GCA003201715_02531 CDS open 1140-1415 _na     91_aa DDE superfamily endonuclease
5068 QJJX01000046.1 GCA003201715_02532 CDS open 2171-2350 _na     59_aa hypothetical protein
5069 QJJX01000046.1 GCA003201715_02533 CDS open 2379-4313 _na     644_aa hypothetical protein
5070 QJJX01000046.1 GCA003201715_02534 CDS open 4368-5486 _na     372_aa Glycosyltransferase involved in cell wall biosynthesis
5071 QJJX01000046.1 GCA003201715_02535 CDS open 5483-6424 _na     313_aa Glycosyl transferase family 2
5072 QJJX01000046.1 GCA003201715_02536 CDS open 6421-7368 _na     315_aa Glycosyl transferase family 2
5073 QJJX01000046.1 GCA003201715_02537 CDS open 7675-9126 _na     483_aa O-antigen/teichoic acid export membrane protein
5074 QJJX01000046.1 GCA003201715_02538 CDS open 9157-10161 _na     334_aa Glycosyltransferase%2C group 2 family protein
5075 QJJX01000046.1 GCA003201715_02539 CDS open 10201-10494 _na     97_aa Tetratricopeptide repeat protein
5076 QJJX01000046.1 GCA003201715_02540 CDS open 10522-10935 _na     137_aa DUF2750 domain-containing protein
5077 QJJX01000046.1 GCA003201715_02541 CDS open 11299-12339 _na     346_aa Lipoprotein
5078 QJJX01000046.1 GCA003201715_02542 CDS open 12342-12671 _na     109_aa Lysozyme
5079 QJJX01000046.1 GCA003201715_02543 CDS open 12825-13391 _na     188_aa Lipoprotein
5080 QJJX01000046.1 GCA003201715_02544 CDS open 13397-13528 _na     43_aa hypothetical protein
5081 QJJX01000046.1 GCA003201715_02545 CDS open 13474-14007 _na     177_aa MORN repeat protein
5082 QJJX01000046.1 GCA003201715_02546 CDS open 14159-14863 _na     234_aa hypothetical protein
5083 QJJX01000046.1 GCA003201715_02547 CDS open 14913-15602 _na     229_aa Lipocalin-like domain-containing protein
5084 QJJX01000046.1 GCA003201715_02548 CDS open 15599-15931 _na     110_aa hypothetical protein
5085 QJJX01000046.1 GCA003201715_02549 CDS open 15956-16414 _na     152_aa Lipoprotein
5086 QJJX01000046.1 GCA003201715_02550 CDS open 16649-17200 _na     183_aa hypothetical protein
5087 QJJX01000046.1 GCA003201715_02551 CDS open 17163-19367 _na     734_aa hypothetical protein
5088 QJJX01000046.1 GCA003201715_02530 gene open 686-1159
5089 QJJX01000046.1 GCA003201715_02531 gene open 1140-1415
5090 QJJX01000046.1 GCA003201715_02532 gene open 2171-2350
5091 QJJX01000046.1 GCA003201715_02533 gene open 2379-4313
5092 QJJX01000046.1 GCA003201715_02534 gene open 4368-5486
5093 QJJX01000046.1 GCA003201715_02535 gene open 5483-6424
5094 QJJX01000046.1 GCA003201715_02536 gene open 6421-7368
5095 QJJX01000046.1 GCA003201715_02537 gene open 7675-9126
5096 QJJX01000046.1 GCA003201715_02538 gene open 9157-10161
5097 QJJX01000046.1 GCA003201715_02539 gene open 10201-10494
5098 QJJX01000046.1 GCA003201715_02540 gene open 10522-10935
5099 QJJX01000046.1 GCA003201715_02541 gene open 11299-12339
5100 QJJX01000046.1 GCA003201715_02542 gene open 12342-12671
5101 QJJX01000046.1 GCA003201715_02543 gene open 12825-13391
5102 QJJX01000046.1 GCA003201715_02544 gene open 13397-13528
5103 QJJX01000046.1 GCA003201715_02545 gene open 13474-14007
5104 QJJX01000046.1 GCA003201715_02546 gene open 14159-14863
5105 QJJX01000046.1 GCA003201715_02547 gene open 14913-15602
5106 QJJX01000046.1 GCA003201715_02548 gene open 15599-15931
5107 QJJX01000046.1 GCA003201715_02549 gene open 15956-16414
5108 QJJX01000046.1 GCA003201715_02550 gene open 16649-17200
5109 QJJX01000046.1 GCA003201715_02551 gene open 17163-19367
5110 QJJX01000047.1 GCA003201715_02552 CDS open 324-899 _na     191_aa Chromate transporter
5111 QJJX01000047.1 GCA003201715_02553 CDS open 985-1545 _na     186_aa Chromate transport protein
5112 QJJX01000047.1 GCA003201715_02554 CDS open 1671-5438 _na     1255_aa purL phosphoribosylformylglycinamidine synthase
5113 QJJX01000047.1 GCA003201715_02555 CDS open 5761-6678 _na     305_aa eamA EamA domain-containing protein
5114 QJJX01000047.1 GCA003201715_02556 CDS open 6868-7176 _na     102_aa OmpA-like domain-containing protein
5115 QJJX01000047.1 GCA003201715_02557 CDS open 7193-7708 _na     171_aa OmpA-like domain-containing protein
5116 QJJX01000047.1 GCA003201715_02558 CDS open 7982-8515 _na     177_aa Lipoprotein
5117 QJJX01000047.1 GCA003201715_02559 CDS open 9061-9438 _na     125_aa Putative transcriptional regulator
5118 QJJX01000047.1 GCA003201715_02560 CDS open 9577-10803 _na     408_aa TonB-dependent receptor
5119 QJJX01000047.1 GCA003201715_02561 CDS open 11072-11551 _na     159_aa TonB-dependent receptor
5120 QJJX01000047.1 GCA003201715_02562 CDS open 11857-12378 _na     173_aa tonB TonB family protein
5121 QJJX01000047.1 GCA003201715_02563 CDS open 12502-12837 _na     111_aa Secreted protein
5122 QJJX01000047.1 GCA003201715_02564 CDS open 14109-15338 _na     409_aa Glycosyl hydrolase family 25
5123 QJJX01000047.1 GCA003201715_02565 CDS open 15323-16309 _na     328_aa Serine protease
5124 QJJX01000047.1 GCA003201715_02552 gene open 324-899
5125 QJJX01000047.1 GCA003201715_02553 gene open 985-1545
5126 QJJX01000047.1 GCA003201715_02554 gene open 1671-5438 purL
5127 QJJX01000047.1 GCA003201715_02555 gene open 5761-6678 eamA
5128 QJJX01000047.1 GCA003201715_02556 gene open 6868-7176
5129 QJJX01000047.1 GCA003201715_02557 gene open 7193-7708
5130 QJJX01000047.1 GCA003201715_02558 gene open 7982-8515
5131 QJJX01000047.1 GCA003201715_02559 gene open 9061-9438
5132 QJJX01000047.1 GCA003201715_02560 gene open 9577-10803
5133 QJJX01000047.1 GCA003201715_02561 gene open 11072-11551
5134 QJJX01000047.1 GCA003201715_02562 gene open 11857-12378 tonB
5135 QJJX01000047.1 GCA003201715_02563 gene open 12502-12837
5136 QJJX01000047.1 GCA003201715_02564 gene open 14109-15338
5137 QJJX01000047.1 GCA003201715_02565 gene open 15323-16309
5138 QJJX01000048.1 GCA003201715_02566 CDS open 269-928 _na     219_aa Outer membrane protein with beta-barrel domain
5139 QJJX01000048.1 GCA003201715_02567 CDS open 950-2302 _na     450_aa PKD domain-containing protein
5140 QJJX01000048.1 GCA003201715_02568 CDS open 2307-3347 _na     346_aa PQQ enzyme repeat protein
5141 QJJX01000048.1 GCA003201715_02569 CDS open 3352-8337 _na     1661_aa Fibronectin type-III domain-containing protein
5142 QJJX01000048.1 GCA003201715_02570 CDS open 8698-9777 _na     359_aa Pyrroloquinoline-quinone binding quinoprotein
5143 QJJX01000048.1 GCA003201715_02571 CDS open 10286-10978 _na     230_aa IS982 family transposase
5144 QJJX01000048.1 GCA003201715_02572 CDS open 11198-11563 _na     121_aa hypothetical protein
5145 QJJX01000048.1 GCA003201715_02573 CDS open 11677-12771 _na     364_aa nosR NosR regulatory protein
5146 QJJX01000048.1 GCA003201715_02574 CDS open 12777-13412 _na     211_aa Nitroreductase
5147 QJJX01000048.1 GCA003201715_02575 CDS open 13454-14950 _na     498_aa subtype B tannase
5148 QJJX01000048.1 GCA003201715_02576 CDS open 14955-16280 _na     441_aa norM Multidrug export protein MepA
5149 QJJX01000048.1 GCA003201715_02566 gene open 269-928
5150 QJJX01000048.1 GCA003201715_02567 gene open 950-2302
5151 QJJX01000048.1 GCA003201715_02568 gene open 2307-3347
5152 QJJX01000048.1 GCA003201715_02569 gene open 3352-8337
5153 QJJX01000048.1 GCA003201715_02570 gene open 8698-9777
5154 QJJX01000048.1 GCA003201715_02571 gene open 10286-10978
5155 QJJX01000048.1 GCA003201715_02572 gene open 11198-11563
5156 QJJX01000048.1 GCA003201715_02573 gene open 11677-12771 nosR
5157 QJJX01000048.1 GCA003201715_02574 gene open 12777-13412
5158 QJJX01000048.1 GCA003201715_02575 gene open 13454-14950
5159 QJJX01000048.1 GCA003201715_02576 gene open 14955-16280 norM
5160 QJJX01000049.1 GCA003201715_02577 CDS open 115-282 _na     55_aa hypothetical protein
5161 QJJX01000049.1 GCA003201715_02578 CDS open 342-1097 _na     251_aa hypothetical protein
5162 QJJX01000049.1 GCA003201715_02579 CDS open 1184-1360 _na     58_aa hypothetical protein
5163 QJJX01000049.1 GCA003201715_02580 CDS open 1435-2901 _na     488_aa mucD Putative serine protease MucD
5164 QJJX01000049.1 GCA003201715_02582 CDS open 3709-3963 _na     84_aa hypothetical protein
5165 QJJX01000049.1 GCA003201715_02583 CDS open 3994-4254 _na     86_aa 4Fe-4S binding protein
5166 QJJX01000049.1 GCA003201715_02584 CDS open 5743-8283 _na     846_aa DUF5118 domain-containing protein
5167 QJJX01000049.1 GCA003201715_02585 CDS open 8280-10832 _na     850_aa DUF5118 domain-containing protein
5168 QJJX01000049.1 GCA003201715_02586 CDS open 10839-12266 _na     475_aa PKD family protein
5169 QJJX01000049.1 GCA003201715_02587 CDS open 12301-13008 _na     235_aa DUF4843 domain-containing protein
5170 QJJX01000049.1 GCA003201715_02588 CDS open 13120-14577 _na     485_aa SusD-like starch-binding protein associating with outer membrane
5171 QJJX01000049.1 GCA003201715_02589 CDS open 14595-16013 _na     472_aa TonB-dependent receptor-like protein
5172 QJJX01000049.1 GCA003201715_02577 gene open 115-282
5173 QJJX01000049.1 GCA003201715_02578 gene open 342-1097
5174 QJJX01000049.1 GCA003201715_02579 gene open 1184-1360
5175 QJJX01000049.1 GCA003201715_02580 gene open 1435-2901 mucD
5176 QJJX01000049.1 GCA003201715_02582 gene open 3709-3963
5177 QJJX01000049.1 GCA003201715_02583 gene open 3994-4254
5178 QJJX01000049.1 GCA003201715_02584 gene open 5743-8283
5179 QJJX01000049.1 GCA003201715_02585 gene open 8280-10832
5180 QJJX01000049.1 GCA003201715_02586 gene open 10839-12266
5181 QJJX01000049.1 GCA003201715_02587 gene open 12301-13008
5182 QJJX01000049.1 GCA003201715_02588 gene open 13120-14577
5183 QJJX01000049.1 GCA003201715_02589 gene open 14595-16013
5184 QJJX01000049.1 GCA003201715_02581 gene open 3287-3374 trnS
5185 QJJX01000049.1 GCA003201715_02581 tRNA open 3287-3374 trnS tRNA-Ser(gga)
5186 QJJX01000050.1 GCA003201715_02590 CDS open 1141-2562 _na     473_aa DUF1212 domain-containing protein
5187 QJJX01000050.1 GCA003201715_02591 CDS open 2754-2906 _na     50_aa hypothetical protein
5188 QJJX01000050.1 GCA003201715_02592 CDS open 2959-3687 _na     242_aa Short-subunit dehydrogenase
5189 QJJX01000050.1 GCA003201715_02593 CDS open 3755-5113 _na     452_aa tRNA(Ile)-lysidine synthase
5190 QJJX01000050.1 GCA003201715_02594 CDS open 5149-6336 _na     395_aa Putative 23S rRNA methyltransferase
5191 QJJX01000050.1 GCA003201715_02595 CDS open 6394-7017 _na     207_aa 3'-5' exonuclease
5192 QJJX01000050.1 GCA003201715_02596 CDS open 7130-9616 _na     828_aa S-DNA-T family DNA segregation ATPase FtsK/SpoIIIE
5193 QJJX01000050.1 GCA003201715_02597 CDS open 9704-10315 _na     203_aa Outer membrane lipoprotein-sorting protein
5194 QJJX01000050.1 GCA003201715_02598 CDS open 10357-11868 _na     503_aa ABC-2 type transport system permease protein
5195 QJJX01000050.1 GCA003201715_02599 CDS open 12016-13764 _na     582_aa recJ single-stranded-DNA-specific exonuclease RecJ
5196 QJJX01000050.1 GCA003201715_02600 CDS open 13771-15696 _na     641_aa recQ ATP-dependent DNA helicase RecQ
5197 QJJX01000050.1 GCA003201715_02590 gene open 1141-2562
5198 QJJX01000050.1 GCA003201715_02591 gene open 2754-2906
5199 QJJX01000050.1 GCA003201715_02592 gene open 2959-3687
5200 QJJX01000050.1 GCA003201715_02593 gene open 3755-5113
5201 QJJX01000050.1 GCA003201715_02594 gene open 5149-6336
5202 QJJX01000050.1 GCA003201715_02595 gene open 6394-7017
5203 QJJX01000050.1 GCA003201715_02596 gene open 7130-9616
5204 QJJX01000050.1 GCA003201715_02597 gene open 9704-10315
5205 QJJX01000050.1 GCA003201715_02598 gene open 10357-11868
5206 QJJX01000050.1 GCA003201715_02599 gene open 12016-13764 recJ
5207 QJJX01000050.1 GCA003201715_02600 gene open 13771-15696 recQ
5208 QJJX01000051.1 GCA003201715_02611 gene open 14203-14309 Bacteroidales_small_SRP
5209 QJJX01000051.1 GCA003201715_02612 gene open 14210-14308 Bacteria_small_SRP
5210 QJJX01000051.1 GCA003201715_02611 ncRNA open 14203-14309 Bacteroidales small SRP
5211 QJJX01000051.1 GCA003201715_02612 ncRNA open 14210-14308 Bacterial small signal recognition particle RNA
5212 QJJX01000051.1 GCA003201715_02601 CDS open 496-1335 _na     279_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
5213 QJJX01000051.1 GCA003201715_02602 CDS open 2835-4313 _na     492_aa dnaB replicative DNA helicase
5214 QJJX01000051.1 GCA003201715_02603 CDS open 4403-5083 _na     226_aa Tetratricopeptide repeat protein
5215 QJJX01000051.1 GCA003201715_02604 CDS open 5368-7005 _na     545_aa Lipocalin-like domain-containing protein
5216 QJJX01000051.1 GCA003201715_02605 CDS open 7207-7926 _na     239_aa YebC/PmpR family DNA-binding transcriptional regulator
5217 QJJX01000051.1 GCA003201715_02606 CDS open 8086-10548 _na     820_aa pheT phenylalanine--tRNA ligase subunit beta
5218 QJJX01000051.1 GCA003201715_02607 CDS open 10601-10726 _na     41_aa hypothetical protein
5219 QJJX01000051.1 GCA003201715_02608 CDS open 10702-11973 _na     423_aa Cardiolipin synthase
5220 QJJX01000051.1 GCA003201715_02609 CDS open 11998-12975 _na     325_aa Arabinose-5-phosphate isomerase
5221 QJJX01000051.1 GCA003201715_02610 CDS open 13024-13776 _na     250_aa kdsA 3-deoxy-8-phosphooctulonate synthase
5222 QJJX01000051.1 GCA003201715_02614 CDS open 14604-15017 _na     137_aa DDE family transposase
5223 QJJX01000051.1 GCA003201715_02601 gene open 496-1335 ispE
5224 QJJX01000051.1 GCA003201715_02602 gene open 2835-4313 dnaB
5225 QJJX01000051.1 GCA003201715_02603 gene open 4403-5083
5226 QJJX01000051.1 GCA003201715_02604 gene open 5368-7005
5227 QJJX01000051.1 GCA003201715_02605 gene open 7207-7926
5228 QJJX01000051.1 GCA003201715_02606 gene open 8086-10548 pheT
5229 QJJX01000051.1 GCA003201715_02607 gene open 10601-10726
5230 QJJX01000051.1 GCA003201715_02608 gene open 10702-11973
5231 QJJX01000051.1 GCA003201715_02609 gene open 11998-12975
5232 QJJX01000051.1 GCA003201715_02610 gene open 13024-13776 kdsA
5233 QJJX01000051.1 GCA003201715_02614 gene open 14604-15017
5234 QJJX01000051.1 GCA003201715_02613 gene open 14311-14384 trnT
5235 QJJX01000051.1 GCA003201715_02613 tRNA open 14311-14384 trnT tRNA-Thr(tgt)
5236 QJJX01000052.1 GCA003201715_02615 CDS open 391-606 _na     71_aa Histidine kinase
5237 QJJX01000052.1 GCA003201715_02616 CDS open 637-1539 _na     300_aa bcrA Putative bacitracin ABC transporter%2C ATP-binding protein BcrA
5238 QJJX01000052.1 GCA003201715_02617 CDS open 1536-2312 _na     258_aa ABC-2 type transporter
5239 QJJX01000052.1 GCA003201715_02618 CDS open 2521-2703 _na     60_aa hypothetical protein
5240 QJJX01000052.1 GCA003201715_02619 CDS open 2684-2803 _na     39_aa hypothetical protein
5241 QJJX01000052.1 GCA003201715_02620 CDS open 2762-3460 _na     232_aa Putative murein hydrolase (TIGR00659 family)
5242 QJJX01000052.1 GCA003201715_02621 CDS open 3589-4020 _na     143_aa Holin-like protein
5243 QJJX01000052.1 GCA003201715_02622 CDS open 4358-7516 _na     1052_aa Pyruvate phosphate dikinase-like enzyme
5244 QJJX01000052.1 GCA003201715_02623 CDS open 7531-7713 _na     60_aa hypothetical protein
5245 QJJX01000052.1 GCA003201715_02624 CDS open 8158-9876 _na     572_aa Fimbrillin-like protein
5246 QJJX01000052.1 GCA003201715_02625 CDS open 10553-10741 _na     62_aa hypothetical protein
5247 QJJX01000052.1 GCA003201715_02626 CDS open 11123-13168 _na     681_aa metG methionine--tRNA ligase
5248 QJJX01000052.1 GCA003201715_02627 CDS open 13326-14468 _na     380_aa Mannose-1-phosphate guanylyltransferase
5249 QJJX01000052.1 GCA003201715_02615 gene open 391-606
5250 QJJX01000052.1 GCA003201715_02616 gene open 637-1539 bcrA
5251 QJJX01000052.1 GCA003201715_02617 gene open 1536-2312
5252 QJJX01000052.1 GCA003201715_02618 gene open 2521-2703
5253 QJJX01000052.1 GCA003201715_02619 gene open 2684-2803
5254 QJJX01000052.1 GCA003201715_02620 gene open 2762-3460
5255 QJJX01000052.1 GCA003201715_02621 gene open 3589-4020
5256 QJJX01000052.1 GCA003201715_02622 gene open 4358-7516
5257 QJJX01000052.1 GCA003201715_02623 gene open 7531-7713
5258 QJJX01000052.1 GCA003201715_02624 gene open 8158-9876
5259 QJJX01000052.1 GCA003201715_02625 gene open 10553-10741
5260 QJJX01000052.1 GCA003201715_02626 gene open 11123-13168 metG
5261 QJJX01000052.1 GCA003201715_02627 gene open 13326-14468
5262 QJJX01000053.1 GCA003201715_02628 CDS open 955-2652 _na     565_aa putative transporter
5263 QJJX01000053.1 GCA003201715_02629 CDS open 2709-4469 _na     586_aa DUF349 domain-containing protein
5264 QJJX01000053.1 GCA003201715_02630 CDS open 4585-5511 _na     308_aa Magnesium transporter
5265 QJJX01000053.1 GCA003201715_02631 CDS open 7127-8053 _na     308_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
5266 QJJX01000053.1 GCA003201715_02632 CDS open 8062-8919 _na     285_aa coaW type II pantothenate kinase
5267 QJJX01000053.1 GCA003201715_02633 CDS open 8910-9605 _na     231_aa DNA/RNA-binding domain of Phe-tRNA-synthetase-like protein
5268 QJJX01000053.1 GCA003201715_02634 CDS open 9602-11602 _na     666_aa ligA NAD-dependent DNA ligase LigA
5269 QJJX01000053.1 GCA003201715_02635 CDS open 11650-12459 _na     269_aa DUF4738 domain-containing protein
5270 QJJX01000053.1 GCA003201715_02636 CDS open 12481-13797 _na     438_aa UDP-glucose 6-dehydrogenase
5271 QJJX01000053.1 GCA003201715_02637 CDS open 13842-14387 _na     181_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
5272 QJJX01000053.1 GCA003201715_02628 gene open 955-2652
5273 QJJX01000053.1 GCA003201715_02629 gene open 2709-4469
5274 QJJX01000053.1 GCA003201715_02630 gene open 4585-5511
5275 QJJX01000053.1 GCA003201715_02631 gene open 7127-8053 menA
5276 QJJX01000053.1 GCA003201715_02632 gene open 8062-8919 coaW
5277 QJJX01000053.1 GCA003201715_02633 gene open 8910-9605
5278 QJJX01000053.1 GCA003201715_02634 gene open 9602-11602 ligA
5279 QJJX01000053.1 GCA003201715_02635 gene open 11650-12459
5280 QJJX01000053.1 GCA003201715_02636 gene open 12481-13797
5281 QJJX01000053.1 GCA003201715_02637 gene open 13842-14387 rfbC
5282 QJJX01000054.1 repeat_region open 12839-13545 CRISPR array with 10 repeats of length 37%2C consensus sequence GTCTTAATCCTTGTTTTAATGGAAGATGCACTAGTAC and spacer length 36
5283 QJJX01000054.1 GCA003201715_02638 CDS open 447-2336 _na     629_aa GHKL domain-containing protein
5284 QJJX01000054.1 GCA003201715_02639 CDS open 2315-2782 _na     155_aa Response regulator receiver domain-containing protein
5285 QJJX01000054.1 GCA003201715_02640 CDS open 2779-4017 _na     412_aa Nucleoside phosphorylase domain-containing protein
5286 QJJX01000054.1 GCA003201715_02641 CDS open 4491-5837 _na     448_aa dcuA Anaerobic C4-dicarboxylate transporter DcuA
5287 QJJX01000054.1 GCA003201715_02642 CDS open 5905-6957 _na     350_aa L-asparaginase
5288 QJJX01000054.1 GCA003201715_02643 CDS open 7049-8263 _na     404_aa Phosphate-selective porin O/P
5289 QJJX01000054.1 GCA003201715_02644 CDS open 8434-9039 _na     201_aa DUF6621 domain-containing protein
5290 QJJX01000054.1 GCA003201715_02645 CDS open 9120-10358 _na     412_aa Saccharopine dehydrogenase
5291 QJJX01000054.1 GCA003201715_02646 CDS open 10397-11422 _na     341_aa recA recombinase RecA
5292 QJJX01000054.1 GCA003201715_02647 CDS open 11721-11879 _na     52_aa hypothetical protein
5293 QJJX01000054.1 GCA003201715_02638 gene open 447-2336
5294 QJJX01000054.1 GCA003201715_02639 gene open 2315-2782
5295 QJJX01000054.1 GCA003201715_02640 gene open 2779-4017
5296 QJJX01000054.1 GCA003201715_02641 gene open 4491-5837 dcuA
5297 QJJX01000054.1 GCA003201715_02642 gene open 5905-6957
5298 QJJX01000054.1 GCA003201715_02643 gene open 7049-8263
5299 QJJX01000054.1 GCA003201715_02644 gene open 8434-9039
5300 QJJX01000054.1 GCA003201715_02645 gene open 9120-10358
5301 QJJX01000054.1 GCA003201715_02646 gene open 10397-11422 recA
5302 QJJX01000054.1 GCA003201715_02647 gene open 11721-11879
5303 QJJX01000055.1 GCA003201715_02648 CDS open 475-2469 _na     664_aa Helix-hairpin-helix protein
5304 QJJX01000055.1 GCA003201715_02649 CDS open 2591-2683 _na     30_aa hypothetical protein
5305 QJJX01000055.1 GCA003201715_02650 CDS open 2625-2756 _na     43_aa hypothetical protein
5306 QJJX01000055.1 GCA003201715_02651 CDS open 2695-4719 _na     674_aa DUF5686 domain-containing protein
5307 QJJX01000055.1 GCA003201715_02652 CDS open 4766-7990 _na     1074_aa DNA 3'-5' helicase
5308 QJJX01000055.1 GCA003201715_02653 CDS open 7987-10860 _na     957_aa PD-(D/E)XK nuclease superfamily protein
5309 QJJX01000055.1 GCA003201715_02654 CDS open 11229-11984 _na     251_aa hypothetical protein
5310 QJJX01000055.1 GCA003201715_02655 CDS open 13358-13525 _na     55_aa hypothetical protein
5311 QJJX01000055.1 GCA003201715_02648 gene open 475-2469
5312 QJJX01000055.1 GCA003201715_02649 gene open 2591-2683
5313 QJJX01000055.1 GCA003201715_02650 gene open 2625-2756
5314 QJJX01000055.1 GCA003201715_02651 gene open 2695-4719
5315 QJJX01000055.1 GCA003201715_02652 gene open 4766-7990
5316 QJJX01000055.1 GCA003201715_02653 gene open 7987-10860
5317 QJJX01000055.1 GCA003201715_02654 gene open 11229-11984
5318 QJJX01000055.1 GCA003201715_02655 gene open 13358-13525
5319 QJJX01000056.1 GCA003201715_02656 CDS open 304-945 _na     213_aa SH3b domain-containing protein
5320 QJJX01000056.1 GCA003201715_02657 CDS open 1149-1289 _na     46_aa hypothetical protein
5321 QJJX01000056.1 GCA003201715_02658 CDS open 1375-1788 _na     137_aa DUF4240 domain-containing protein
5322 QJJX01000056.1 GCA003201715_02659 CDS open 1888-2262 _na     124_aa Immunity protein 40 of polymorphic toxin system
5323 QJJX01000056.1 GCA003201715_02660 CDS open 2541-3272 _na     243_aa Lipoprotein
5324 QJJX01000056.1 GCA003201715_02661 CDS open 3288-3932 _na     214_aa Lipoprotein
5325 QJJX01000056.1 GCA003201715_02662 CDS open 3993-4892 _na     299_aa Putative RNase toxin 23 of polymorphic toxin system
5326 QJJX01000056.1 GCA003201715_02663 CDS open 5350-5835 _na     161_aa Putative secreted protein (Por secretion system target)
5327 QJJX01000056.1 GCA003201715_02664 CDS open 5832-6761 _na     309_aa Calycin-like beta-barrel protein
5328 QJJX01000056.1 GCA003201715_02665 CDS open 6942-7736 _na     264_aa Heme-binding HmuY-like protein
5329 QJJX01000056.1 GCA003201715_02666 CDS open 7985-9940 _na     651_aa Outer membrane receptor for ferrienterochelin and colicins
5330 QJJX01000056.1 GCA003201715_02667 CDS open 10141-10311 _na     56_aa hypothetical protein
5331 QJJX01000056.1 GCA003201715_02668 CDS open 10434-11432 _na     332_aa NADPH:quinone reductase-like Zn-dependent oxidoreductase
5332 QJJX01000056.1 GCA003201715_02669 CDS open 11756-12028 _na     90_aa AB hydrolase-1 domain-containing protein
5333 QJJX01000056.1 GCA003201715_02670 CDS open 13368-13574 _na     68_aa Transposase DDE domain-containing protein
5334 QJJX01000056.1 GCA003201715_02656 gene open 304-945
5335 QJJX01000056.1 GCA003201715_02657 gene open 1149-1289
5336 QJJX01000056.1 GCA003201715_02658 gene open 1375-1788
5337 QJJX01000056.1 GCA003201715_02659 gene open 1888-2262
5338 QJJX01000056.1 GCA003201715_02660 gene open 2541-3272
5339 QJJX01000056.1 GCA003201715_02661 gene open 3288-3932
5340 QJJX01000056.1 GCA003201715_02662 gene open 3993-4892
5341 QJJX01000056.1 GCA003201715_02663 gene open 5350-5835
5342 QJJX01000056.1 GCA003201715_02664 gene open 5832-6761
5343 QJJX01000056.1 GCA003201715_02665 gene open 6942-7736
5344 QJJX01000056.1 GCA003201715_02666 gene open 7985-9940
5345 QJJX01000056.1 GCA003201715_02667 gene open 10141-10311
5346 QJJX01000056.1 GCA003201715_02668 gene open 10434-11432
5347 QJJX01000056.1 GCA003201715_02669 gene open 11756-12028
5348 QJJX01000056.1 GCA003201715_02670 gene open 13368-13574
5349 QJJX01000057.1 GCA003201715_02671 CDS open 426-551 _na     41_aa hypothetical protein
5350 QJJX01000057.1 GCA003201715_02672 CDS open 773-952 _na     59_aa hypothetical protein
5351 QJJX01000057.1 GCA003201715_02673 CDS open 1316-2719 _na     467_aa hypothetical protein
5352 QJJX01000057.1 GCA003201715_02674 CDS open 3070-4062 _na     330_aa F5/8 type C domain-containing protein
5353 QJJX01000057.1 GCA003201715_02675 CDS open 4161-5324 _na     387_aa Concanavalin A-like lectin/glucanase superfamily protein
5354 QJJX01000057.1 GCA003201715_02676 CDS open 5347-6450 _na     367_aa Glycosyl hydrolase family 18 (Putative chitinase)
5355 QJJX01000057.1 GCA003201715_02677 CDS open 6672-8216 _na     514_aa SusD/RagB-like outer membrane lipoprotein
5356 QJJX01000057.1 GCA003201715_02678 CDS open 8263-11298 _na     1011_aa TonB-linked SusC/RagA family outer membrane protein
5357 QJJX01000057.1 GCA003201715_02671 gene open 426-551
5358 QJJX01000057.1 GCA003201715_02672 gene open 773-952
5359 QJJX01000057.1 GCA003201715_02673 gene open 1316-2719
5360 QJJX01000057.1 GCA003201715_02674 gene open 3070-4062
5361 QJJX01000057.1 GCA003201715_02675 gene open 4161-5324
5362 QJJX01000057.1 GCA003201715_02676 gene open 5347-6450
5363 QJJX01000057.1 GCA003201715_02677 gene open 6672-8216
5364 QJJX01000057.1 GCA003201715_02678 gene open 8263-11298
5365 QJJX01000058.1 GCA003201715_02692 gene open 11347-11459 rrf
5366 QJJX01000058.1 GCA003201715_02692 rRNA open 11347-11459 rrf 5S ribosomal RNA
5367 QJJX01000058.1 GCA003201715_02679 CDS open 553-813 _na     86_aa hypothetical protein
5368 QJJX01000058.1 GCA003201715_02680 CDS open 1107-2645 _na     512_aa recG Divergent AAA domain / ATP-dependent DNA helicase RecG C-terminal / winged helix-turn-helix DNA-binding multi-domain protein
5369 QJJX01000058.1 GCA003201715_02681 CDS open 2650-3381 _na     243_aa hypothetical protein
5370 QJJX01000058.1 GCA003201715_02682 CDS open 3378-4220 _na     280_aa Porphyromonas-type peptidyl-arginine deiminase
5371 QJJX01000058.1 GCA003201715_02683 CDS open 4387-4815 _na     142_aa hypothetical protein
5372 QJJX01000058.1 GCA003201715_02684 CDS open 4888-5358 _na     156_aa Fic/DOC family protein
5373 QJJX01000058.1 GCA003201715_02685 CDS open 5441-5860 _na     139_aa gtrA Putative flippase GtrA
5374 QJJX01000058.1 GCA003201715_02686 CDS open 5838-6800 _na     320_aa Glycosyltransferase%2C group 2 family protein
5375 QJJX01000058.1 GCA003201715_02687 CDS open 6797-7606 _na     269_aa Polysaccharide deacetylase
5376 QJJX01000058.1 GCA003201715_02688 CDS open 8083-8304 _na     73_aa DUF2795 domain-containing protein
5377 QJJX01000058.1 GCA003201715_02689 CDS open 8365-8928 _na     187_aa Corrinoid adenosyltransferase
5378 QJJX01000058.1 GCA003201715_02690 CDS open 8948-9538 _na     196_aa Class I SAM-dependent methyltransferase
5379 QJJX01000058.1 GCA003201715_02691 CDS open 9882-10619 _na     245_aa SIMPL domain-containing protein
5380 QJJX01000058.1 GCA003201715_02679 gene open 553-813
5381 QJJX01000058.1 GCA003201715_02680 gene open 1107-2645 recG
5382 QJJX01000058.1 GCA003201715_02681 gene open 2650-3381
5383 QJJX01000058.1 GCA003201715_02682 gene open 3378-4220
5384 QJJX01000058.1 GCA003201715_02683 gene open 4387-4815
5385 QJJX01000058.1 GCA003201715_02684 gene open 4888-5358
5386 QJJX01000058.1 GCA003201715_02685 gene open 5441-5860 gtrA
5387 QJJX01000058.1 GCA003201715_02686 gene open 5838-6800
5388 QJJX01000058.1 GCA003201715_02687 gene open 6797-7606
5389 QJJX01000058.1 GCA003201715_02688 gene open 8083-8304
5390 QJJX01000058.1 GCA003201715_02689 gene open 8365-8928
5391 QJJX01000058.1 GCA003201715_02690 gene open 8948-9538
5392 QJJX01000058.1 GCA003201715_02691 gene open 9882-10619
5393 QJJX01000059.1 GCA003201715_02693 CDS open 888-2549 _na     553_aa DUF6377 domain-containing protein
5394 QJJX01000059.1 GCA003201715_02694 CDS open 2780-5770 _na     996_aa TonB-linked SusC/RagA family outer membrane protein
5395 QJJX01000059.1 GCA003201715_02695 CDS open 5802-7535 _na     577_aa susD SusD family protein
5396 QJJX01000059.1 GCA003201715_02696 CDS open 7557-9116 _na     519_aa DUF5019 domain-containing protein
5397 QJJX01000059.1 GCA003201715_02697 CDS open 9248-10675 _na     475_aa Alpha galactosidase C-terminal beta sandwich domain-containing protein
5398 QJJX01000059.1 GCA003201715_02693 gene open 888-2549
5399 QJJX01000059.1 GCA003201715_02694 gene open 2780-5770
5400 QJJX01000059.1 GCA003201715_02695 gene open 5802-7535 susD
5401 QJJX01000059.1 GCA003201715_02696 gene open 7557-9116
5402 QJJX01000059.1 GCA003201715_02697 gene open 9248-10675
5403 QJJX01000060.1 GCA003201715_02699 CDS open 1773-1892 _na     39_aa hypothetical protein
5404 QJJX01000060.1 GCA003201715_02700 CDS open 2477-3583 _na     368_aa Membrane-bound lytic murein transglycosylase F
5405 QJJX01000060.1 GCA003201715_02701 CDS open 3740-4072 _na     110_aa Cupin type-2 domain-containing protein
5406 QJJX01000060.1 GCA003201715_02702 CDS open 4215-5243 _na     342_aa TonB-dependent receptor-like protein
5407 QJJX01000060.1 GCA003201715_02703 CDS open 5359-7422 _na     687_aa TonB-dependent receptor-like protein
5408 QJJX01000060.1 GCA003201715_02704 CDS open 8332-10779 _na     815_aa Spi protease inhibitor
5409 QJJX01000060.1 GCA003201715_02699 gene open 1773-1892
5410 QJJX01000060.1 GCA003201715_02700 gene open 2477-3583
5411 QJJX01000060.1 GCA003201715_02701 gene open 3740-4072
5412 QJJX01000060.1 GCA003201715_02702 gene open 4215-5243
5413 QJJX01000060.1 GCA003201715_02703 gene open 5359-7422
5414 QJJX01000060.1 GCA003201715_02704 gene open 8332-10779
5415 QJJX01000060.1 GCA003201715_02698 gene open 394-478 trnS
5416 QJJX01000060.1 GCA003201715_02698 tRNA open 394-478 trnS tRNA-Ser(tga)
5417 QJJX01000061.1 GCA003201715_02705 CDS open 423-671 _na     82_aa Cas6b C-terminal domain-containing protein
5418 QJJX01000061.1 GCA003201715_02706 CDS open 690-2252 _na     520_aa Cas10/Cmr2 second palm domain-containing protein
5419 QJJX01000061.1 GCA003201715_02707 CDS open 2256-2810 _na     184_aa CRISPR-associated RAMP protein
5420 QJJX01000061.1 GCA003201715_02708 CDS open 2807-4231 _na     474_aa CRISPR-associated protein Csx10
5421 QJJX01000061.1 GCA003201715_02709 CDS open 4243-5739 _na     498_aa CRISPR-associated RAMP protein
5422 QJJX01000061.1 GCA003201715_02710 CDS open 5732-6139 _na     135_aa TIGR04423 family type III CRISPR-associated protein
5423 QJJX01000061.1 GCA003201715_02711 CDS open 6147-7940 _na     597_aa CRISPR-associated protein
5424 QJJX01000061.1 GCA003201715_02712 CDS open 7953-9059 _na     368_aa Card1 endonuclease domain-containing protein
5425 QJJX01000061.1 GCA003201715_02713 CDS open 9068-9826 _na     252_aa csx2 TIGR02221 family CRISPR-associated protein
5426 QJJX01000061.1 GCA003201715_02705 gene open 423-671
5427 QJJX01000061.1 GCA003201715_02706 gene open 690-2252
5428 QJJX01000061.1 GCA003201715_02707 gene open 2256-2810
5429 QJJX01000061.1 GCA003201715_02708 gene open 2807-4231
5430 QJJX01000061.1 GCA003201715_02709 gene open 4243-5739
5431 QJJX01000061.1 GCA003201715_02710 gene open 5732-6139
5432 QJJX01000061.1 GCA003201715_02711 gene open 6147-7940
5433 QJJX01000061.1 GCA003201715_02712 gene open 7953-9059
5434 QJJX01000061.1 GCA003201715_02713 gene open 9068-9826 csx2
5435 QJJX01000062.1 GCA003201715_02714 CDS open 181-1146 _na     321_aa cfxA CfxA family broad-spectrum class A beta-lactamase
5436 QJJX01000062.1 GCA003201715_02715 CDS open 1239-2642 _na     467_aa Mobilization protein
5437 QJJX01000062.1 GCA003201715_02716 CDS open 2926-4041 _na     371_aa Toprim domain-containing protein
5438 QJJX01000062.1 GCA003201715_02717 CDS open 4045-5142 _na     365_aa rAD55 Helicase
5439 QJJX01000062.1 GCA003201715_02718 CDS open 5148-5522 _na     124_aa Helix-turn-helix domain-containing protein
5440 QJJX01000062.1 GCA003201715_02719 CDS open 5722-6579 _na     285_aa Transposase
5441 QJJX01000062.1 GCA003201715_02720 CDS open 6827-7945 _na     372_aa xerD Site-specific integrase
5442 QJJX01000062.1 GCA003201715_02721 CDS open 8087-9019 _na     310_aa DNA binding domain%2C excisionase family
5443 QJJX01000062.1 GCA003201715_02722 CDS open 9325-9975 _na     216_aa IS1380 family transposase
5444 QJJX01000062.1 GCA003201715_02714 gene open 181-1146 cfxA
5445 QJJX01000062.1 GCA003201715_02715 gene open 1239-2642
5446 QJJX01000062.1 GCA003201715_02716 gene open 2926-4041
5447 QJJX01000062.1 GCA003201715_02717 gene open 4045-5142 rAD55
5448 QJJX01000062.1 GCA003201715_02718 gene open 5148-5522
5449 QJJX01000062.1 GCA003201715_02719 gene open 5722-6579
5450 QJJX01000062.1 GCA003201715_02720 gene open 6827-7945 xerD
5451 QJJX01000062.1 GCA003201715_02721 gene open 8087-9019
5452 QJJX01000062.1 GCA003201715_02722 gene open 9325-9975
5453 QJJX01000063.1 GCA003201715_02723 CDS open 38-1444 _na     468_aa hypothetical protein
5454 QJJX01000063.1 GCA003201715_02724 CDS open 2411-2659 _na     82_aa Transposase
5455 QJJX01000063.1 GCA003201715_02725 CDS open 2804-3394 _na     196_aa Outer membrane protein with beta-barrel domain
5456 QJJX01000063.1 GCA003201715_02726 CDS open 3427-3786 _na     119_aa hypothetical protein
5457 QJJX01000063.1 GCA003201715_02727 CDS open 4154-4306 _na     50_aa hypothetical protein
5458 QJJX01000063.1 GCA003201715_02728 CDS open 4245-7577 _na     1110_aa TonB-linked SusC/RagA family outer membrane protein
5459 QJJX01000063.1 GCA003201715_02729 CDS open 7590-8990 _na     466_aa SusD-like starch-binding protein associating with outer membrane
5460 QJJX01000063.1 GCA003201715_02723 gene open 38-1444
5461 QJJX01000063.1 GCA003201715_02724 gene open 2411-2659
5462 QJJX01000063.1 GCA003201715_02725 gene open 2804-3394
5463 QJJX01000063.1 GCA003201715_02726 gene open 3427-3786
5464 QJJX01000063.1 GCA003201715_02727 gene open 4154-4306
5465 QJJX01000063.1 GCA003201715_02728 gene open 4245-7577
5466 QJJX01000063.1 GCA003201715_02729 gene open 7590-8990
5467 QJJX01000064.1 GCA003201715_02730 CDS open 547-1752 _na     401_aa Lipoprotein
5468 QJJX01000064.1 GCA003201715_02731 CDS open 2186-6808 _na     1540_aa DUF490 domain-containing protein
5469 QJJX01000064.1 GCA003201715_02732 CDS open 6798-9104 _na     768_aa Surface antigen-like protein
5470 QJJX01000064.1 GCA003201715_02730 gene open 547-1752
5471 QJJX01000064.1 GCA003201715_02731 gene open 2186-6808
5472 QJJX01000064.1 GCA003201715_02732 gene open 6798-9104
5473 QJJX01000065.1 GCA003201715_02733 CDS open 460-888 _na     142_aa Lipoprotein
5474 QJJX01000065.1 GCA003201715_02734 CDS open 895-3243 _na     782_aa RHS repeat-associated protein
5475 QJJX01000065.1 GCA003201715_02735 CDS open 3424-3669 _na     81_aa hypothetical protein
5476 QJJX01000065.1 GCA003201715_02736 CDS open 3676-5019 _na     447_aa RHS repeat-associated protein
5477 QJJX01000065.1 GCA003201715_02737 CDS open 5117-5998 _na     293_aa YD repeat-containing protein
5478 QJJX01000065.1 GCA003201715_02738 CDS open 6817-7302 _na     161_aa MORN repeat protein
5479 QJJX01000065.1 GCA003201715_02739 CDS open 7283-8458 _na     391_aa RHS repeat-associated protein
5480 QJJX01000065.1 GCA003201715_02733 gene open 460-888
5481 QJJX01000065.1 GCA003201715_02734 gene open 895-3243
5482 QJJX01000065.1 GCA003201715_02735 gene open 3424-3669
5483 QJJX01000065.1 GCA003201715_02736 gene open 3676-5019
5484 QJJX01000065.1 GCA003201715_02737 gene open 5117-5998
5485 QJJX01000065.1 GCA003201715_02738 gene open 6817-7302
5486 QJJX01000065.1 GCA003201715_02739 gene open 7283-8458
5487 QJJX01000066.1 GCA003201715_02740 CDS open 319-1254 _na     311_aa Protein NO VEIN C-terminal domain-containing protein
5488 QJJX01000066.1 GCA003201715_02741 CDS open 1229-3184 _na     651_aa Helicase-like protein
5489 QJJX01000066.1 GCA003201715_02742 CDS open 3177-4463 _na     428_aa ParB/Sulfiredoxin domain-containing protein
5490 QJJX01000066.1 GCA003201715_02743 CDS open 4467-5375 _na     302_aa DpnII restriction endonuclease
5491 QJJX01000066.1 GCA003201715_02744 CDS open 5372-6715 _na     447_aa Cytosine-specific methyltransferase
5492 QJJX01000066.1 GCA003201715_02745 CDS open 6719-7498 _na     259_aa HNH nuclease domain-containing protein
5493 QJJX01000066.1 GCA003201715_02746 CDS open 7523-7729 _na     68_aa DNA-binding XRE family transcriptional regulator
5494 QJJX01000066.1 GCA003201715_02747 CDS open 7867-8166 _na     99_aa hypothetical protein
5495 QJJX01000066.1 GCA003201715_02740 gene open 319-1254
5496 QJJX01000066.1 GCA003201715_02741 gene open 1229-3184
5497 QJJX01000066.1 GCA003201715_02742 gene open 3177-4463
5498 QJJX01000066.1 GCA003201715_02743 gene open 4467-5375
5499 QJJX01000066.1 GCA003201715_02744 gene open 5372-6715
5500 QJJX01000066.1 GCA003201715_02745 gene open 6719-7498