BAKTAGenome Explorer: Haemophilus parahaemolyticus (GCA_003252925.1)
Select a Genome:
|
BAKTA Annotations for GCA_003252925.1
|
Search & Sort all 4159 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | QEPS01000005.1 | GCA003252925_01685 | gene | open | 8564-10435 | rpoD | ||
| 3502 | QEPS01000005.1 | GCA003252925_01686 | gene | open | 10559-10978 | psiE | ||
| 3503 | QEPS01000005.1 | GCA003252925_01687 | gene | open | 11169-12749 | prfC | ||
| 3504 | QEPS01000005.1 | GCA003252925_01688 | gene | open | 12839-14041 | |||
| 3505 | QEPS01000005.1 | GCA003252925_01689 | gene | open | 14146-14928 | |||
| 3506 | QEPS01000005.1 | GCA003252925_01690 | gene | open | 14934-15371 | aroQ | ||
| 3507 | QEPS01000005.1 | GCA003252925_01691 | gene | open | 15483-16511 | bioB | ||
| 3508 | QEPS01000005.1 | GCA003252925_01692 | gene | open | 16638-17462 | dapD | ||
| 3509 | QEPS01000005.1 | GCA003252925_01693 | gene | open | 17557-17991 | dtd | ||
| 3510 | QEPS01000005.1 | GCA003252925_01694 | gene | open | 17988-18818 | brkB | ||
| 3511 | QEPS01000005.1 | GCA003252925_01695 | gene | open | 18995-19327 | |||
| 3512 | QEPS01000005.1 | GCA003252925_01696 | gene | open | 19395-20501 | trmA | ||
| 3513 | QEPS01000005.1 | GCA003252925_01698 | gene | open | 20805-22886 | recG | ||
| 3514 | QEPS01000005.1 | GCA003252925_01699 | gene | open | 23057-23254 | |||
| 3515 | QEPS01000005.1 | GCA003252925_01700 | gene | open | 23336-24487 | fucO | ||
| 3516 | QEPS01000005.1 | GCA003252925_01701 | gene | open | 24554-25840 | fucP | ||
| 3517 | QEPS01000005.1 | GCA003252925_01702 | gene | open | 25883-26530 | fucA | ||
| 3518 | QEPS01000005.1 | GCA003252925_01703 | gene | open | 26592-27026 | fucU | ||
| 3519 | QEPS01000005.1 | GCA003252925_01704 | gene | open | 27047-28480 | fucK | ||
| 3520 | QEPS01000005.1 | GCA003252925_01705 | gene | open | 28661-30427 | fucI | ||
| 3521 | QEPS01000005.1 | GCA003252925_01706 | gene | open | 30741-32399 | manB | ||
| 3522 | QEPS01000005.1 | GCA003252925_01707 | gene | open | 32596-34071 | |||
| 3523 | QEPS01000005.1 | GCA003252925_01708 | gene | open | 34077-34250 | |||
| 3524 | QEPS01000005.1 | GCA003252925_01709 | gene | open | 34367-35797 | selA | ||
| 3525 | QEPS01000005.1 | GCA003252925_01711 | gene | open | 36090-36533 | mioC | ||
| 3526 | QEPS01000005.1 | GCA003252925_01712 | gene | open | 36600-37631 | hipA | ||
| 3527 | QEPS01000005.1 | GCA003252925_01713 | gene | open | 37631-37948 | hipA | ||
| 3528 | QEPS01000005.1 | GCA003252925_01714 | gene | open | 37936-38244 | |||
| 3529 | QEPS01000005.1 | GCA003252925_01715 | gene | open | 38500-38664 | |||
| 3530 | QEPS01000005.1 | GCA003252925_01716 | gene | open | 38759-40336 | |||
| 3531 | QEPS01000005.1 | GCA003252925_01717 | gene | open | 40410-44696 | rpoC | ||
| 3532 | QEPS01000005.1 | GCA003252925_01718 | gene | open | 44959-48987 | rpoB | ||
| 3533 | QEPS01000005.1 | GCA003252925_01719 | gene | open | 49314-49832 | |||
| 3534 | QEPS01000005.1 | GCA003252925_01720 | gene | open | 49907-50020 | |||
| 3535 | QEPS01000005.1 | GCA003252925_01721 | gene | open | 50474-51217 | |||
| 3536 | QEPS01000005.1 | GCA003252925_01722 | gene | open | 51268-52614 | trkA | ||
| 3537 | QEPS01000005.1 | GCA003252925_01723 | gene | open | 52792-54159 | rsmB | ||
| 3538 | QEPS01000005.1 | GCA003252925_01724 | gene | open | 54143-56011 | selB | ||
| 3539 | QEPS01000005.1 | GCA003252925_01725 | gene | open | 56279-57994 | proS | ||
| 3540 | QEPS01000005.1 | GCA003252925_01726 | gene | open | 58051-58686 | |||
| 3541 | QEPS01000005.1 | GCA003252925_01727 | gene | open | 58689-59381 | |||
| 3542 | QEPS01000005.1 | GCA003252925_01728 | gene | open | 59658-60422 | deoR | ||
| 3543 | QEPS01000005.1 | GCA003252925_01729 | gene | open | 60682-62502 | glmS | ||
| 3544 | QEPS01000005.1 | GCA003252925_01730 | gene | open | 62745-63272 | |||
| 3545 | QEPS01000005.1 | GCA003252925_01731 | gene | open | 63414-63668 | rpsQ | ||
| 3546 | QEPS01000005.1 | GCA003252925_01732 | gene | open | 63668-63859 | rpmC | ||
| 3547 | QEPS01000005.1 | GCA003252925_01733 | gene | open | 63859-64269 | rplP | ||
| 3548 | QEPS01000005.1 | GCA003252925_01734 | gene | open | 64283-64990 | rpsC | ||
| 3549 | QEPS01000005.1 | GCA003252925_01735 | gene | open | 65008-65340 | rplV | ||
| 3550 | QEPS01000005.1 | GCA003252925_01736 | gene | open | 65351-65626 | rpsS | ||
| 3551 | QEPS01000005.1 | GCA003252925_01737 | gene | open | 65654-66475 | rplB | ||
| 3552 | QEPS01000005.1 | GCA003252925_01738 | gene | open | 66495-66800 | rplW | ||
| 3553 | QEPS01000005.1 | GCA003252925_01739 | gene | open | 66797-67399 | rplD | ||
| 3554 | QEPS01000005.1 | GCA003252925_01740 | gene | open | 67415-68041 | rplC | ||
| 3555 | QEPS01000005.1 | GCA003252925_01741 | gene | open | 68067-68378 | rpsJ_V57L | ||
| 3556 | QEPS01000005.1 | GCA003252925_01742 | gene | open | 68861-69511 | |||
| 3557 | QEPS01000005.1 | GCA003252925_01743 | gene | open | 70408-71730 | dcuB | ||
| 3558 | QEPS01000005.1 | GCA003252925_01744 | gene | open | 71870-72694 | dapF | ||
| 3559 | QEPS01000005.1 | GCA003252925_01745 | gene | open | 72708-73277 | |||
| 3560 | QEPS01000005.1 | GCA003252925_01746 | gene | open | 73358-74797 | |||
| 3561 | QEPS01000005.1 | GCA003252925_01747 | gene | open | 74875-75162 | |||
| 3562 | QEPS01000005.1 | GCA003252925_01748 | gene | open | 75162-75452 | |||
| 3563 | QEPS01000005.1 | GCA003252925_01749 | gene | open | 75567-76934 | |||
| 3564 | QEPS01000005.1 | GCA003252925_01750 | gene | open | 77067-77480 | |||
| 3565 | QEPS01000005.1 | GCA003252925_01751 | gene | open | 77848-78642 | |||
| 3566 | QEPS01000005.1 | GCA003252925_01752 | gene | open | 78698-80086 | ffh | ||
| 3567 | QEPS01000005.1 | GCA003252925_01755 | gene | open | 80672-81769 | mltC | ||
| 3568 | QEPS01000005.1 | GCA003252925_01756 | gene | open | 81780-82049 | yggX | ||
| 3569 | QEPS01000005.1 | GCA003252925_01757 | gene | open | 82052-83188 | mutY | ||
| 3570 | QEPS01000005.1 | GCA003252925_01758 | gene | open | 83261-83656 | |||
| 3571 | QEPS01000005.1 | GCA003252925_01759 | gene | open | 84214-84735 | hslV | ||
| 3572 | QEPS01000005.1 | GCA003252925_01760 | gene | open | 84881-86203 | hslU | ||
| 3573 | QEPS01000005.1 | GCA003252925_01761 | gene | open | 86502-86780 | |||
| 3574 | QEPS01000005.1 | GCA003252925_01762 | gene | open | 86859-88547 | |||
| 3575 | QEPS01000005.1 | GCA003252925_01763 | gene | open | 88631-89386 | pTC1 | ||
| 3576 | QEPS01000005.1 | GCA003252925_01764 | gene | open | 89386-90231 | |||
| 3577 | QEPS01000005.1 | GCA003252925_01765 | gene | open | 90228-90428 | ftsK | ||
| 3578 | QEPS01000005.1 | GCA003252925_01766 | gene | open | 90505-90690 | |||
| 3579 | QEPS01000005.1 | GCA003252925_01767 | gene | open | 90738-91454 | |||
| 3580 | QEPS01000005.1 | GCA003252925_01768 | gene | open | 91813-91962 | |||
| 3581 | QEPS01000005.1 | GCA003252925_01769 | gene | open | 92041-92751 | sIR2 | ||
| 3582 | QEPS01000005.1 | GCA003252925_01770 | gene | open | 92755-93645 | yorC | ||
| 3583 | QEPS01000005.1 | GCA003252925_01771 | gene | open | 93806-95104 | |||
| 3584 | QEPS01000005.1 | GCA003252925_01772 | gene | open | 95230-95772 | |||
| 3585 | QEPS01000005.1 | GCA003252925_01773 | gene | open | 95860-99309 | |||
| 3586 | QEPS01000005.1 | GCA003252925_01774 | gene | open | 99309-99947 | |||
| 3587 | QEPS01000005.1 | GCA003252925_01775 | gene | open | 100162-100791 | |||
| 3588 | QEPS01000005.1 | GCA003252925_01776 | gene | open | 100841-101704 | |||
| 3589 | QEPS01000005.1 | GCA003252925_01777 | gene | open | 101731-102546 | ureD | ||
| 3590 | QEPS01000005.1 | GCA003252925_01778 | gene | open | 102621-103256 | ureG | ||
| 3591 | QEPS01000005.1 | GCA003252925_01779 | gene | open | 103332-104039 | ureF | ||
| 3592 | QEPS01000005.1 | GCA003252925_01780 | gene | open | 104024-104581 | ureE | ||
| 3593 | QEPS01000005.1 | GCA003252925_01781 | gene | open | 104832-105452 | |||
| 3594 | QEPS01000005.1 | GCA003252925_01782 | gene | open | 105490-107208 | ureC | ||
| 3595 | QEPS01000005.1 | GCA003252925_01784 | gene | open | 107220-107525 | ureB | ||
| 3596 | QEPS01000005.1 | GCA003252925_01785 | gene | open | 107547-107849 | ureA | ||
| 3597 | QEPS01000005.1 | GCA003252925_01786 | gene | open | 107917-108822 | |||
| 3598 | QEPS01000005.1 | GCA003252925_01787 | gene | open | 108902-109522 | |||
| 3599 | QEPS01000005.1 | GCA003252925_01788 | gene | open | 109530-110129 | |||
| 3600 | QEPS01000005.1 | GCA003252925_01789 | gene | open | 110122-110727 | cbiM | ||
| 3601 | QEPS01000005.1 | GCA003252925_01790 | gene | open | 110727-111191 | |||
| 3602 | QEPS01000005.1 | GCA003252925_01791 | gene | open | 111205-111909 | |||
| 3603 | QEPS01000005.1 | GCA003252925_01792 | gene | open | 112003-112617 | rsmG | ||
| 3604 | QEPS01000005.1 | GCA003252925_01793 | gene | open | 112833-113234 | |||
| 3605 | QEPS01000005.1 | GCA003252925_01794 | gene | open | 113324-115216 | mnmG | ||
| 3606 | QEPS01000005.1 | GCA003252925_01795 | gene | open | 115681-116154 | ychJ | ||
| 3607 | QEPS01000005.1 | GCA003252925_01796 | gene | open | 116240-117022 | |||
| 3608 | QEPS01000005.1 | GCA003252925_01797 | gene | open | 117171-122279 | |||
| 3609 | QEPS01000005.1 | GCA003252925_01798 | gene | open | 122397-123113 | hisM | ||
| 3610 | QEPS01000005.1 | GCA003252925_01799 | gene | open | 123123-123872 | |||
| 3611 | QEPS01000005.1 | GCA003252925_01800 | gene | open | 123981-124268 | |||
| 3612 | QEPS01000005.1 | GCA003252925_01801 | gene | open | 124540-124920 | |||
| 3613 | QEPS01000005.1 | GCA003252925_01802 | gene | open | 124948-125745 | atpB | ||
| 3614 | QEPS01000005.1 | GCA003252925_01803 | gene | open | 125870-126124 | atpE | ||
| 3615 | QEPS01000005.1 | GCA003252925_01804 | gene | open | 126183-126653 | atpF | ||
| 3616 | QEPS01000005.1 | GCA003252925_01805 | gene | open | 126667-127200 | atpH | ||
| 3617 | QEPS01000005.1 | GCA003252925_01806 | gene | open | 127213-128754 | atpA | ||
| 3618 | QEPS01000005.1 | GCA003252925_01807 | gene | open | 128777-129643 | atpG | ||
| 3619 | QEPS01000005.1 | GCA003252925_01808 | gene | open | 129663-131036 | atpD | ||
| 3620 | QEPS01000005.1 | GCA003252925_01809 | gene | open | 131088-131507 | |||
| 3621 | QEPS01000005.1 | GCA003252925_01810 | gene | open | 131665-132054 | |||
| 3622 | QEPS01000005.1 | GCA003252925_01811 | gene | open | 132182-132400 | |||
| 3623 | QEPS01000005.1 | GCA003252925_01812 | gene | open | 132409-132561 | |||
| 3624 | QEPS01000005.1 | GCA003252925_01813 | gene | open | 132584-132742 | |||
| 3625 | QEPS01000005.1 | GCA003252925_01814 | gene | open | 133177-134322 | lldD | ||
| 3626 | QEPS01000005.1 | GCA003252925_01676 | gene | open | 133-209 | trnP | ||
| 3627 | QEPS01000005.1 | GCA003252925_01677 | gene | open | 236-311 | trnH | ||
| 3628 | QEPS01000005.1 | GCA003252925_01678 | gene | open | 342-418 | trnR | ||
| 3629 | QEPS01000005.1 | GCA003252925_01697 | gene | open | 20576-20665 | trnS | ||
| 3630 | QEPS01000005.1 | GCA003252925_01710 | gene | open | 35869-35963 | trnU | ||
| 3631 | QEPS01000005.1 | GCA003252925_01753 | gene | open | 80390-80465 | trnN | ||
| 3632 | QEPS01000005.1 | GCA003252925_01754 | gene | open | 80471-80546 | trnF | ||
| 3633 | QEPS01000005.1 | GCA003252925_01676 | tRNA | open | 133-209 | trnP | tRNA-Pro(tgg) | |
| 3634 | QEPS01000005.1 | GCA003252925_01677 | tRNA | open | 236-311 | trnH | tRNA-His(gtg) | |
| 3635 | QEPS01000005.1 | GCA003252925_01678 | tRNA | open | 342-418 | trnR | tRNA-Arg(ccg) | |
| 3636 | QEPS01000005.1 | GCA003252925_01697 | tRNA | open | 20576-20665 | trnS | tRNA-Ser(tga) | |
| 3637 | QEPS01000005.1 | GCA003252925_01710 | tRNA | open | 35869-35963 | trnU | tRNA-SeC(tca) | |
| 3638 | QEPS01000005.1 | GCA003252925_01753 | tRNA | open | 80390-80465 | trnN | tRNA-Asn(gtt) | |
| 3639 | QEPS01000005.1 | GCA003252925_01754 | tRNA | open | 80471-80546 | trnF | tRNA-Phe(gaa) | |
| 3640 | QEPS01000006.1 | GCA003252925_01815 | gene | open | 11-126 | rrf | ||
| 3641 | QEPS01000006.1 | regulatory_region | open | 69270-69383 | Alpha operon ribosome binding site | |||
| 3642 | QEPS01000006.1 | GCA003252925_01815 | rRNA | open | 11-126 | rrf | 5S ribosomal RNA | |
| 3643 | QEPS01000006.1 | GCA003252925_01816 | CDS | open | 366-515 | _na 49_aa | Phage protein | |
| 3644 | QEPS01000006.1 | GCA003252925_01817 | CDS | open | 524-739 | _na 71_aa | hypothetical protein | |
| 3645 | QEPS01000006.1 | GCA003252925_01818 | CDS | open | 815-1444 | _na 209_aa | Glutathionine S-transferase | |
| 3646 | QEPS01000006.1 | GCA003252925_01819 | CDS | open | 1549-4155 | _na 868_aa | mutS | DNA mismatch repair protein MutS |
| 3647 | QEPS01000006.1 | GCA003252925_01820 | CDS | open | 4380-4694 | _na 104_aa | rsfS | ribosome silencing factor |
| 3648 | QEPS01000006.1 | GCA003252925_01821 | CDS | open | 4696-5163 | _na 155_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 3649 | QEPS01000006.1 | GCA003252925_01822 | CDS | open | 5212-7194 | _na 660_aa | mrdA | penicillin-binding protein 2 |
| 3650 | QEPS01000006.1 | GCA003252925_01823 | CDS | open | 7187-8314 | _na 375_aa | rodA | rod shape-determining protein RodA |
| 3651 | QEPS01000006.1 | GCA003252925_01824 | CDS | open | 8550-9140 | _na 196_aa | rlpA | Endolytic peptidoglycan transglycosylase RlpA |
| 3652 | QEPS01000006.1 | GCA003252925_01825 | CDS | open | 9248-10426 | _na 392_aa | serine-type D-Ala-D-Ala carboxypeptidase | |
| 3653 | QEPS01000006.1 | GCA003252925_01826 | CDS | open | 10540-10836 | _na 98_aa | ybeD | DUF493 domain-containing protein |
| 3654 | QEPS01000006.1 | GCA003252925_01827 | CDS | open | 10929-11603 | _na 224_aa | lipB | lipoyl(octanoyl) transferase LipB |
| 3655 | QEPS01000006.1 | GCA003252925_01828 | CDS | open | 11603-12592 | _na 329_aa | lipA | lipoyl synthase |
| 3656 | QEPS01000006.1 | GCA003252925_01829 | CDS | open | 12786-14246 | _na 486_aa | tldD | metalloprotease TldD |
| 3657 | QEPS01000006.1 | GCA003252925_01830 | CDS | open | 14250-15068 | _na 272_aa | DUF5710 domain-containing protein | |
| 3658 | QEPS01000006.1 | GCA003252925_01831 | CDS | open | 15058-15432 | _na 124_aa | hypothetical protein | |
| 3659 | QEPS01000006.1 | GCA003252925_01832 | CDS | open | 15467-15796 | _na 109_aa | azlD | Branched-chain amino acid transport protein AzlD |
| 3660 | QEPS01000006.1 | GCA003252925_01833 | CDS | open | 15793-16638 | _na 281_aa | azlC | azaleucine resistance protein AzlC |
| 3661 | QEPS01000006.1 | GCA003252925_01834 | CDS | open | 16756-17637 | _na 293_aa | prmA | 50S ribosomal protein L11 methyltransferase |
| 3662 | QEPS01000006.1 | GCA003252925_01835 | CDS | open | 17692-18660 | _na 322_aa | Outer membrane protein | |
| 3663 | QEPS01000006.1 | GCA003252925_01836 | CDS | open | 18878-19732 | _na 284_aa | Sodium/panthothenate symporter | |
| 3664 | QEPS01000006.1 | GCA003252925_01837 | CDS | open | 20165-20911 | _na 248_aa | ulaR | HTH-type transcriptional regulator UlaR |
| 3665 | QEPS01000006.1 | GCA003252925_01838 | CDS | open | 21602-23386 | _na 594_aa | PTS ascorbate-specific subunit IIBC | |
| 3666 | QEPS01000006.1 | GCA003252925_01839 | CDS | open | 23465-23932 | _na 155_aa | Ascorbate-specific PTS system EIIA component | |
| 3667 | QEPS01000006.1 | GCA003252925_01840 | CDS | open | 24092-24454 | _na 120_aa | fluC | Fluoride-specific ion channel FluC |
| 3668 | QEPS01000006.1 | GCA003252925_01841 | CDS | open | 24462-25466 | _na 334_aa | Transporter%2C major facilitator family protein | |
| 3669 | QEPS01000006.1 | GCA003252925_01842 | CDS | open | 25539-25760 | _na 73_aa | Protein SlyX-like protein | |
| 3670 | QEPS01000006.1 | GCA003252925_01843 | CDS | open | 25845-26561 | _na 238_aa | fkpA | FKBP-type peptidyl-prolyl cis-trans isomerase |
| 3671 | QEPS01000006.1 | GCA003252925_01844 | CDS | open | 26653-27327 | _na 224_aa | Transcriptional regulator | |
| 3672 | QEPS01000006.1 | GCA003252925_01845 | CDS | open | 27327-27680 | _na 117_aa | tusD | sulfurtransferase complex subunit TusD |
| 3673 | QEPS01000006.1 | GCA003252925_01846 | CDS | open | 27682-28050 | _na 122_aa | tusC | sulfurtransferase complex subunit TusC |
| 3674 | QEPS01000006.1 | GCA003252925_01847 | CDS | open | 28061-28327 | _na 88_aa | tusB | Sulfurtransferase complex subunit TusB |
| 3675 | QEPS01000006.1 | GCA003252925_01848 | CDS | open | 28329-29357 | _na 342_aa | fmt | methionyl-tRNA formyltransferase |
| 3676 | QEPS01000006.1 | GCA003252925_01849 | CDS | open | 29601-30209 | _na 202_aa | sirA | Cell developmental protein SirA |
| 3677 | QEPS01000006.1 | GCA003252925_01850 | CDS | open | 30214-31692 | _na 492_aa | Trk system potassium uptake protein | |
| 3678 | QEPS01000006.1 | GCA003252925_01851 | CDS | open | 31695-32225 | _na 176_aa | hemG | menaquinone-dependent protoporphyrinogen IX dehydrogenase |
| 3679 | QEPS01000006.1 | GCA003252925_01852 | CDS | open | 32320-32718 | _na 132_aa | mscL | large-conductance mechanosensitive channel protein MscL |
| 3680 | QEPS01000006.1 | GCA003252925_01853 | CDS | open | 33392-35185 | _na 597_aa | frdA | fumarate reductase (quinol) flavoprotein subunit |
| 3681 | QEPS01000006.1 | GCA003252925_01854 | CDS | open | 35195-35920 | _na 241_aa | sdhB | succinate dehydrogenase/fumarate reductase iron-sulfur subunit |
| 3682 | QEPS01000006.1 | GCA003252925_01855 | CDS | open | 35930-36316 | _na 128_aa | frdC | fumarate reductase subunit FrdC |
| 3683 | QEPS01000006.1 | GCA003252925_01856 | CDS | open | 36326-36682 | _na 118_aa | frdD | fumarate reductase subunit FrdD |
| 3684 | QEPS01000006.1 | GCA003252925_01857 | CDS | open | 36850-37077 | _na 75_aa | Bacterial inner membrane protein | |
| 3685 | QEPS01000006.1 | GCA003252925_01858 | CDS | open | 37188-38171 | _na 327_aa | epmA | elongation factor P--(R)-beta-lysine ligase |
| 3686 | QEPS01000006.1 | GCA003252925_01859 | CDS | open | 38262-38372 | _na 36_aa | lptM | LPS translocon maturation chaperone LptM |
| 3687 | QEPS01000006.1 | GCA003252925_01860 | CDS | open | 38423-39670 | _na 415_aa | lysA | diaminopimelate decarboxylase |
| 3688 | QEPS01000006.1 | GCA003252925_01861 | CDS | open | 39911-41911 | _na 666_aa | OPT family oligopeptide transporter | |
| 3689 | QEPS01000006.1 | GCA003252925_01862 | CDS | open | 42246-43640 | _na 464_aa | fumC | class II fumarate hydratase |
| 3690 | QEPS01000006.1 | GCA003252925_01863 | CDS | open | 43740-44666 | _na 308_aa | rfaD | ADP-glyceromanno-heptose 6-epimerase |
| 3691 | QEPS01000006.1 | GCA003252925_01864 | CDS | open | 45036-45548 | _na 170_aa | def | peptide deformylase |
| 3692 | QEPS01000006.1 | GCA003252925_01865 | CDS | open | 45650-46795 | _na 381_aa | dprA | DNA-processing protein DprA |
| 3693 | QEPS01000006.1 | GCA003252925_01866 | CDS | open | 46916-47320 | _na 134_aa | secE | preprotein translocase subunit SecE |
| 3694 | QEPS01000006.1 | GCA003252925_01867 | CDS | open | 47332-47901 | _na 189_aa | nusG | transcription termination/antitermination protein NusG |
| 3695 | QEPS01000006.1 | GCA003252925_01868 | CDS | open | 48125-48553 | _na 142_aa | rplK | 50S ribosomal protein L11 |
| 3696 | QEPS01000006.1 | GCA003252925_01869 | CDS | open | 48558-49247 | _na 229_aa | rplA | 50S ribosomal protein L1 |
| 3697 | QEPS01000006.1 | GCA003252925_01870 | CDS | open | 49336-49641 | _na 101_aa | hypothetical protein | |
| 3698 | QEPS01000006.1 | GCA003252925_01871 | CDS | open | 49641-51956 | _na 771_aa | DEAD/DEAH box helicase family protein | |
| 3699 | QEPS01000006.1 | GCA003252925_01872 | CDS | open | 51977-52654 | _na 225_aa | type I restriction-modification enzyme R subunit C-terminal domain-containing protein | |
| 3700 | QEPS01000006.1 | GCA003252925_01873 | CDS | open | 53120-54292 | _na 390_aa | restriction endonuclease subunit S | |
| 3701 | QEPS01000006.1 | GCA003252925_01874 | CDS | open | 54571-56133 | _na 520_aa | class I SAM-dependent DNA methyltransferase | |
| 3702 | QEPS01000006.1 | GCA003252925_01875 | CDS | open | 56307-57974 | _na 555_aa | dcuB | Anaerobic C4-dicarboxylate transporter DcuB |
| 3703 | QEPS01000006.1 | GCA003252925_01876 | CDS | open | 58322-58816 | _na 164_aa | rplJ | 50S ribosomal protein L10 |
| 3704 | QEPS01000006.1 | GCA003252925_01877 | CDS | open | 58871-59239 | _na 122_aa | rplL | 50S ribosomal protein L7/L12 |
| 3705 | QEPS01000006.1 | GCA003252925_01878 | CDS | open | 59402-60640 | _na 412_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 3706 | QEPS01000006.1 | GCA003252925_01879 | CDS | open | 60653-62047 | _na 464_aa | DHHW protein | |
| 3707 | QEPS01000006.1 | GCA003252925_01880 | CDS | open | 62058-63455 | _na 465_aa | putative alginate O-acetylase | |
| 3708 | QEPS01000006.1 | GCA003252925_01881 | CDS | open | 63699-64070 | _na 123_aa | rplN | 50S ribosomal protein L14 |
| 3709 | QEPS01000006.1 | GCA003252925_01882 | CDS | open | 64081-64392 | _na 103_aa | rplX | 50S ribosomal protein L24 |
| 3710 | QEPS01000006.1 | GCA003252925_01883 | CDS | open | 64412-64951 | _na 179_aa | rplE | 50S ribosomal protein L5 |
| 3711 | QEPS01000006.1 | GCA003252925_01884 | CDS | open | 64978-65268 | _na 96_aa | rpsN | 30S ribosomal protein S14 |
| 3712 | QEPS01000006.1 | GCA003252925_01885 | CDS | open | 65305-65697 | _na 130_aa | rpsH | 30S ribosomal protein S8 |
| 3713 | QEPS01000006.1 | GCA003252925_01886 | CDS | open | 65714-66247 | _na 177_aa | rplF | 50S ribosomal protein L6 |
| 3714 | QEPS01000006.1 | GCA003252925_01887 | CDS | open | 66262-66615 | _na 117_aa | rplR | 50S ribosomal protein L18 |
| 3715 | QEPS01000006.1 | GCA003252925_01888 | CDS | open | 66630-67130 | _na 166_aa | rpsE | 30S ribosomal protein S5 |
| 3716 | QEPS01000006.1 | GCA003252925_01889 | CDS | open | 67137-67313 | _na 58_aa | rpmD | 50S ribosomal protein L30 |
| 3717 | QEPS01000006.1 | GCA003252925_01890 | CDS | open | 67318-67752 | _na 144_aa | rplO | 50S ribosomal protein L15 |
| 3718 | QEPS01000006.1 | GCA003252925_01891 | CDS | open | 67756-69081 | _na 441_aa | secY | preprotein translocase subunit SecY |
| 3719 | QEPS01000006.1 | GCA003252925_01892 | CDS | open | 69102-69215 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 3720 | QEPS01000006.1 | GCA003252925_01893 | CDS | open | 69351-69707 | _na 118_aa | rpsM | 30S ribosomal protein S13 |
| 3721 | QEPS01000006.1 | GCA003252925_01894 | CDS | open | 69723-70112 | _na 129_aa | rpsK | 30S ribosomal protein S11 |
| 3722 | QEPS01000006.1 | GCA003252925_01895 | CDS | open | 70141-70767 | _na 208_aa | rpsD | 30S ribosomal protein S4 |
| 3723 | QEPS01000006.1 | GCA003252925_01896 | CDS | open | 70832-71821 | _na 329_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 3724 | QEPS01000006.1 | GCA003252925_01897 | CDS | open | 71858-72241 | _na 127_aa | rplQ | 50S ribosomal protein L17 |
| 3725 | QEPS01000006.1 | GCA003252925_01898 | CDS | open | 72425-73012 | _na 195_aa | FMN dependent NADH:quinone oxidoreductase | |
| 3726 | QEPS01000006.1 | GCA003252925_01899 | CDS | open | 73164-74219 | _na 351_aa | citC | [citrate (pro-3S)-lyase] ligase |
| 3727 | QEPS01000006.1 | GCA003252925_01900 | CDS | open | 74237-74911 | _na 224_aa | phosphoglycolate phosphatase | |
| 3728 | QEPS01000006.1 | GCA003252925_01905 | CDS | open | 75587-75913 | _na 108_aa | PF04175 family protein | |
| 3729 | QEPS01000006.1 | GCA003252925_01906 | CDS | open | 75939-76958 | _na 339_aa | hemB | porphobilinogen synthase |
| 3730 | QEPS01000006.1 | GCA003252925_01907 | CDS | open | 77054-77806 | _na 250_aa | tatC | twin-arginine translocase subunit TatC |
| 3731 | QEPS01000006.1 | GCA003252925_01908 | CDS | open | 77793-78404 | _na 203_aa | tatB | Sec-independent protein translocase protein TatB |
| 3732 | QEPS01000006.1 | GCA003252925_01909 | CDS | open | 78408-78632 | _na 74_aa | tatA | Sec-independent protein translocase subunit TatA |
| 3733 | QEPS01000006.1 | GCA003252925_01910 | CDS | open | 78984-79937 | _na 317_aa | corA | magnesium/cobalt transporter CorA |
| 3734 | QEPS01000006.1 | GCA003252925_01911 | CDS | open | 80053-80394 | _na 113_aa | erpA | iron-sulfur cluster insertion protein ErpA |
| 3735 | QEPS01000006.1 | GCA003252925_01912 | CDS | open | 80557-81681 | _na 374_aa | wzzB | LPS O-antigen chain length determinant protein WzzB |
| 3736 | QEPS01000006.1 | GCA003252925_01913 | CDS | open | 81686-82486 | _na 266_aa | DUF4422 domain-containing protein | |
| 3737 | QEPS01000006.1 | GCA003252925_01914 | CDS | open | 82501-83583 | _na 360_aa | Putative UDP-galactose--lipooligosaccharide galactosyltransferase | |
| 3738 | QEPS01000006.1 | GCA003252925_01915 | CDS | open | 83573-84616 | _na 347_aa | glycosyltransferase family 2 protein | |
| 3739 | QEPS01000006.1 | GCA003252925_01916 | CDS | open | 84639-85688 | _na 349_aa | sugar transferase | |
| 3740 | QEPS01000006.1 | GCA003252925_01917 | CDS | open | 85698-87005 | _na 435_aa | O-antigen polymerase | |
| 3741 | QEPS01000006.1 | GCA003252925_01918 | CDS | open | 87054-88481 | _na 475_aa | O-antigen transporter | |
| 3742 | QEPS01000006.1 | GCA003252925_01919 | CDS | open | 88500-89600 | _na 366_aa | glf | UDP-galactopyranose mutase |
| 3743 | QEPS01000006.1 | GCA003252925_01920 | CDS | open | 89622-90932 | _na 436_aa | sugar transferase | |
| 3744 | QEPS01000006.1 | GCA003252925_01921 | CDS | open | 91212-92246 | _na 344_aa | acyltransferase | |
| 3745 | QEPS01000006.1 | GCA003252925_01922 | CDS | open | 92416-93477 | _na 353_aa | rffG | dTDP-glucose 4%2C6-dehydratase |
| 3746 | QEPS01000006.1 | GCA003252925_01923 | CDS | open | 93580-94806 | _na 408_aa | nlpD | murein hydrolase activator NlpD |
| 3747 | QEPS01000006.1 | GCA003252925_01924 | CDS | open | 94839-95036 | _na 65_aa | Lipoprotein | |
| 3748 | QEPS01000006.1 | GCA003252925_01925 | CDS | open | 95049-95555 | _na 168_aa | Lipoprotein | |
| 3749 | QEPS01000006.1 | GCA003252925_01926 | CDS | open | 95651-96235 | _na 194_aa | Membrane lipoprotein B | |
| 3750 | QEPS01000006.1 | GCA003252925_01927 | CDS | open | 96252-97028 | _na 258_aa | surE | 5'/3'-nucleotidase SurE |
| 3751 | QEPS01000006.1 | GCA003252925_01928 | CDS | open | 97036-98049 | _na 337_aa | truD | tRNA pseudouridine(13) synthase TruD |
| 3752 | QEPS01000006.1 | GCA003252925_01929 | CDS | open | 98229-99320 | _na 363_aa | ychF | redox-regulated ATPase YchF |
| 3753 | QEPS01000006.1 | GCA003252925_01930 | CDS | open | 99408-99992 | _na 194_aa | pth | aminoacyl-tRNA hydrolase |
| 3754 | QEPS01000006.1 | GCA003252925_01931 | CDS | open | 100115-100672 | _na 185_aa | Integral membrane protein | |
| 3755 | QEPS01000006.1 | GCA003252925_01932 | CDS | open | 100715-101023 | _na 102_aa | rsaL | DNA-binding protein%2C virulence gene repressor RsaL |
| 3756 | QEPS01000006.1 | GCA003252925_01933 | CDS | open | 101020-101367 | _na 115_aa | PF06296 family protein | |
| 3757 | QEPS01000006.1 | GCA003252925_01934 | CDS | open | 101474-102811 | _na 445_aa | srmB | ATP-dependent RNA helicase SrmB |
| 3758 | QEPS01000006.1 | GCA003252925_01935 | CDS | open | 102974-104047 | _na 357_aa | wecA | UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase |
| 3759 | QEPS01000006.1 | GCA003252925_01936 | CDS | open | 104281-105561 | _na 426_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 3760 | QEPS01000006.1 | GCA003252925_01937 | CDS | open | 105592-105909 | _na 105_aa | hypothetical protein | |
| 3761 | QEPS01000006.1 | GCA003252925_01938 | CDS | open | 106027-106296 | _na 89_aa | Macro domain-containing protein | |
| 3762 | QEPS01000006.1 | GCA003252925_01939 | CDS | open | 106354-106692 | _na 112_aa | XRE family transcriptional regulator | |
| 3763 | QEPS01000006.1 | GCA003252925_01940 | CDS | open | 106827-107099 | _na 90_aa | bamE | Outer membrane protein assembly factor BamE |
| 3764 | QEPS01000006.1 | GCA003252925_01941 | CDS | open | 107125-107490 | _na 121_aa | bamE | Outer membrane protein assembly factor BamE |
| 3765 | QEPS01000006.1 | GCA003252925_01942 | CDS | open | 107505-107804 | _na 99_aa | hypothetical protein | |
| 3766 | QEPS01000006.1 | GCA003252925_01943 | CDS | open | 107967-108215 | _na 82_aa | rpsP | 30S ribosomal protein S16 |
| 3767 | QEPS01000006.1 | GCA003252925_01944 | CDS | open | 108262-108789 | _na 175_aa | rimM | ribosome maturation factor RimM |
| 3768 | QEPS01000006.1 | GCA003252925_01945 | CDS | open | 108848-109603 | _na 251_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 3769 | QEPS01000006.1 | GCA003252925_01946 | CDS | open | 109629-109979 | _na 116_aa | rplS | 50S ribosomal protein L19 |
| 3770 | QEPS01000006.1 | GCA003252925_01947 | CDS | open | 110161-112182 | _na 673_aa | Adhesin | |
| 3771 | QEPS01000006.1 | GCA003252925_01948 | CDS | open | 112201-113535 | _na 444_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 3772 | QEPS01000006.1 | GCA003252925_01949 | CDS | open | 113681-114379 | _na 232_aa | mtnN | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase |
| 3773 | QEPS01000006.1 | GCA003252925_01950 | CDS | open | 114369-115079 | _na 236_aa | dsbA | Thiol:disulfide interchange protein DsbA |
| 3774 | QEPS01000006.1 | GCA003252925_01951 | CDS | open | 115104-115736 | _na 210_aa | mog | molybdopterin adenylyltransferase |
| 3775 | QEPS01000006.1 | GCA003252925_01952 | CDS | open | 115926-116840 | _na 304_aa | ccmI | Cytochrome c-type biogenesis protein CcmI |
| 3776 | QEPS01000006.1 | GCA003252925_01953 | CDS | open | 116844-117308 | _na 154_aa | Cytochrome c-type biogenesis protein | |
| 3777 | QEPS01000006.1 | GCA003252925_01954 | CDS | open | 117331-117876 | _na 181_aa | dsbE | Thiol:disulfide interchange protein DsbE |
| 3778 | QEPS01000006.1 | GCA003252925_01955 | CDS | open | 117945-118895 | _na 316_aa | coaA | type I pantothenate kinase |
| 3779 | QEPS01000006.1 | GCA003252925_01816 | gene | open | 366-515 | |||
| 3780 | QEPS01000006.1 | GCA003252925_01817 | gene | open | 524-739 | |||
| 3781 | QEPS01000006.1 | GCA003252925_01818 | gene | open | 815-1444 | |||
| 3782 | QEPS01000006.1 | GCA003252925_01819 | gene | open | 1549-4155 | mutS | ||
| 3783 | QEPS01000006.1 | GCA003252925_01820 | gene | open | 4380-4694 | rsfS | ||
| 3784 | QEPS01000006.1 | GCA003252925_01821 | gene | open | 4696-5163 | rlmH | ||
| 3785 | QEPS01000006.1 | GCA003252925_01822 | gene | open | 5212-7194 | mrdA | ||
| 3786 | QEPS01000006.1 | GCA003252925_01823 | gene | open | 7187-8314 | rodA | ||
| 3787 | QEPS01000006.1 | GCA003252925_01824 | gene | open | 8550-9140 | rlpA | ||
| 3788 | QEPS01000006.1 | GCA003252925_01825 | gene | open | 9248-10426 | |||
| 3789 | QEPS01000006.1 | GCA003252925_01826 | gene | open | 10540-10836 | ybeD | ||
| 3790 | QEPS01000006.1 | GCA003252925_01827 | gene | open | 10929-11603 | lipB | ||
| 3791 | QEPS01000006.1 | GCA003252925_01828 | gene | open | 11603-12592 | lipA | ||
| 3792 | QEPS01000006.1 | GCA003252925_01829 | gene | open | 12786-14246 | tldD | ||
| 3793 | QEPS01000006.1 | GCA003252925_01830 | gene | open | 14250-15068 | |||
| 3794 | QEPS01000006.1 | GCA003252925_01831 | gene | open | 15058-15432 | |||
| 3795 | QEPS01000006.1 | GCA003252925_01832 | gene | open | 15467-15796 | azlD | ||
| 3796 | QEPS01000006.1 | GCA003252925_01833 | gene | open | 15793-16638 | azlC | ||
| 3797 | QEPS01000006.1 | GCA003252925_01834 | gene | open | 16756-17637 | prmA | ||
| 3798 | QEPS01000006.1 | GCA003252925_01835 | gene | open | 17692-18660 | |||
| 3799 | QEPS01000006.1 | GCA003252925_01836 | gene | open | 18878-19732 | |||
| 3800 | QEPS01000006.1 | GCA003252925_01837 | gene | open | 20165-20911 | ulaR | ||
| 3801 | QEPS01000006.1 | GCA003252925_01838 | gene | open | 21602-23386 | |||
| 3802 | QEPS01000006.1 | GCA003252925_01839 | gene | open | 23465-23932 | |||
| 3803 | QEPS01000006.1 | GCA003252925_01840 | gene | open | 24092-24454 | fluC | ||
| 3804 | QEPS01000006.1 | GCA003252925_01841 | gene | open | 24462-25466 | |||
| 3805 | QEPS01000006.1 | GCA003252925_01842 | gene | open | 25539-25760 | |||
| 3806 | QEPS01000006.1 | GCA003252925_01843 | gene | open | 25845-26561 | fkpA | ||
| 3807 | QEPS01000006.1 | GCA003252925_01844 | gene | open | 26653-27327 | |||
| 3808 | QEPS01000006.1 | GCA003252925_01845 | gene | open | 27327-27680 | tusD | ||
| 3809 | QEPS01000006.1 | GCA003252925_01846 | gene | open | 27682-28050 | tusC | ||
| 3810 | QEPS01000006.1 | GCA003252925_01847 | gene | open | 28061-28327 | tusB | ||
| 3811 | QEPS01000006.1 | GCA003252925_01848 | gene | open | 28329-29357 | fmt | ||
| 3812 | QEPS01000006.1 | GCA003252925_01849 | gene | open | 29601-30209 | sirA | ||
| 3813 | QEPS01000006.1 | GCA003252925_01850 | gene | open | 30214-31692 | |||
| 3814 | QEPS01000006.1 | GCA003252925_01851 | gene | open | 31695-32225 | hemG | ||
| 3815 | QEPS01000006.1 | GCA003252925_01852 | gene | open | 32320-32718 | mscL | ||
| 3816 | QEPS01000006.1 | GCA003252925_01853 | gene | open | 33392-35185 | frdA | ||
| 3817 | QEPS01000006.1 | GCA003252925_01854 | gene | open | 35195-35920 | sdhB | ||
| 3818 | QEPS01000006.1 | GCA003252925_01855 | gene | open | 35930-36316 | frdC | ||
| 3819 | QEPS01000006.1 | GCA003252925_01856 | gene | open | 36326-36682 | frdD | ||
| 3820 | QEPS01000006.1 | GCA003252925_01857 | gene | open | 36850-37077 | |||
| 3821 | QEPS01000006.1 | GCA003252925_01858 | gene | open | 37188-38171 | epmA | ||
| 3822 | QEPS01000006.1 | GCA003252925_01859 | gene | open | 38262-38372 | lptM | ||
| 3823 | QEPS01000006.1 | GCA003252925_01860 | gene | open | 38423-39670 | lysA | ||
| 3824 | QEPS01000006.1 | GCA003252925_01861 | gene | open | 39911-41911 | |||
| 3825 | QEPS01000006.1 | GCA003252925_01862 | gene | open | 42246-43640 | fumC | ||
| 3826 | QEPS01000006.1 | GCA003252925_01863 | gene | open | 43740-44666 | rfaD | ||
| 3827 | QEPS01000006.1 | GCA003252925_01864 | gene | open | 45036-45548 | def | ||
| 3828 | QEPS01000006.1 | GCA003252925_01865 | gene | open | 45650-46795 | dprA | ||
| 3829 | QEPS01000006.1 | GCA003252925_01866 | gene | open | 46916-47320 | secE | ||
| 3830 | QEPS01000006.1 | GCA003252925_01867 | gene | open | 47332-47901 | nusG | ||
| 3831 | QEPS01000006.1 | GCA003252925_01868 | gene | open | 48125-48553 | rplK | ||
| 3832 | QEPS01000006.1 | GCA003252925_01869 | gene | open | 48558-49247 | rplA | ||
| 3833 | QEPS01000006.1 | GCA003252925_01870 | gene | open | 49336-49641 | |||
| 3834 | QEPS01000006.1 | GCA003252925_01871 | gene | open | 49641-51956 | |||
| 3835 | QEPS01000006.1 | GCA003252925_01872 | gene | open | 51977-52654 | |||
| 3836 | QEPS01000006.1 | GCA003252925_01873 | gene | open | 53120-54292 | |||
| 3837 | QEPS01000006.1 | GCA003252925_01874 | gene | open | 54571-56133 | |||
| 3838 | QEPS01000006.1 | GCA003252925_01875 | gene | open | 56307-57974 | dcuB | ||
| 3839 | QEPS01000006.1 | GCA003252925_01876 | gene | open | 58322-58816 | rplJ | ||
| 3840 | QEPS01000006.1 | GCA003252925_01877 | gene | open | 58871-59239 | rplL | ||
| 3841 | QEPS01000006.1 | GCA003252925_01878 | gene | open | 59402-60640 | |||
| 3842 | QEPS01000006.1 | GCA003252925_01879 | gene | open | 60653-62047 | |||
| 3843 | QEPS01000006.1 | GCA003252925_01880 | gene | open | 62058-63455 | |||
| 3844 | QEPS01000006.1 | GCA003252925_01881 | gene | open | 63699-64070 | rplN | ||
| 3845 | QEPS01000006.1 | GCA003252925_01882 | gene | open | 64081-64392 | rplX | ||
| 3846 | QEPS01000006.1 | GCA003252925_01883 | gene | open | 64412-64951 | rplE | ||
| 3847 | QEPS01000006.1 | GCA003252925_01884 | gene | open | 64978-65268 | rpsN | ||
| 3848 | QEPS01000006.1 | GCA003252925_01885 | gene | open | 65305-65697 | rpsH | ||
| 3849 | QEPS01000006.1 | GCA003252925_01886 | gene | open | 65714-66247 | rplF | ||
| 3850 | QEPS01000006.1 | GCA003252925_01887 | gene | open | 66262-66615 | rplR | ||
| 3851 | QEPS01000006.1 | GCA003252925_01888 | gene | open | 66630-67130 | rpsE | ||
| 3852 | QEPS01000006.1 | GCA003252925_01889 | gene | open | 67137-67313 | rpmD | ||
| 3853 | QEPS01000006.1 | GCA003252925_01890 | gene | open | 67318-67752 | rplO | ||
| 3854 | QEPS01000006.1 | GCA003252925_01891 | gene | open | 67756-69081 | secY | ||
| 3855 | QEPS01000006.1 | GCA003252925_01892 | gene | open | 69102-69215 | rpmJ | ||
| 3856 | QEPS01000006.1 | GCA003252925_01893 | gene | open | 69351-69707 | rpsM | ||
| 3857 | QEPS01000006.1 | GCA003252925_01894 | gene | open | 69723-70112 | rpsK | ||
| 3858 | QEPS01000006.1 | GCA003252925_01895 | gene | open | 70141-70767 | rpsD | ||
| 3859 | QEPS01000006.1 | GCA003252925_01896 | gene | open | 70832-71821 | rpoA | ||
| 3860 | QEPS01000006.1 | GCA003252925_01897 | gene | open | 71858-72241 | rplQ | ||
| 3861 | QEPS01000006.1 | GCA003252925_01898 | gene | open | 72425-73012 | |||
| 3862 | QEPS01000006.1 | GCA003252925_01899 | gene | open | 73164-74219 | citC | ||
| 3863 | QEPS01000006.1 | GCA003252925_01900 | gene | open | 74237-74911 | |||
| 3864 | QEPS01000006.1 | GCA003252925_01905 | gene | open | 75587-75913 | |||
| 3865 | QEPS01000006.1 | GCA003252925_01906 | gene | open | 75939-76958 | hemB | ||
| 3866 | QEPS01000006.1 | GCA003252925_01907 | gene | open | 77054-77806 | tatC | ||
| 3867 | QEPS01000006.1 | GCA003252925_01908 | gene | open | 77793-78404 | tatB | ||
| 3868 | QEPS01000006.1 | GCA003252925_01909 | gene | open | 78408-78632 | tatA | ||
| 3869 | QEPS01000006.1 | GCA003252925_01910 | gene | open | 78984-79937 | corA | ||
| 3870 | QEPS01000006.1 | GCA003252925_01911 | gene | open | 80053-80394 | erpA | ||
| 3871 | QEPS01000006.1 | GCA003252925_01912 | gene | open | 80557-81681 | wzzB | ||
| 3872 | QEPS01000006.1 | GCA003252925_01913 | gene | open | 81686-82486 | |||
| 3873 | QEPS01000006.1 | GCA003252925_01914 | gene | open | 82501-83583 | |||
| 3874 | QEPS01000006.1 | GCA003252925_01915 | gene | open | 83573-84616 | |||
| 3875 | QEPS01000006.1 | GCA003252925_01916 | gene | open | 84639-85688 | |||
| 3876 | QEPS01000006.1 | GCA003252925_01917 | gene | open | 85698-87005 | |||
| 3877 | QEPS01000006.1 | GCA003252925_01918 | gene | open | 87054-88481 | |||
| 3878 | QEPS01000006.1 | GCA003252925_01919 | gene | open | 88500-89600 | glf | ||
| 3879 | QEPS01000006.1 | GCA003252925_01920 | gene | open | 89622-90932 | |||
| 3880 | QEPS01000006.1 | GCA003252925_01921 | gene | open | 91212-92246 | |||
| 3881 | QEPS01000006.1 | GCA003252925_01922 | gene | open | 92416-93477 | rffG | ||
| 3882 | QEPS01000006.1 | GCA003252925_01923 | gene | open | 93580-94806 | nlpD | ||
| 3883 | QEPS01000006.1 | GCA003252925_01924 | gene | open | 94839-95036 | |||
| 3884 | QEPS01000006.1 | GCA003252925_01925 | gene | open | 95049-95555 | |||
| 3885 | QEPS01000006.1 | GCA003252925_01926 | gene | open | 95651-96235 | |||
| 3886 | QEPS01000006.1 | GCA003252925_01927 | gene | open | 96252-97028 | surE | ||
| 3887 | QEPS01000006.1 | GCA003252925_01928 | gene | open | 97036-98049 | truD | ||
| 3888 | QEPS01000006.1 | GCA003252925_01929 | gene | open | 98229-99320 | ychF | ||
| 3889 | QEPS01000006.1 | GCA003252925_01930 | gene | open | 99408-99992 | pth | ||
| 3890 | QEPS01000006.1 | GCA003252925_01931 | gene | open | 100115-100672 | |||
| 3891 | QEPS01000006.1 | GCA003252925_01932 | gene | open | 100715-101023 | rsaL | ||
| 3892 | QEPS01000006.1 | GCA003252925_01933 | gene | open | 101020-101367 | |||
| 3893 | QEPS01000006.1 | GCA003252925_01934 | gene | open | 101474-102811 | srmB | ||
| 3894 | QEPS01000006.1 | GCA003252925_01935 | gene | open | 102974-104047 | wecA | ||
| 3895 | QEPS01000006.1 | GCA003252925_01936 | gene | open | 104281-105561 | hemL | ||
| 3896 | QEPS01000006.1 | GCA003252925_01937 | gene | open | 105592-105909 | |||
| 3897 | QEPS01000006.1 | GCA003252925_01938 | gene | open | 106027-106296 | |||
| 3898 | QEPS01000006.1 | GCA003252925_01939 | gene | open | 106354-106692 | |||
| 3899 | QEPS01000006.1 | GCA003252925_01940 | gene | open | 106827-107099 | bamE | ||
| 3900 | QEPS01000006.1 | GCA003252925_01941 | gene | open | 107125-107490 | bamE | ||
| 3901 | QEPS01000006.1 | GCA003252925_01942 | gene | open | 107505-107804 | |||
| 3902 | QEPS01000006.1 | GCA003252925_01943 | gene | open | 107967-108215 | rpsP | ||
| 3903 | QEPS01000006.1 | GCA003252925_01944 | gene | open | 108262-108789 | rimM | ||
| 3904 | QEPS01000006.1 | GCA003252925_01945 | gene | open | 108848-109603 | trmD | ||
| 3905 | QEPS01000006.1 | GCA003252925_01946 | gene | open | 109629-109979 | rplS | ||
| 3906 | QEPS01000006.1 | GCA003252925_01947 | gene | open | 110161-112182 | |||
| 3907 | QEPS01000006.1 | GCA003252925_01948 | gene | open | 112201-113535 | rimO | ||
| 3908 | QEPS01000006.1 | GCA003252925_01949 | gene | open | 113681-114379 | mtnN | ||
| 3909 | QEPS01000006.1 | GCA003252925_01950 | gene | open | 114369-115079 | dsbA | ||
| 3910 | QEPS01000006.1 | GCA003252925_01951 | gene | open | 115104-115736 | mog | ||
| 3911 | QEPS01000006.1 | GCA003252925_01952 | gene | open | 115926-116840 | ccmI | ||
| 3912 | QEPS01000006.1 | GCA003252925_01953 | gene | open | 116844-117308 | |||
| 3913 | QEPS01000006.1 | GCA003252925_01954 | gene | open | 117331-117876 | dsbE | ||
| 3914 | QEPS01000006.1 | GCA003252925_01955 | gene | open | 117945-118895 | coaA | ||
| 3915 | QEPS01000006.1 | GCA003252925_01901 | gene | open | 75081-75167 | trnL | ||
| 3916 | QEPS01000006.1 | GCA003252925_01902 | gene | open | 75187-75262 | trnG | ||
| 3917 | QEPS01000006.1 | GCA003252925_01903 | gene | open | 75274-75360 | trnL | ||
| 3918 | QEPS01000006.1 | GCA003252925_01904 | gene | open | 75379-75454 | trnG | ||
| 3919 | QEPS01000006.1 | GCA003252925_01956 | gene | open | 119140-119215 | trnT | ||
| 3920 | QEPS01000006.1 | GCA003252925_01957 | gene | open | 119251-119335 | trnY | ||
| 3921 | QEPS01000006.1 | GCA003252925_01958 | gene | open | 119380-119454 | trnG | ||
| 3922 | QEPS01000006.1 | GCA003252925_01959 | gene | open | 119458-119533 | trnT | ||
| 3923 | QEPS01000006.1 | GCA003252925_01901 | tRNA | open | 75081-75167 | trnL | tRNA-Leu(taa) | |
| 3924 | QEPS01000006.1 | GCA003252925_01902 | tRNA | open | 75187-75262 | trnG | tRNA-Gly(gcc) | |
| 3925 | QEPS01000006.1 | GCA003252925_01903 | tRNA | open | 75274-75360 | trnL | tRNA-Leu(taa) | |
| 3926 | QEPS01000006.1 | GCA003252925_01904 | tRNA | open | 75379-75454 | trnG | tRNA-Gly(gcc) | |
| 3927 | QEPS01000006.1 | GCA003252925_01956 | tRNA | open | 119140-119215 | trnT | tRNA-Thr(tgt) | |
| 3928 | QEPS01000006.1 | GCA003252925_01957 | tRNA | open | 119251-119335 | trnY | tRNA-Tyr(gta) | |
| 3929 | QEPS01000006.1 | GCA003252925_01958 | tRNA | open | 119380-119454 | trnG | tRNA-Gly(tcc) | |
| 3930 | QEPS01000006.1 | GCA003252925_01959 | tRNA | open | 119458-119533 | trnT | tRNA-Thr(ggt) | |
| 3931 | QEPS01000007.1 | GCA003252925_01960 | gene | open | 11-126 | rrf | ||
| 3932 | QEPS01000007.1 | GCA003252925_01960 | rRNA | open | 11-126 | rrf | 5S ribosomal RNA | |
| 3933 | QEPS01000007.1 | repeat_region | open | 23795-24494 | CRISPR array with 10 repeats of length 36%2C consensus sequence TTTCAATCCCTTTGGAACAGGGCAGTGTCTTACGAC and spacer length 37 | |||
| 3934 | QEPS01000007.1 | GCA003252925_01961 | CDS | open | 356-673 | _na 105_aa | hypothetical protein | |
| 3935 | QEPS01000007.1 | GCA003252925_01962 | CDS | open | 801-1094 | _na 97_aa | hypothetical protein | |
| 3936 | QEPS01000007.1 | GCA003252925_01963 | CDS | open | 1301-2899 | _na 532_aa | dppA | Periplasmic dipeptide transport protein DppA |
| 3937 | QEPS01000007.1 | GCA003252925_01964 | CDS | open | 3028-4032 | _na 334_aa | dppB | Dipeptide transport system permease DppB |
| 3938 | QEPS01000007.1 | GCA003252925_01965 | CDS | open | 4049-4939 | _na 296_aa | dppC | Dipeptide ABC transporter%2C permease protein DppC |
| 3939 | QEPS01000007.1 | GCA003252925_01966 | CDS | open | 4949-5926 | _na 325_aa | dppD | dipeptide ABC transporter ATP-binding protein |
| 3940 | QEPS01000007.1 | GCA003252925_01967 | CDS | open | 5943-6923 | _na 326_aa | Dipeptide transporter ATP-binding protein | |
| 3941 | QEPS01000007.1 | GCA003252925_01968 | CDS | open | 7032-8075 | _na 347_aa | ADP-heptose--lipooligosaccharide heptosyltransferase I | |
| 3942 | QEPS01000007.1 | GCA003252925_01969 | CDS | open | 8139-9257 | _na 372_aa | tyrA | bifunctional chorismate mutase/prephenate dehydrogenase |
| 3943 | QEPS01000007.1 | GCA003252925_01970 | CDS | open | 9307-9582 | _na 91_aa | Deoxyribose-phosphate aldolase | |
| 3944 | QEPS01000007.1 | GCA003252925_01971 | CDS | open | 9605-10069 | _na 154_aa | Outer membrane lipoprotein pcp | |
| 3945 | QEPS01000007.1 | GCA003252925_01972 | CDS | open | 10093-10698 | _na 201_aa | VOC family protein | |
| 3946 | QEPS01000007.1 | GCA003252925_01973 | CDS | open | 10729-12456 | _na 575_aa | argS | arginine--tRNA ligase |
| 3947 | QEPS01000007.1 | GCA003252925_01974 | CDS | open | 12596-13774 | _na 392_aa | cgtA | Obg family GTPase CgtA |
| 3948 | QEPS01000007.1 | GCA003252925_01975 | CDS | open | 13838-14449 | _na 203_aa | Glucose-6-phosphate 1-dehydrogenase | |
| 3949 | QEPS01000007.1 | GCA003252925_01976 | CDS | open | 14501-15778 | _na 425_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 3950 | QEPS01000007.1 | GCA003252925_01977 | CDS | open | 15946-16239 | _na 97_aa | bolA | BolA family transcriptional regulator |
| 3951 | QEPS01000007.1 | GCA003252925_01978 | CDS | open | 16223-16576 | _na 117_aa | Anti-anti-sigma factor | |
| 3952 | QEPS01000007.1 | GCA003252925_01979 | CDS | open | 16581-17222 | _na 213_aa | mlaC | phospholipid-binding protein MlaC |
| 3953 | QEPS01000007.1 | GCA003252925_01980 | CDS | open | 17303-17830 | _na 175_aa | mlaD | outer membrane lipid asymmetry maintenance protein MlaD |
| 3954 | QEPS01000007.1 | GCA003252925_01981 | CDS | open | 17855-18631 | _na 258_aa | mlaE | lipid asymmetry maintenance ABC transporter permease subunit MlaE |
| 3955 | QEPS01000007.1 | GCA003252925_01982 | CDS | open | 18624-19427 | _na 267_aa | mlaF | phospholipid ABC transporter ATP-binding protein MlaF |
| 3956 | QEPS01000007.1 | GCA003252925_01983 | CDS | open | 19687-21102 | _na 471_aa | degQ | Protease DegQ |
| 3957 | QEPS01000007.1 | GCA003252925_01984 | CDS | open | 21284-21736 | _na 150_aa | UPF0756 membrane protein HMPREF1054_1082 | |
| 3958 | QEPS01000007.1 | GCA003252925_01985 | CDS | open | 21861-23717 | _na 618_aa | Glutathione-regulated potassium-efflux system protein | |
| 3959 | QEPS01000007.1 | GCA003252925_01986 | CDS | open | 24732-25016 | _na 94_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3960 | QEPS01000007.1 | GCA003252925_01987 | CDS | open | 25025-26095 | _na 356_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 3961 | QEPS01000007.1 | GCA003252925_01988 | CDS | open | 26104-26388 | _na 94_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3962 | QEPS01000007.1 | GCA003252925_01989 | CDS | open | 28001-29161 | _na 386_aa | csm6 | CRISPR-associated ring nuclease Csm6 |
| 3963 | QEPS01000007.1 | GCA003252925_01990 | CDS | open | 29170-30342 | _na 390_aa | Card1 endonuclease domain-containing protein | |
| 3964 | QEPS01000007.1 | GCA003252925_01991 | CDS | open | 30352-30642 | _na 96_aa | CRISPR-associated protein Csx16 | |
| 3965 | QEPS01000007.1 | GCA003252925_01992 | CDS | open | 30701-31621 | _na 306_aa | CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 | |
| 3966 | QEPS01000007.1 | GCA003252925_01993 | CDS | open | 31621-33174 | _na 517_aa | CRISPR system Cms protein Csm5 | |
| 3967 | QEPS01000007.1 | GCA003252925_01994 | CDS | open | 33171-34109 | _na 312_aa | csm4 | type III-A CRISPR-associated RAMP protein Csm4 |
| 3968 | QEPS01000007.1 | GCA003252925_01995 | CDS | open | 34119-34811 | _na 230_aa | csm3 | type III-A CRISPR-associated RAMP protein Csm3 |
| 3969 | QEPS01000007.1 | GCA003252925_01996 | CDS | open | 34828-35217 | _na 129_aa | CRISPR system Cms protein Csm2 | |
| 3970 | QEPS01000007.1 | GCA003252925_01997 | CDS | open | 35227-37398 | _na 723_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 3971 | QEPS01000007.1 | GCA003252925_01998 | CDS | open | 37530-38885 | _na 451_aa | qseC | quorum sensing histidine kinase QseC |
| 3972 | QEPS01000007.1 | GCA003252925_01999 | CDS | open | 38917-39576 | _na 219_aa | qseC | DNA-binding response regulator in two-component regulatory system with QseC |
| 3973 | QEPS01000007.1 | GCA003252925_02000 | CDS | open | 39646-40014 | _na 122_aa | Putative outer membrane protein | |
| 3974 | QEPS01000007.1 | GCA003252925_02001 | CDS | open | 40095-40463 | _na 122_aa | YgiW/YdeI family stress tolerance OB fold protein | |
| 3975 | QEPS01000007.1 | GCA003252925_02002 | CDS | open | 40618-41358 | _na 246_aa | tACO1 | YebC/PmpR family DNA-binding transcriptional regulator |
| 3976 | QEPS01000007.1 | GCA003252925_02003 | CDS | open | 41413-41856 | _na 147_aa | nudB | dihydroneopterin triphosphate diphosphatase |
| 3977 | QEPS01000007.1 | GCA003252925_02004 | CDS | open | 42007-43383 | _na 458_aa | argH | argininosuccinate lyase |
| 3978 | QEPS01000007.1 | GCA003252925_02005 | CDS | open | 43738-44367 | _na 209_aa | Metallo-beta-lactamase domain protein | |
| 3979 | QEPS01000007.1 | GCA003252925_02006 | CDS | open | 44392-44949 | _na 185_aa | PF05951 family protein | |
| 3980 | QEPS01000007.1 | GCA003252925_02007 | CDS | open | 45257-46837 | _na 526_aa | L%2CD-transpeptidase | |
| 3981 | QEPS01000007.1 | GCA003252925_02008 | CDS | open | 46919-48940 | _na 673_aa | prc | carboxy terminal-processing peptidase |
| 3982 | QEPS01000007.1 | GCA003252925_02009 | CDS | open | 49016-49570 | _na 184_aa | proQ | RNA chaperone ProQ |
| 3983 | QEPS01000007.1 | GCA003252925_02010 | CDS | open | 49893-50105 | _na 70_aa | cspC | Cold shock-like protein CspC |
| 3984 | QEPS01000007.1 | GCA003252925_02011 | CDS | open | 50238-50651 | _na 137_aa | L-lactate permease | |
| 3985 | QEPS01000007.1 | GCA003252925_02012 | CDS | open | 50660-50968 | _na 102_aa | L-lactate permease | |
| 3986 | QEPS01000007.1 | GCA003252925_02013 | CDS | open | 50931-51212 | _na 93_aa | L-lactate permease | |
| 3987 | QEPS01000007.1 | GCA003252925_02014 | CDS | open | 51175-51864 | _na 229_aa | L-lactate permease | |
| 3988 | QEPS01000007.1 | GCA003252925_02015 | CDS | open | 52171-53697 | _na 508_aa | katA | Catalase |
| 3989 | QEPS01000007.1 | GCA003252925_02016 | CDS | open | 53766-54560 | _na 264_aa | tatD | TatD family deoxyribonuclease |
| 3990 | QEPS01000007.1 | GCA003252925_02017 | CDS | open | 54634-56823 | _na 729_aa | uvrD | DNA helicase II |
| 3991 | QEPS01000007.1 | GCA003252925_02018 | CDS | open | 57025-58020 | _na 331_aa | fbpA | Iron-utilization periplasmic protein |
| 3992 | QEPS01000007.1 | GCA003252925_02019 | CDS | open | 58137-59657 | _na 506_aa | Iron ABC transporter permease | |
| 3993 | QEPS01000007.1 | GCA003252925_02020 | CDS | open | 59659-60726 | _na 355_aa | Fe(3+)-transporting ATPase | |
| 3994 | QEPS01000007.1 | GCA003252925_02021 | CDS | open | 60774-61898 | _na 374_aa | alr | alanine racemase |
| 3995 | QEPS01000007.1 | GCA003252925_02022 | CDS | open | 62010-63971 | _na 653_aa | recD | exodeoxyribonuclease V subunit alpha |
| 3996 | QEPS01000007.1 | GCA003252925_01961 | gene | open | 356-673 | |||
| 3997 | QEPS01000007.1 | GCA003252925_01962 | gene | open | 801-1094 | |||
| 3998 | QEPS01000007.1 | GCA003252925_01963 | gene | open | 1301-2899 | dppA | ||
| 3999 | QEPS01000007.1 | GCA003252925_01964 | gene | open | 3028-4032 | dppB | ||
| 4000 | QEPS01000007.1 | GCA003252925_01965 | gene | open | 4049-4939 | dppC |

