BAKTAGenome Explorer: Aggregatibacter aphrophilus (GCA_003252955.1)
Select a Genome:
|
BAKTA Annotations for GCA_003252955.1
|
Search & Sort all 4435 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | QEPU01000003.1 | GCA003252955_01051 | CDS | open | 122785-123192 | _na 135_aa | PIN-like domain-containing protein | |
| 2002 | QEPU01000003.1 | GCA003252955_01052 | CDS | open | 123622-125163 | _na 513_aa | subtype B tannase | |
| 2003 | QEPU01000003.1 | GCA003252955_01053 | CDS | open | 125330-126697 | _na 455_aa | tdeA | toxin/drug exporter TdeA |
| 2004 | QEPU01000003.1 | GCA003252955_01054 | CDS | open | 126783-128717 | _na 644_aa | pvdT | Pyoverdine export ATP-binding/permease protein PvdT |
| 2005 | QEPU01000003.1 | GCA003252955_01055 | CDS | open | 128734-129918 | _na 394_aa | Efflux transporter periplasmic adaptor subunit | |
| 2006 | QEPU01000003.1 | GCA003252955_01056 | CDS | open | 130194-131873 | _na 559_aa | glnS | glutamine--tRNA ligase |
| 2007 | QEPU01000003.1 | GCA003252955_01057 | CDS | open | 131944-132387 | _na 147_aa | ycgN | YcgN family cysteine cluster protein |
| 2008 | QEPU01000003.1 | GCA003252955_01058 | CDS | open | 132479-134578 | _na 699_aa | malQ | 4-alpha-glucanotransferase |
| 2009 | QEPU01000003.1 | GCA003252955_01059 | CDS | open | 134591-136783 | _na 730_aa | glgB | 1%2C4-alpha-glucan branching protein GlgB |
| 2010 | QEPU01000003.1 | GCA003252955_01060 | CDS | open | 136873-138930 | _na 685_aa | glgX | glycogen debranching protein GlgX |
| 2011 | QEPU01000003.1 | GCA003252955_01061 | CDS | open | 138958-140268 | _na 436_aa | glgC | glucose-1-phosphate adenylyltransferase |
| 2012 | QEPU01000003.1 | GCA003252955_01062 | CDS | open | 140569-142008 | _na 479_aa | glgA | glycogen synthase GlgA |
| 2013 | QEPU01000003.1 | GCA003252955_01063 | CDS | open | 142131-144596 | _na 821_aa | Alpha-1%2C4 glucan phosphorylase | |
| 2014 | QEPU01000003.1 | GCA003252955_01064 | CDS | open | 144715-145650 | _na 311_aa | SCP domain-containing protein | |
| 2015 | QEPU01000003.1 | GCA003252955_01065 | CDS | open | 145785-146390 | _na 201_aa | dedA | DedA family membrane protein |
| 2016 | QEPU01000003.1 | GCA003252955_01066 | CDS | open | 146609-146896 | _na 95_aa | rplY | 50S ribosomal protein L25 |
| 2017 | QEPU01000003.1 | GCA003252955_01067 | CDS | open | 147040-147639 | _na 199_aa | hlpB | Lipoprotein HlpB |
| 2018 | QEPU01000003.1 | GCA003252955_01068 | CDS | open | 147726-148634 | _na 302_aa | D-alanyl-D-alanine endopeptidase | |
| 2019 | QEPU01000003.1 | GCA003252955_01069 | CDS | open | 148880-150202 | _na 440_aa | mukF | chromosome partition protein MukF |
| 2020 | QEPU01000003.1 | GCA003252955_01070 | CDS | open | 150231-150542 | _na 103_aa | hypothetical protein | |
| 2021 | QEPU01000003.1 | GCA003252955_01071 | CDS | open | 150553-154014 | _na 1153_aa | fucP | acyl-[ACP]--phospholipid O-acyltransferase |
| 2022 | QEPU01000003.1 | GCA003252955_01072 | CDS | open | 154035-154775 | _na 246_aa | mukE | chromosome partition protein MukE |
| 2023 | QEPU01000003.1 | GCA003252955_01073 | CDS | open | 154775-159268 | _na 1497_aa | mukB | chromosome partition protein MukB |
| 2024 | QEPU01000003.1 | GCA003252955_01074 | CDS | open | 159345-160217 | _na 290_aa | eamA | EamA domain-containing protein |
| 2025 | QEPU01000003.1 | GCA003252955_01075 | CDS | open | 160232-161656 | _na 474_aa | sbcB | exodeoxyribonuclease I |
| 2026 | QEPU01000003.1 | GCA003252955_00939 | gene | open | 1235-1888 | ribA | ||
| 2027 | QEPU01000003.1 | GCA003252955_00940 | gene | open | 1974-2705 | |||
| 2028 | QEPU01000003.1 | GCA003252955_00941 | gene | open | 2759-3673 | nagK | ||
| 2029 | QEPU01000003.1 | GCA003252955_00942 | gene | open | 3792-4595 | amsE | ||
| 2030 | QEPU01000003.1 | GCA003252955_00943 | gene | open | 4597-5727 | |||
| 2031 | QEPU01000003.1 | GCA003252955_00944 | gene | open | 5836-6624 | |||
| 2032 | QEPU01000003.1 | GCA003252955_00945 | gene | open | 6621-7364 | tagH | ||
| 2033 | QEPU01000003.1 | GCA003252955_00946 | gene | open | 7361-7717 | |||
| 2034 | QEPU01000003.1 | GCA003252955_00947 | gene | open | 7726-8655 | |||
| 2035 | QEPU01000003.1 | GCA003252955_00948 | gene | open | 8645-10768 | yfhO | ||
| 2036 | QEPU01000003.1 | GCA003252955_00949 | gene | open | 10749-12497 | glfT2 | ||
| 2037 | QEPU01000003.1 | GCA003252955_00950 | gene | open | 12517-13668 | glf | ||
| 2038 | QEPU01000003.1 | GCA003252955_00951 | gene | open | 13668-14591 | glfT1 | ||
| 2039 | QEPU01000003.1 | GCA003252955_00952 | gene | open | 14597-15361 | |||
| 2040 | QEPU01000003.1 | GCA003252955_00953 | gene | open | 15369-16781 | |||
| 2041 | QEPU01000003.1 | GCA003252955_00954 | gene | open | 16896-17699 | xthA | ||
| 2042 | QEPU01000003.1 | GCA003252955_00955 | gene | open | 17699-18490 | |||
| 2043 | QEPU01000003.1 | GCA003252955_00956 | gene | open | 18511-19560 | rfbB | ||
| 2044 | QEPU01000003.1 | GCA003252955_00957 | gene | open | 19694-20590 | |||
| 2045 | QEPU01000003.1 | GCA003252955_00959 | gene | open | 20759-21313 | |||
| 2046 | QEPU01000003.1 | GCA003252955_00960 | gene | open | 21455-23341 | sppA | ||
| 2047 | QEPU01000003.1 | GCA003252955_00961 | gene | open | 23384-24508 | tyrA | ||
| 2048 | QEPU01000003.1 | GCA003252955_00962 | gene | open | 24587-25210 | |||
| 2049 | QEPU01000003.1 | GCA003252955_00963 | gene | open | 25249-26226 | rluB | ||
| 2050 | QEPU01000003.1 | GCA003252955_00964 | gene | open | 26251-27222 | cysB | ||
| 2051 | QEPU01000003.1 | GCA003252955_00965 | gene | open | 27257-28084 | dapD | ||
| 2052 | QEPU01000003.1 | GCA003252955_00966 | gene | open | 28404-28817 | uraH | ||
| 2053 | QEPU01000003.1 | GCA003252955_00967 | gene | open | 29219-30076 | tehB | ||
| 2054 | QEPU01000003.1 | GCA003252955_00968 | gene | open | 30480-33137 | aceE | ||
| 2055 | QEPU01000003.1 | GCA003252955_00969 | gene | open | 33225-35105 | aceF | ||
| 2056 | QEPU01000003.1 | GCA003252955_00970 | gene | open | 35196-36620 | lpdA | ||
| 2057 | QEPU01000003.1 | GCA003252955_00971 | gene | open | 36718-36999 | |||
| 2058 | QEPU01000003.1 | GCA003252955_00972 | gene | open | 37107-37703 | |||
| 2059 | QEPU01000003.1 | GCA003252955_00973 | gene | open | 37706-38683 | |||
| 2060 | QEPU01000003.1 | GCA003252955_00974 | gene | open | 38783-39349 | |||
| 2061 | QEPU01000003.1 | GCA003252955_00975 | gene | open | 39504-40448 | ldhA | ||
| 2062 | QEPU01000003.1 | GCA003252955_00976 | gene | open | 40534-42480 | |||
| 2063 | QEPU01000003.1 | GCA003252955_00977 | gene | open | 42547-43353 | |||
| 2064 | QEPU01000003.1 | GCA003252955_00978 | gene | open | 43454-43936 | |||
| 2065 | QEPU01000003.1 | GCA003252955_00979 | gene | open | 44009-44986 | feuC | ||
| 2066 | QEPU01000003.1 | GCA003252955_00980 | gene | open | 44991-45740 | hmuV | ||
| 2067 | QEPU01000003.1 | GCA003252955_00981 | gene | open | 45966-46433 | |||
| 2068 | QEPU01000003.1 | GCA003252955_00982 | gene | open | 46748-46984 | |||
| 2069 | QEPU01000003.1 | GCA003252955_00983 | gene | open | 46962-47522 | |||
| 2070 | QEPU01000003.1 | GCA003252955_00984 | gene | open | 48002-49681 | |||
| 2071 | QEPU01000003.1 | GCA003252955_00985 | gene | open | 49871-53560 | metH | ||
| 2072 | QEPU01000003.1 | GCA003252955_00986 | gene | open | 53785-54969 | |||
| 2073 | QEPU01000003.1 | GCA003252955_00987 | gene | open | 54983-55669 | lolD | ||
| 2074 | QEPU01000003.1 | GCA003252955_00988 | gene | open | 55669-56919 | lolE | ||
| 2075 | QEPU01000003.1 | GCA003252955_00989 | gene | open | 57022-58104 | aroG | ||
| 2076 | QEPU01000003.1 | GCA003252955_00990 | gene | open | 58272-59672 | dnaB | ||
| 2077 | QEPU01000003.1 | GCA003252955_00991 | gene | open | 59699-60781 | alr | ||
| 2078 | QEPU01000003.1 | GCA003252955_00992 | gene | open | 60811-62460 | pgi | ||
| 2079 | QEPU01000003.1 | GCA003252955_00994 | gene | open | 62680-63153 | ribE | ||
| 2080 | QEPU01000003.1 | GCA003252955_00995 | gene | open | 63160-63585 | nusB | ||
| 2081 | QEPU01000003.1 | GCA003252955_00996 | gene | open | 63604-64599 | thiL | ||
| 2082 | QEPU01000003.1 | GCA003252955_00997 | gene | open | 64608-65099 | |||
| 2083 | QEPU01000003.1 | GCA003252955_00998 | gene | open | 65108-65731 | |||
| 2084 | QEPU01000003.1 | GCA003252955_00999 | gene | open | 65750-66562 | dapB | ||
| 2085 | QEPU01000003.1 | GCA003252955_01000 | gene | open | 66636-66884 | yfaE | ||
| 2086 | QEPU01000003.1 | GCA003252955_01001 | gene | open | 66953-68338 | |||
| 2087 | QEPU01000003.1 | GCA003252955_01002 | gene | open | 68597-69727 | nrdB | ||
| 2088 | QEPU01000003.1 | GCA003252955_01003 | gene | open | 70004-72274 | nrdA | ||
| 2089 | QEPU01000003.1 | GCA003252955_01004 | gene | open | 72571-75666 | |||
| 2090 | QEPU01000003.1 | GCA003252955_01005 | gene | open | 75684-77042 | |||
| 2091 | QEPU01000003.1 | GCA003252955_01006 | gene | open | 77061-78227 | |||
| 2092 | QEPU01000003.1 | GCA003252955_01007 | gene | open | 78235-79782 | hsdM | ||
| 2093 | QEPU01000003.1 | GCA003252955_01008 | gene | open | 79970-80407 | |||
| 2094 | QEPU01000003.1 | GCA003252955_01009 | gene | open | 80495-81478 | |||
| 2095 | QEPU01000003.1 | GCA003252955_01010 | gene | open | 81426-81923 | |||
| 2096 | QEPU01000003.1 | GCA003252955_01011 | gene | open | 82295-83323 | |||
| 2097 | QEPU01000003.1 | GCA003252955_01012 | gene | open | 83487-85511 | cysW | ||
| 2098 | QEPU01000003.1 | GCA003252955_01013 | gene | open | 85512-86552 | potA | ||
| 2099 | QEPU01000003.1 | GCA003252955_01014 | gene | open | 86627-87106 | ybaK | ||
| 2100 | QEPU01000003.1 | GCA003252955_01015 | gene | open | 87167-88138 | |||
| 2101 | QEPU01000003.1 | GCA003252955_01016 | gene | open | 88195-88824 | |||
| 2102 | QEPU01000003.1 | GCA003252955_01017 | gene | open | 88894-89376 | trxA | ||
| 2103 | QEPU01000003.1 | GCA003252955_01018 | gene | open | 89392-90033 | ccdA | ||
| 2104 | QEPU01000003.1 | GCA003252955_01019 | gene | open | 90037-91107 | msrAB | ||
| 2105 | QEPU01000003.1 | GCA003252955_01020 | gene | open | 91325-92017 | can | ||
| 2106 | QEPU01000003.1 | GCA003252955_01021 | gene | open | 92188-92775 | dolP | ||
| 2107 | QEPU01000003.1 | GCA003252955_01022 | gene | open | 92841-93425 | |||
| 2108 | QEPU01000003.1 | GCA003252955_01023 | gene | open | 93431-93790 | yraN | ||
| 2109 | QEPU01000003.1 | GCA003252955_01024 | gene | open | 93800-95515 | lpoA | ||
| 2110 | QEPU01000003.1 | GCA003252955_01025 | gene | open | 95592-96440 | rsmI | ||
| 2111 | QEPU01000003.1 | GCA003252955_01026 | gene | open | 96572-98071 | glpK | ||
| 2112 | QEPU01000003.1 | GCA003252955_01027 | gene | open | 98098-98892 | glpF | ||
| 2113 | QEPU01000003.1 | GCA003252955_01028 | gene | open | 99256-100848 | glpA | ||
| 2114 | QEPU01000003.1 | GCA003252955_01029 | gene | open | 100996-101586 | |||
| 2115 | QEPU01000003.1 | GCA003252955_01030 | gene | open | 101820-102881 | sohB | ||
| 2116 | QEPU01000003.1 | GCA003252955_01031 | gene | open | 103110-103946 | |||
| 2117 | QEPU01000003.1 | GCA003252955_01032 | gene | open | 104006-104881 | fN3K | ||
| 2118 | QEPU01000003.1 | GCA003252955_01033 | gene | open | 105120-107051 | thrS | ||
| 2119 | QEPU01000003.1 | GCA003252955_01034 | gene | open | 107156-107935 | |||
| 2120 | QEPU01000003.1 | GCA003252955_01035 | gene | open | 108318-108782 | infC | ||
| 2121 | QEPU01000003.1 | GCA003252955_01036 | gene | open | 108961-109158 | rpmI | ||
| 2122 | QEPU01000003.1 | GCA003252955_01037 | gene | open | 109214-109567 | rplT | ||
| 2123 | QEPU01000003.1 | GCA003252955_01038 | gene | open | 109802-110362 | |||
| 2124 | QEPU01000003.1 | GCA003252955_01039 | gene | open | 110742-112601 | dxs | ||
| 2125 | QEPU01000003.1 | GCA003252955_01040 | gene | open | 112693-113583 | ispA | ||
| 2126 | QEPU01000003.1 | GCA003252955_01041 | gene | open | 113594-113839 | xseB | ||
| 2127 | QEPU01000003.1 | GCA003252955_01042 | gene | open | 113977-114930 | besA | ||
| 2128 | QEPU01000003.1 | GCA003252955_01043 | gene | open | 115125-116021 | accD | ||
| 2129 | QEPU01000003.1 | GCA003252955_01044 | gene | open | 116042-117388 | folC | ||
| 2130 | QEPU01000003.1 | GCA003252955_01045 | gene | open | 117450-118091 | |||
| 2131 | QEPU01000003.1 | GCA003252955_01046 | gene | open | 118158-119615 | cls | ||
| 2132 | QEPU01000003.1 | GCA003252955_01047 | gene | open | 119631-120539 | lysO | ||
| 2133 | QEPU01000003.1 | GCA003252955_01048 | gene | open | 120673-121389 | |||
| 2134 | QEPU01000003.1 | GCA003252955_01049 | gene | open | 121399-122262 | rhaT | ||
| 2135 | QEPU01000003.1 | GCA003252955_01050 | gene | open | 122356-122679 | |||
| 2136 | QEPU01000003.1 | GCA003252955_01051 | gene | open | 122785-123192 | |||
| 2137 | QEPU01000003.1 | GCA003252955_01052 | gene | open | 123622-125163 | |||
| 2138 | QEPU01000003.1 | GCA003252955_01053 | gene | open | 125330-126697 | tdeA | ||
| 2139 | QEPU01000003.1 | GCA003252955_01054 | gene | open | 126783-128717 | pvdT | ||
| 2140 | QEPU01000003.1 | GCA003252955_01055 | gene | open | 128734-129918 | |||
| 2141 | QEPU01000003.1 | GCA003252955_01056 | gene | open | 130194-131873 | glnS | ||
| 2142 | QEPU01000003.1 | GCA003252955_01057 | gene | open | 131944-132387 | ycgN | ||
| 2143 | QEPU01000003.1 | GCA003252955_01058 | gene | open | 132479-134578 | malQ | ||
| 2144 | QEPU01000003.1 | GCA003252955_01059 | gene | open | 134591-136783 | glgB | ||
| 2145 | QEPU01000003.1 | GCA003252955_01060 | gene | open | 136873-138930 | glgX | ||
| 2146 | QEPU01000003.1 | GCA003252955_01061 | gene | open | 138958-140268 | glgC | ||
| 2147 | QEPU01000003.1 | GCA003252955_01062 | gene | open | 140569-142008 | glgA | ||
| 2148 | QEPU01000003.1 | GCA003252955_01063 | gene | open | 142131-144596 | |||
| 2149 | QEPU01000003.1 | GCA003252955_01064 | gene | open | 144715-145650 | |||
| 2150 | QEPU01000003.1 | GCA003252955_01065 | gene | open | 145785-146390 | dedA | ||
| 2151 | QEPU01000003.1 | GCA003252955_01066 | gene | open | 146609-146896 | rplY | ||
| 2152 | QEPU01000003.1 | GCA003252955_01067 | gene | open | 147040-147639 | hlpB | ||
| 2153 | QEPU01000003.1 | GCA003252955_01068 | gene | open | 147726-148634 | |||
| 2154 | QEPU01000003.1 | GCA003252955_01069 | gene | open | 148880-150202 | mukF | ||
| 2155 | QEPU01000003.1 | GCA003252955_01070 | gene | open | 150231-150542 | |||
| 2156 | QEPU01000003.1 | GCA003252955_01071 | gene | open | 150553-154014 | fucP | ||
| 2157 | QEPU01000003.1 | GCA003252955_01072 | gene | open | 154035-154775 | mukE | ||
| 2158 | QEPU01000003.1 | GCA003252955_01073 | gene | open | 154775-159268 | mukB | ||
| 2159 | QEPU01000003.1 | GCA003252955_01074 | gene | open | 159345-160217 | eamA | ||
| 2160 | QEPU01000003.1 | GCA003252955_01075 | gene | open | 160232-161656 | sbcB | ||
| 2161 | QEPU01000004.1 | GCA003252955_01116 | gene | open | 43849-43949 | AaHKsRNA22 | ||
| 2162 | QEPU01000004.1 | GCA003252955_01191 | gene | open | 122432-122528 | AaHKsRNA22 | ||
| 2163 | QEPU01000004.1 | GCA003252955_01116 | ncRNA | open | 43849-43949 | Aggregatibacter sRNA 22 | ||
| 2164 | QEPU01000004.1 | GCA003252955_01191 | ncRNA | open | 122432-122528 | Aggregatibacter sRNA 22 | ||
| 2165 | QEPU01000004.1 | regulatory_region | open | 97707-97751 | PreQ1 (pre queuosine) riboswitch aptamer | |||
| 2166 | QEPU01000004.1 | repeat_region | open | 47177-47350 | CRISPR array with 3 repeats of length 32%2C consensus sequence GCAGCCGCTTTCGGGCGGCTGTGTGTTGAAAC and spacer length 34 | |||
| 2167 | QEPU01000004.1 | GCA003252955_01077 | CDS | open | 45-362 | _na 105_aa | hypothetical protein | |
| 2168 | QEPU01000004.1 | GCA003252955_01078 | CDS | open | 399-1067 | _na 222_aa | hypothetical protein | |
| 2169 | QEPU01000004.1 | GCA003252955_01079 | CDS | open | 1015-1599 | _na 194_aa | hypothetical protein | |
| 2170 | QEPU01000004.1 | GCA003252955_01080 | CDS | open | 2652-2954 | _na 100_aa | Immunity protein 40 domain-containing protein | |
| 2171 | QEPU01000004.1 | GCA003252955_01081 | CDS | open | 3047-4375 | _na 442_aa | tcyP | Transporter of cystine tcyP |
| 2172 | QEPU01000004.1 | GCA003252955_01082 | CDS | open | 4541-6031 | _na 496_aa | leucyl aminopeptidase | |
| 2173 | QEPU01000004.1 | GCA003252955_01083 | CDS | open | 6182-7285 | _na 367_aa | lptF | LPS export ABC transporter permease LptF |
| 2174 | QEPU01000004.1 | GCA003252955_01084 | CDS | open | 7291-8358 | _na 355_aa | lptG | LPS export ABC transporter permease LptG |
| 2175 | QEPU01000004.1 | GCA003252955_01085 | CDS | open | 8535-9419 | _na 294_aa | metF | methylenetetrahydrofolate reductase |
| 2176 | QEPU01000004.1 | GCA003252955_01086 | CDS | open | 9503-10288 | _na 261_aa | znuB | zinc ABC transporter permease subunit ZnuB |
| 2177 | QEPU01000004.1 | GCA003252955_01087 | CDS | open | 10299-11072 | _na 257_aa | znuC | zinc ABC transporter ATP-binding protein ZnuC |
| 2178 | QEPU01000004.1 | GCA003252955_01088 | CDS | open | 11264-12796 | _na 510_aa | mepM | murein DD-endopeptidase MepM |
| 2179 | QEPU01000004.1 | GCA003252955_01089 | CDS | open | 13035-13181 | _na 48_aa | Lipoprotein | |
| 2180 | QEPU01000004.1 | GCA003252955_01090 | CDS | open | 13337-13825 | _na 162_aa | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein | |
| 2181 | QEPU01000004.1 | GCA003252955_01091 | CDS | open | 13908-14858 | _na 316_aa | prs | Ribose-phosphate pyrophosphokinase |
| 2182 | QEPU01000004.1 | GCA003252955_01092 | CDS | open | 14905-15822 | _na 305_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 2183 | QEPU01000004.1 | GCA003252955_01093 | CDS | open | 15826-16452 | _na 208_aa | lolB | lipoprotein insertase outer membrane protein LolB |
| 2184 | QEPU01000004.1 | GCA003252955_01094 | CDS | open | 16537-17808 | _na 423_aa | multifunctional CCA addition/repair protein | |
| 2185 | QEPU01000004.1 | GCA003252955_01095 | CDS | open | 17808-18419 | _na 203_aa | TIGR04211 family SH3 domain-containing protein | |
| 2186 | QEPU01000004.1 | GCA003252955_01096 | CDS | open | 18487-19752 | _na 421_aa | Phosphate transporter | |
| 2187 | QEPU01000004.1 | GCA003252955_01097 | CDS | open | 19777-20457 | _na 226_aa | ykaA | Phosphate transport regulator |
| 2188 | QEPU01000004.1 | GCA003252955_01098 | CDS | open | 20617-21687 | _na 356_aa | putative conserved protein | |
| 2189 | QEPU01000004.1 | GCA003252955_01099 | CDS | open | 21698-23071 | _na 457_aa | radA | DNA repair protein RadA |
| 2190 | QEPU01000004.1 | GCA003252955_01100 | CDS | open | 23227-23706 | _na 159_aa | lrp | leucine-responsive transcriptional regulator Lrp |
| 2191 | QEPU01000004.1 | GCA003252955_01101 | CDS | open | 23724-26480 | _na 918_aa | ftsK | DNA translocase FtsK |
| 2192 | QEPU01000004.1 | GCA003252955_01102 | CDS | open | 26591-27208 | _na 205_aa | lolA | outer membrane lipoprotein chaperone LolA |
| 2193 | QEPU01000004.1 | GCA003252955_01103 | CDS | open | 27221-28543 | _na 440_aa | rarA | Replication-associated recombination protein A |
| 2194 | QEPU01000004.1 | GCA003252955_01104 | CDS | open | 28966-30633 | _na 555_aa | dcuA | Transporter%2C anaerobic C4-dicarboxylate uptake (Dcu) family |
| 2195 | QEPU01000004.1 | GCA003252955_01105 | CDS | open | 30933-32240 | _na 435_aa | serS | serine--tRNA ligase |
| 2196 | QEPU01000004.1 | GCA003252955_01106 | CDS | open | 32340-35273 | _na 977_aa | glnE | bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase |
| 2197 | QEPU01000004.1 | GCA003252955_01107 | CDS | open | 35521-35718 | _na 65_aa | HD Cas3-type domain-containing protein | |
| 2198 | QEPU01000004.1 | GCA003252955_01108 | CDS | open | 35818-37812 | _na 664_aa | CRISPR-associated helicase/endonuclease Cas3 | |
| 2199 | QEPU01000004.1 | GCA003252955_01109 | CDS | open | 37909-38202 | _na 97_aa | hepA | ATP-dependent helicase HepA |
| 2200 | QEPU01000004.1 | GCA003252955_01110 | CDS | open | 38309-38890 | _na 193_aa | SLC26A/SulP transporter domain-containing protein | |
| 2201 | QEPU01000004.1 | GCA003252955_01111 | CDS | open | 38887-39831 | _na 314_aa | DUF4868 domain-containing protein | |
| 2202 | QEPU01000004.1 | GCA003252955_01112 | CDS | open | 39912-40328 | _na 138_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 2203 | QEPU01000004.1 | GCA003252955_01113 | CDS | open | 40499-41176 | _na 225_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 2204 | QEPU01000004.1 | GCA003252955_01114 | CDS | open | 41173-42966 | _na 597_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 2205 | QEPU01000004.1 | GCA003252955_01115 | CDS | open | 42978-43844 | _na 288_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 2206 | QEPU01000004.1 | GCA003252955_01117 | CDS | open | 44103-44573 | _na 156_aa | cas4 | CRISPR-associated protein Cas4 |
| 2207 | QEPU01000004.1 | GCA003252955_01118 | CDS | open | 44608-45624 | _na 338_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 2208 | QEPU01000004.1 | GCA003252955_01119 | CDS | open | 45663-46688 | _na 341_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 2209 | QEPU01000004.1 | GCA003252955_01120 | CDS | open | 46692-46985 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2210 | QEPU01000004.1 | GCA003252955_01121 | CDS | open | 47718-49382 | _na 554_aa | PTS system%2C glucose-specific IIABC component | |
| 2211 | QEPU01000004.1 | GCA003252955_01122 | CDS | open | 49393-50184 | _na 263_aa | Endonuclease/exonuclease/phosphatase | |
| 2212 | QEPU01000004.1 | GCA003252955_01123 | CDS | open | 50194-53967 | _na 1257_aa | malQ | 4-alpha-glucanotransferase |
| 2213 | QEPU01000004.1 | GCA003252955_01124 | CDS | open | 54167-54880 | _na 237_aa | Trehalose operon transcriptional repressor | |
| 2214 | QEPU01000004.1 | GCA003252955_01125 | CDS | open | 55014-57287 | _na 757_aa | metE | 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase |
| 2215 | QEPU01000004.1 | GCA003252955_01126 | CDS | open | 57552-58484 | _na 310_aa | metR | HTH-type transcriptional regulator MetR |
| 2216 | QEPU01000004.1 | GCA003252955_01127 | CDS | open | 58489-59220 | _na 243_aa | azlC | Putative azaleucine resistance protein AzlC |
| 2217 | QEPU01000004.1 | GCA003252955_01128 | CDS | open | 59217-59549 | _na 110_aa | azlD | Branched-chain amino acid transport protein AzlD |
| 2218 | QEPU01000004.1 | GCA003252955_01129 | CDS | open | 59616-62408 | _na 930_aa | pqqL | Protease3 |
| 2219 | QEPU01000004.1 | GCA003252955_01130 | CDS | open | 62468-64834 | _na 788_aa | cirA | TonB-dependent receptor |
| 2220 | QEPU01000004.1 | GCA003252955_01131 | CDS | open | 65127-66020 | _na 297_aa | DUF535 domain-containing protein | |
| 2221 | QEPU01000004.1 | GCA003252955_01132 | CDS | open | 66013-66690 | _na 225_aa | cmk | (d)CMP kinase |
| 2222 | QEPU01000004.1 | GCA003252955_01133 | CDS | open | 66789-68435 | _na 548_aa | rpsA | 30S ribosomal protein S1 |
| 2223 | QEPU01000004.1 | GCA003252955_01134 | CDS | open | 68498-68782 | _na 94_aa | hupA | integration host factor subunit beta |
| 2224 | QEPU01000004.1 | GCA003252955_01135 | CDS | open | 68882-69178 | _na 98_aa | lapA | putative lipopolysaccharide assembly protein A |
| 2225 | QEPU01000004.1 | GCA003252955_01136 | CDS | open | 69178-70368 | _na 396_aa | lapB | lipopolysaccharide assembly protein LapB |
| 2226 | QEPU01000004.1 | GCA003252955_01137 | CDS | open | 70402-71094 | _na 230_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 2227 | QEPU01000004.1 | GCA003252955_01138 | CDS | open | 71101-71418 | _na 105_aa | yciH | stress response translation initiation inhibitor YciH |
| 2228 | QEPU01000004.1 | GCA003252955_01139 | CDS | open | 71457-71807 | _na 116_aa | sirB | Invasion gene expression up-regulator%2C SirB |
| 2229 | QEPU01000004.1 | GCA003252955_01140 | CDS | open | 71875-74532 | _na 885_aa | gyrA | DNA topoisomerase (ATP-hydrolyzing) subunit A |
| 2230 | QEPU01000004.1 | GCA003252955_01141 | CDS | open | 74720-75043 | _na 107_aa | ubiG | bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG |
| 2231 | QEPU01000004.1 | GCA003252955_01142 | CDS | open | 75120-75476 | _na 118_aa | ubiG | bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG |
| 2232 | QEPU01000004.1 | GCA003252955_01143 | CDS | open | 75542-75982 | _na 146_aa | fur | ferric iron uptake transcriptional regulator |
| 2233 | QEPU01000004.1 | GCA003252955_01144 | CDS | open | 76002-76526 | _na 174_aa | fldA | flavodoxin FldA |
| 2234 | QEPU01000004.1 | GCA003252955_01145 | CDS | open | 76538-76816 | _na 92_aa | ybfE | LexA regulated protein |
| 2235 | QEPU01000004.1 | GCA003252955_01146 | CDS | open | 76940-77740 | _na 266_aa | ybfF | Esterase ybfF |
| 2236 | QEPU01000004.1 | GCA003252955_01147 | CDS | open | 77827-78444 | _na 205_aa | seqA | replication initiation negative regulator SeqA |
| 2237 | QEPU01000004.1 | GCA003252955_01148 | CDS | open | 78447-79874 | _na 475_aa | menE | o-succinylbenzoate--CoA ligase |
| 2238 | QEPU01000004.1 | GCA003252955_01149 | CDS | open | 79877-83203 | _na 1108_aa | mscK | mechanosensitive channel MscK |
| 2239 | QEPU01000004.1 | GCA003252955_01150 | CDS | open | 83226-84299 | _na 357_aa | aroC | chorismate synthase |
| 2240 | QEPU01000004.1 | GCA003252955_01151 | CDS | open | 84318-85190 | _na 290_aa | mepA | penicillin-insensitive murein endopeptidase |
| 2241 | QEPU01000004.1 | GCA003252955_01152 | CDS | open | 85194-85961 | _na 255_aa | tauE | putative membrane transporter protein |
| 2242 | QEPU01000004.1 | GCA003252955_01153 | CDS | open | 85998-86954 | _na 318_aa | lpxM | lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase |
| 2243 | QEPU01000004.1 | GCA003252955_01154 | CDS | open | 87021-87587 | _na 188_aa | apt | adenine phosphoribosyltransferase |
| 2244 | QEPU01000004.1 | GCA003252955_01155 | CDS | open | 87625-89667 | _na 680_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 2245 | QEPU01000004.1 | GCA003252955_01156 | CDS | open | 89680-90540 | _na 286_aa | endonuclease/exonuclease/phosphatase family protein | |
| 2246 | QEPU01000004.1 | GCA003252955_01157 | CDS | open | 90537-90890 | _na 117_aa | Enamine/imine deaminase | |
| 2247 | QEPU01000004.1 | GCA003252955_01158 | CDS | open | 91001-91717 | _na 238_aa | YwiC-like protein | |
| 2248 | QEPU01000004.1 | GCA003252955_01159 | CDS | open | 91714-92436 | _na 240_aa | hcpC | Beta-lactamase hcpC |
| 2249 | QEPU01000004.1 | GCA003252955_01160 | CDS | open | 92579-94558 | _na 659_aa | rnb | exoribonuclease II |
| 2250 | QEPU01000004.1 | GCA003252955_01161 | CDS | open | 94684-95472 | _na 262_aa | fabI | Enoyl-[acyl-carrier-protein] reductase [NADH] FabI |
| 2251 | QEPU01000004.1 | GCA003252955_01162 | CDS | open | 95563-96318 | _na 251_aa | Nif3-like dinuclear metal center hexameric protein | |
| 2252 | QEPU01000004.1 | GCA003252955_01163 | CDS | open | 96543-97172 | _na 209_aa | 7-carboxy-7-deazaguanine synthase | |
| 2253 | QEPU01000004.1 | GCA003252955_01164 | CDS | open | 97178-97603 | _na 141_aa | queD | 6-carboxytetrahydropterin synthase QueD |
| 2254 | QEPU01000004.1 | GCA003252955_01165 | CDS | open | 98136-99311 | _na 391_aa | Beta-N-acetylhexosaminidase | |
| 2255 | QEPU01000004.1 | GCA003252955_01166 | CDS | open | 99402-100301 | _na 299_aa | DNA-binding transcriptional regulator | |
| 2256 | QEPU01000004.1 | GCA003252955_01167 | CDS | open | 100365-100979 | _na 204_aa | putative conserved protein | |
| 2257 | QEPU01000004.1 | GCA003252955_01168 | CDS | open | 101111-102061 | _na 316_aa | prmB | 50S ribosomal protein L3 N(5)-glutamine methyltransferase |
| 2258 | QEPU01000004.1 | GCA003252955_01169 | CDS | open | 102126-102632 | _na 168_aa | smrB | endonuclease SmrB |
| 2259 | QEPU01000004.1 | GCA003252955_01170 | CDS | open | 102629-104770 | _na 713_aa | yccS | Inner membrane protein yccS |
| 2260 | QEPU01000004.1 | GCA003252955_01171 | CDS | open | 104793-105254 | _na 153_aa | yccF | YccF domain-containing protein |
| 2261 | QEPU01000004.1 | GCA003252955_01172 | CDS | open | 105257-105715 | _na 152_aa | mgsA | methylglyoxal synthase |
| 2262 | QEPU01000004.1 | GCA003252955_01173 | CDS | open | 105789-106460 | _na 223_aa | curli polymerization inhibitor CsgI-related protein | |
| 2263 | QEPU01000004.1 | GCA003252955_01174 | CDS | open | 106615-106887 | _na 90_aa | acylphosphatase | |
| 2264 | QEPU01000004.1 | GCA003252955_01175 | CDS | open | 106862-107710 | _na 282_aa | yfeD | Iron (Fe3+) ABC superfamily ATP binding cassette transporter%2C membrane protein YfeD |
| 2265 | QEPU01000004.1 | GCA003252955_01176 | CDS | open | 107707-108564 | _na 285_aa | afeC | iron ABC transporter permease subunit AfeC |
| 2266 | QEPU01000004.1 | GCA003252955_01177 | CDS | open | 108564-109454 | _na 296_aa | afeB | ironABC transporter ATP-binding protein AfeB |
| 2267 | QEPU01000004.1 | GCA003252955_01178 | CDS | open | 109454-110335 | _na 293_aa | afeA | iron ABC transporter substrate-binding protein AfeA |
| 2268 | QEPU01000004.1 | GCA003252955_01179 | CDS | open | 110434-110763 | _na 109_aa | dsrC | Sulfurtransferase |
| 2269 | QEPU01000004.1 | GCA003252955_01180 | CDS | open | 110849-111511 | _na 220_aa | ybhL | BAX inhibitor protein |
| 2270 | QEPU01000004.1 | GCA003252955_01181 | CDS | open | 111689-112096 | _na 135_aa | Z-ring associated protein G | |
| 2271 | QEPU01000004.1 | GCA003252955_01182 | CDS | open | 112234-112542 | _na 102_aa | YceK/YidQ family lipoprotein | |
| 2272 | QEPU01000004.1 | GCA003252955_01183 | CDS | open | 112711-114474 | _na 587_aa | ycaO | 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO |
| 2273 | QEPU01000004.1 | GCA003252955_01184 | CDS | open | 114573-115775 | _na 400_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 2274 | QEPU01000004.1 | GCA003252955_01185 | CDS | open | 115979-116311 | _na 110_aa | DUF1508 domain-containing protein | |
| 2275 | QEPU01000004.1 | GCA003252955_01186 | CDS | open | 116525-118018 | _na 497_aa | ptsG2 | PTS family glucose porter%2C IICBA component |
| 2276 | QEPU01000004.1 | GCA003252955_01187 | CDS | open | 118090-118788 | _na 232_aa | Methyltransferase domain protein | |
| 2277 | QEPU01000004.1 | GCA003252955_01188 | CDS | open | 118806-119507 | _na 233_aa | gloB | hydroxyacylglutathione hydrolase |
| 2278 | QEPU01000004.1 | GCA003252955_01189 | CDS | open | 119823-121127 | _na 434_aa | hemA | glutamyl-tRNA reductase |
| 2279 | QEPU01000004.1 | GCA003252955_01190 | CDS | open | 121190-122413 | _na 407_aa | nagC | ROK family protein |
| 2280 | QEPU01000004.1 | GCA003252955_01196 | CDS | open | 123117-124889 | _na 590_aa | ggt | gamma-glutamyltransferase |
| 2281 | QEPU01000004.1 | GCA003252955_01197 | CDS | open | 125133-125378 | _na 81_aa | ygjV | YgjV family protein |
| 2282 | QEPU01000004.1 | GCA003252955_01198 | CDS | open | 125624-126961 | _na 445_aa | argG | argininosuccinate synthase |
| 2283 | QEPU01000004.1 | GCA003252955_01199 | CDS | open | 127087-127917 | _na 276_aa | NAD dependent epimerase/dehydratase family | |
| 2284 | QEPU01000004.1 | GCA003252955_01200 | CDS | open | 127982-128842 | _na 286_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 2285 | QEPU01000004.1 | GCA003252955_01201 | CDS | open | 129083-130090 | _na 335_aa | Outer membrane phosphoporin protein E | |
| 2286 | QEPU01000004.1 | GCA003252955_01202 | CDS | open | 130821-132404 | _na 527_aa | prfC | peptide chain release factor 3 |
| 2287 | QEPU01000004.1 | GCA003252955_01203 | CDS | open | 132487-133383 | _na 298_aa | cdd | cytidine deaminase |
| 2288 | QEPU01000004.1 | GCA003252955_01204 | CDS | open | 133497-134594 | _na 365_aa | potD | Putrescine-binding periplasmic protein |
| 2289 | QEPU01000004.1 | GCA003252955_01205 | CDS | open | 134724-135497 | _na 257_aa | potC | spermidine/putrescine ABC transporter permease PotC |
| 2290 | QEPU01000004.1 | GCA003252955_01206 | CDS | open | 135497-136357 | _na 286_aa | potB | spermidine/putrescine ABC transporter permease PotB |
| 2291 | QEPU01000004.1 | GCA003252955_01207 | CDS | open | 136341-137459 | _na 372_aa | potA | spermidine/putrescine ABC transporter ATP-binding protein PotA |
| 2292 | QEPU01000004.1 | GCA003252955_01208 | CDS | open | 137728-138978 | _na 416_aa | pepT | peptidase T |
| 2293 | QEPU01000004.1 | GCA003252955_01209 | CDS | open | 139031-141685 | _na 884_aa | Mce/MlaD domain-containing protein | |
| 2294 | QEPU01000004.1 | GCA003252955_01210 | CDS | open | 141651-142931 | _na 426_aa | Paraquat-inducible protein A | |
| 2295 | QEPU01000004.1 | GCA003252955_01211 | CDS | open | 143142-143759 | _na 205_aa | proQ | RNA chaperone ProQ |
| 2296 | QEPU01000004.1 | GCA003252955_01212 | CDS | open | 143827-145884 | _na 685_aa | prc | carboxy terminal-processing peptidase |
| 2297 | QEPU01000004.1 | GCA003252955_01213 | CDS | open | 145969-147489 | _na 506_aa | Murein L%2CD-transpeptidase | |
| 2298 | QEPU01000004.1 | GCA003252955_01214 | CDS | open | 147560-148120 | _na 186_aa | ycbK | DUF882 domain-containing protein |
| 2299 | QEPU01000004.1 | GCA003252955_01215 | CDS | open | 148187-148825 | _na 212_aa | Carboxy-protease | |
| 2300 | QEPU01000004.1 | GCA003252955_01216 | CDS | open | 149071-151875 | _na 934_aa | sucA | 2-oxoglutarate dehydrogenase E1 component |
| 2301 | QEPU01000004.1 | GCA003252955_01217 | CDS | open | 152007-153212 | _na 401_aa | odhB | 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase |
| 2302 | QEPU01000004.1 | GCA003252955_01218 | CDS | open | 153307-154476 | _na 389_aa | sucC | ADP-forming succinate--CoA ligase subunit beta |
| 2303 | QEPU01000004.1 | GCA003252955_01219 | CDS | open | 154488-155366 | _na 292_aa | sucD | succinate--CoA ligase subunit alpha |
| 2304 | QEPU01000004.1 | GCA003252955_01077 | gene | open | 45-362 | |||
| 2305 | QEPU01000004.1 | GCA003252955_01078 | gene | open | 399-1067 | |||
| 2306 | QEPU01000004.1 | GCA003252955_01079 | gene | open | 1015-1599 | |||
| 2307 | QEPU01000004.1 | GCA003252955_01080 | gene | open | 2652-2954 | |||
| 2308 | QEPU01000004.1 | GCA003252955_01081 | gene | open | 3047-4375 | tcyP | ||
| 2309 | QEPU01000004.1 | GCA003252955_01082 | gene | open | 4541-6031 | |||
| 2310 | QEPU01000004.1 | GCA003252955_01083 | gene | open | 6182-7285 | lptF | ||
| 2311 | QEPU01000004.1 | GCA003252955_01084 | gene | open | 7291-8358 | lptG | ||
| 2312 | QEPU01000004.1 | GCA003252955_01085 | gene | open | 8535-9419 | metF | ||
| 2313 | QEPU01000004.1 | GCA003252955_01086 | gene | open | 9503-10288 | znuB | ||
| 2314 | QEPU01000004.1 | GCA003252955_01087 | gene | open | 10299-11072 | znuC | ||
| 2315 | QEPU01000004.1 | GCA003252955_01088 | gene | open | 11264-12796 | mepM | ||
| 2316 | QEPU01000004.1 | GCA003252955_01089 | gene | open | 13035-13181 | |||
| 2317 | QEPU01000004.1 | GCA003252955_01090 | gene | open | 13337-13825 | |||
| 2318 | QEPU01000004.1 | GCA003252955_01091 | gene | open | 13908-14858 | prs | ||
| 2319 | QEPU01000004.1 | GCA003252955_01092 | gene | open | 14905-15822 | ispE | ||
| 2320 | QEPU01000004.1 | GCA003252955_01093 | gene | open | 15826-16452 | lolB | ||
| 2321 | QEPU01000004.1 | GCA003252955_01094 | gene | open | 16537-17808 | |||
| 2322 | QEPU01000004.1 | GCA003252955_01095 | gene | open | 17808-18419 | |||
| 2323 | QEPU01000004.1 | GCA003252955_01096 | gene | open | 18487-19752 | |||
| 2324 | QEPU01000004.1 | GCA003252955_01097 | gene | open | 19777-20457 | ykaA | ||
| 2325 | QEPU01000004.1 | GCA003252955_01098 | gene | open | 20617-21687 | |||
| 2326 | QEPU01000004.1 | GCA003252955_01099 | gene | open | 21698-23071 | radA | ||
| 2327 | QEPU01000004.1 | GCA003252955_01100 | gene | open | 23227-23706 | lrp | ||
| 2328 | QEPU01000004.1 | GCA003252955_01101 | gene | open | 23724-26480 | ftsK | ||
| 2329 | QEPU01000004.1 | GCA003252955_01102 | gene | open | 26591-27208 | lolA | ||
| 2330 | QEPU01000004.1 | GCA003252955_01103 | gene | open | 27221-28543 | rarA | ||
| 2331 | QEPU01000004.1 | GCA003252955_01104 | gene | open | 28966-30633 | dcuA | ||
| 2332 | QEPU01000004.1 | GCA003252955_01105 | gene | open | 30933-32240 | serS | ||
| 2333 | QEPU01000004.1 | GCA003252955_01106 | gene | open | 32340-35273 | glnE | ||
| 2334 | QEPU01000004.1 | GCA003252955_01107 | gene | open | 35521-35718 | |||
| 2335 | QEPU01000004.1 | GCA003252955_01108 | gene | open | 35818-37812 | |||
| 2336 | QEPU01000004.1 | GCA003252955_01109 | gene | open | 37909-38202 | hepA | ||
| 2337 | QEPU01000004.1 | GCA003252955_01110 | gene | open | 38309-38890 | |||
| 2338 | QEPU01000004.1 | GCA003252955_01111 | gene | open | 38887-39831 | |||
| 2339 | QEPU01000004.1 | GCA003252955_01112 | gene | open | 39912-40328 | |||
| 2340 | QEPU01000004.1 | GCA003252955_01113 | gene | open | 40499-41176 | cas5c | ||
| 2341 | QEPU01000004.1 | GCA003252955_01114 | gene | open | 41173-42966 | cas8c | ||
| 2342 | QEPU01000004.1 | GCA003252955_01115 | gene | open | 42978-43844 | cas7c | ||
| 2343 | QEPU01000004.1 | GCA003252955_01117 | gene | open | 44103-44573 | cas4 | ||
| 2344 | QEPU01000004.1 | GCA003252955_01118 | gene | open | 44608-45624 | |||
| 2345 | QEPU01000004.1 | GCA003252955_01119 | gene | open | 45663-46688 | cas1c | ||
| 2346 | QEPU01000004.1 | GCA003252955_01120 | gene | open | 46692-46985 | cas2 | ||
| 2347 | QEPU01000004.1 | GCA003252955_01121 | gene | open | 47718-49382 | |||
| 2348 | QEPU01000004.1 | GCA003252955_01122 | gene | open | 49393-50184 | |||
| 2349 | QEPU01000004.1 | GCA003252955_01123 | gene | open | 50194-53967 | malQ | ||
| 2350 | QEPU01000004.1 | GCA003252955_01124 | gene | open | 54167-54880 | |||
| 2351 | QEPU01000004.1 | GCA003252955_01125 | gene | open | 55014-57287 | metE | ||
| 2352 | QEPU01000004.1 | GCA003252955_01126 | gene | open | 57552-58484 | metR | ||
| 2353 | QEPU01000004.1 | GCA003252955_01127 | gene | open | 58489-59220 | azlC | ||
| 2354 | QEPU01000004.1 | GCA003252955_01128 | gene | open | 59217-59549 | azlD | ||
| 2355 | QEPU01000004.1 | GCA003252955_01129 | gene | open | 59616-62408 | pqqL | ||
| 2356 | QEPU01000004.1 | GCA003252955_01130 | gene | open | 62468-64834 | cirA | ||
| 2357 | QEPU01000004.1 | GCA003252955_01131 | gene | open | 65127-66020 | |||
| 2358 | QEPU01000004.1 | GCA003252955_01132 | gene | open | 66013-66690 | cmk | ||
| 2359 | QEPU01000004.1 | GCA003252955_01133 | gene | open | 66789-68435 | rpsA | ||
| 2360 | QEPU01000004.1 | GCA003252955_01134 | gene | open | 68498-68782 | hupA | ||
| 2361 | QEPU01000004.1 | GCA003252955_01135 | gene | open | 68882-69178 | lapA | ||
| 2362 | QEPU01000004.1 | GCA003252955_01136 | gene | open | 69178-70368 | lapB | ||
| 2363 | QEPU01000004.1 | GCA003252955_01137 | gene | open | 70402-71094 | pyrF | ||
| 2364 | QEPU01000004.1 | GCA003252955_01138 | gene | open | 71101-71418 | yciH | ||
| 2365 | QEPU01000004.1 | GCA003252955_01139 | gene | open | 71457-71807 | sirB | ||
| 2366 | QEPU01000004.1 | GCA003252955_01140 | gene | open | 71875-74532 | gyrA | ||
| 2367 | QEPU01000004.1 | GCA003252955_01141 | gene | open | 74720-75043 | ubiG | ||
| 2368 | QEPU01000004.1 | GCA003252955_01142 | gene | open | 75120-75476 | ubiG | ||
| 2369 | QEPU01000004.1 | GCA003252955_01143 | gene | open | 75542-75982 | fur | ||
| 2370 | QEPU01000004.1 | GCA003252955_01144 | gene | open | 76002-76526 | fldA | ||
| 2371 | QEPU01000004.1 | GCA003252955_01145 | gene | open | 76538-76816 | ybfE | ||
| 2372 | QEPU01000004.1 | GCA003252955_01146 | gene | open | 76940-77740 | ybfF | ||
| 2373 | QEPU01000004.1 | GCA003252955_01147 | gene | open | 77827-78444 | seqA | ||
| 2374 | QEPU01000004.1 | GCA003252955_01148 | gene | open | 78447-79874 | menE | ||
| 2375 | QEPU01000004.1 | GCA003252955_01149 | gene | open | 79877-83203 | mscK | ||
| 2376 | QEPU01000004.1 | GCA003252955_01150 | gene | open | 83226-84299 | aroC | ||
| 2377 | QEPU01000004.1 | GCA003252955_01151 | gene | open | 84318-85190 | mepA | ||
| 2378 | QEPU01000004.1 | GCA003252955_01152 | gene | open | 85194-85961 | tauE | ||
| 2379 | QEPU01000004.1 | GCA003252955_01153 | gene | open | 85998-86954 | lpxM | ||
| 2380 | QEPU01000004.1 | GCA003252955_01154 | gene | open | 87021-87587 | apt | ||
| 2381 | QEPU01000004.1 | GCA003252955_01155 | gene | open | 87625-89667 | dnaX | ||
| 2382 | QEPU01000004.1 | GCA003252955_01156 | gene | open | 89680-90540 | |||
| 2383 | QEPU01000004.1 | GCA003252955_01157 | gene | open | 90537-90890 | |||
| 2384 | QEPU01000004.1 | GCA003252955_01158 | gene | open | 91001-91717 | |||
| 2385 | QEPU01000004.1 | GCA003252955_01159 | gene | open | 91714-92436 | hcpC | ||
| 2386 | QEPU01000004.1 | GCA003252955_01160 | gene | open | 92579-94558 | rnb | ||
| 2387 | QEPU01000004.1 | GCA003252955_01161 | gene | open | 94684-95472 | fabI | ||
| 2388 | QEPU01000004.1 | GCA003252955_01162 | gene | open | 95563-96318 | |||
| 2389 | QEPU01000004.1 | GCA003252955_01163 | gene | open | 96543-97172 | |||
| 2390 | QEPU01000004.1 | GCA003252955_01164 | gene | open | 97178-97603 | queD | ||
| 2391 | QEPU01000004.1 | GCA003252955_01165 | gene | open | 98136-99311 | |||
| 2392 | QEPU01000004.1 | GCA003252955_01166 | gene | open | 99402-100301 | |||
| 2393 | QEPU01000004.1 | GCA003252955_01167 | gene | open | 100365-100979 | |||
| 2394 | QEPU01000004.1 | GCA003252955_01168 | gene | open | 101111-102061 | prmB | ||
| 2395 | QEPU01000004.1 | GCA003252955_01169 | gene | open | 102126-102632 | smrB | ||
| 2396 | QEPU01000004.1 | GCA003252955_01170 | gene | open | 102629-104770 | yccS | ||
| 2397 | QEPU01000004.1 | GCA003252955_01171 | gene | open | 104793-105254 | yccF | ||
| 2398 | QEPU01000004.1 | GCA003252955_01172 | gene | open | 105257-105715 | mgsA | ||
| 2399 | QEPU01000004.1 | GCA003252955_01173 | gene | open | 105789-106460 | |||
| 2400 | QEPU01000004.1 | GCA003252955_01174 | gene | open | 106615-106887 | |||
| 2401 | QEPU01000004.1 | GCA003252955_01175 | gene | open | 106862-107710 | yfeD | ||
| 2402 | QEPU01000004.1 | GCA003252955_01176 | gene | open | 107707-108564 | afeC | ||
| 2403 | QEPU01000004.1 | GCA003252955_01177 | gene | open | 108564-109454 | afeB | ||
| 2404 | QEPU01000004.1 | GCA003252955_01178 | gene | open | 109454-110335 | afeA | ||
| 2405 | QEPU01000004.1 | GCA003252955_01179 | gene | open | 110434-110763 | dsrC | ||
| 2406 | QEPU01000004.1 | GCA003252955_01180 | gene | open | 110849-111511 | ybhL | ||
| 2407 | QEPU01000004.1 | GCA003252955_01181 | gene | open | 111689-112096 | |||
| 2408 | QEPU01000004.1 | GCA003252955_01182 | gene | open | 112234-112542 | |||
| 2409 | QEPU01000004.1 | GCA003252955_01183 | gene | open | 112711-114474 | ycaO | ||
| 2410 | QEPU01000004.1 | GCA003252955_01184 | gene | open | 114573-115775 | manA | ||
| 2411 | QEPU01000004.1 | GCA003252955_01185 | gene | open | 115979-116311 | |||
| 2412 | QEPU01000004.1 | GCA003252955_01186 | gene | open | 116525-118018 | ptsG2 | ||
| 2413 | QEPU01000004.1 | GCA003252955_01187 | gene | open | 118090-118788 | |||
| 2414 | QEPU01000004.1 | GCA003252955_01188 | gene | open | 118806-119507 | gloB | ||
| 2415 | QEPU01000004.1 | GCA003252955_01189 | gene | open | 119823-121127 | hemA | ||
| 2416 | QEPU01000004.1 | GCA003252955_01190 | gene | open | 121190-122413 | nagC | ||
| 2417 | QEPU01000004.1 | GCA003252955_01196 | gene | open | 123117-124889 | ggt | ||
| 2418 | QEPU01000004.1 | GCA003252955_01197 | gene | open | 125133-125378 | ygjV | ||
| 2419 | QEPU01000004.1 | GCA003252955_01198 | gene | open | 125624-126961 | argG | ||
| 2420 | QEPU01000004.1 | GCA003252955_01199 | gene | open | 127087-127917 | |||
| 2421 | QEPU01000004.1 | GCA003252955_01200 | gene | open | 127982-128842 | purC | ||
| 2422 | QEPU01000004.1 | GCA003252955_01201 | gene | open | 129083-130090 | |||
| 2423 | QEPU01000004.1 | GCA003252955_01202 | gene | open | 130821-132404 | prfC | ||
| 2424 | QEPU01000004.1 | GCA003252955_01203 | gene | open | 132487-133383 | cdd | ||
| 2425 | QEPU01000004.1 | GCA003252955_01204 | gene | open | 133497-134594 | potD | ||
| 2426 | QEPU01000004.1 | GCA003252955_01205 | gene | open | 134724-135497 | potC | ||
| 2427 | QEPU01000004.1 | GCA003252955_01206 | gene | open | 135497-136357 | potB | ||
| 2428 | QEPU01000004.1 | GCA003252955_01207 | gene | open | 136341-137459 | potA | ||
| 2429 | QEPU01000004.1 | GCA003252955_01208 | gene | open | 137728-138978 | pepT | ||
| 2430 | QEPU01000004.1 | GCA003252955_01209 | gene | open | 139031-141685 | |||
| 2431 | QEPU01000004.1 | GCA003252955_01210 | gene | open | 141651-142931 | |||
| 2432 | QEPU01000004.1 | GCA003252955_01211 | gene | open | 143142-143759 | proQ | ||
| 2433 | QEPU01000004.1 | GCA003252955_01212 | gene | open | 143827-145884 | prc | ||
| 2434 | QEPU01000004.1 | GCA003252955_01213 | gene | open | 145969-147489 | |||
| 2435 | QEPU01000004.1 | GCA003252955_01214 | gene | open | 147560-148120 | ycbK | ||
| 2436 | QEPU01000004.1 | GCA003252955_01215 | gene | open | 148187-148825 | |||
| 2437 | QEPU01000004.1 | GCA003252955_01216 | gene | open | 149071-151875 | sucA | ||
| 2438 | QEPU01000004.1 | GCA003252955_01217 | gene | open | 152007-153212 | odhB | ||
| 2439 | QEPU01000004.1 | GCA003252955_01218 | gene | open | 153307-154476 | sucC | ||
| 2440 | QEPU01000004.1 | GCA003252955_01219 | gene | open | 154488-155366 | sucD | ||
| 2441 | QEPU01000004.1 | GCA003252955_01192 | gene | open | 122652-122728 | trnM | ||
| 2442 | QEPU01000004.1 | GCA003252955_01193 | gene | open | 122733-122817 | trnL | ||
| 2443 | QEPU01000004.1 | GCA003252955_01194 | gene | open | 122846-122920 | trnQ | ||
| 2444 | QEPU01000004.1 | GCA003252955_01195 | gene | open | 122958-123032 | trnQ | ||
| 2445 | QEPU01000004.1 | GCA003252955_01192 | tRNA | open | 122652-122728 | trnM | tRNA-Met(cat) | |
| 2446 | QEPU01000004.1 | GCA003252955_01193 | tRNA | open | 122733-122817 | trnL | tRNA-Leu(tag) | |
| 2447 | QEPU01000004.1 | GCA003252955_01194 | tRNA | open | 122846-122920 | trnQ | tRNA-Gln(ttg) | |
| 2448 | QEPU01000004.1 | GCA003252955_01195 | tRNA | open | 122958-123032 | trnQ | tRNA-Gln(ttg) | |
| 2449 | QEPU01000005.1 | GCA003252955_01307 | gene | open | 89221-89586 | ssrA | ||
| 2450 | QEPU01000005.1 | GCA003252955_01307 | tmRNA | open | 89221-89586 | ssrA | transfer-messenger RNA%2C SsrA | |
| 2451 | QEPU01000005.1 | GCA003252955_01220 | gene | open | 11-126 | rrf | ||
| 2452 | QEPU01000005.1 | GCA003252955_01224 | gene | open | 2825-2933 | AaHKsRNA22 | ||
| 2453 | QEPU01000005.1 | GCA003252955_01239 | gene | open | 16895-16974 | JA04 | ||
| 2454 | QEPU01000005.1 | GCA003252955_01318 | gene | open | 95306-95391 | C4 | ||
| 2455 | QEPU01000005.1 | GCA003252955_01224 | ncRNA | open | 2825-2933 | Aggregatibacter sRNA 22 | ||
| 2456 | QEPU01000005.1 | GCA003252955_01239 | ncRNA | open | 16895-16974 | Aggregatibacter sRNA JA04 | ||
| 2457 | QEPU01000005.1 | GCA003252955_01318 | ncRNA | open | 95306-95391 | C4 antisense RNA | ||
| 2458 | QEPU01000005.1 | regulatory_region | open | 54997-55167 | FMN riboswitch aptamer (RFN element) | |||
| 2459 | QEPU01000005.1 | regulatory_region | open | 141843-141941 | TPP riboswitch aptamer (THI element) | |||
| 2460 | QEPU01000005.1 | regulatory_region | open | 145385-145524 | Histidine operon leader | |||
| 2461 | QEPU01000005.1 | GCA003252955_01220 | rRNA | open | 11-126 | rrf | 5S ribosomal RNA | |
| 2462 | QEPU01000005.1 | GCA003252955_01221 | CDS | open | 463-1326 | _na 287_aa | DUF808 domain-containing protein | |
| 2463 | QEPU01000005.1 | GCA003252955_01222 | CDS | open | 1518-2816 | _na 432_aa | envC | murein hydrolase activator EnvC |
| 2464 | QEPU01000005.1 | GCA003252955_01223 | CDS | open | 2813-3718 | _na 301_aa | Divergent polysaccharide deacetylase family protein | |
| 2465 | QEPU01000005.1 | GCA003252955_01225 | CDS | open | 3780-4262 | _na 160_aa | Serine/threonine-protein kinase B | |
| 2466 | QEPU01000005.1 | GCA003252955_01226 | CDS | open | 4284-5369 | _na 361_aa | Sel1 repeat family protein | |
| 2467 | QEPU01000005.1 | GCA003252955_01227 | CDS | open | 5387-6973 | _na 528_aa | Peptidoglycan binding domain | |
| 2468 | QEPU01000005.1 | GCA003252955_01228 | CDS | open | 7029-7409 | _na 126_aa | Hemolysin | |
| 2469 | QEPU01000005.1 | GCA003252955_01229 | CDS | open | 7472-7885 | _na 137_aa | DUF3918 domain-containing protein | |
| 2470 | QEPU01000005.1 | GCA003252955_01230 | CDS | open | 7987-8394 | _na 135_aa | Heme utilization protein | |
| 2471 | QEPU01000005.1 | GCA003252955_01231 | CDS | open | 8885-10420 | _na 511_aa | yifB | YifB family Mg chelatase-like AAA ATPase |
| 2472 | QEPU01000005.1 | GCA003252955_01232 | CDS | open | 10529-11278 | _na 249_aa | deoR | DNA-binding transcriptional repressor DeoR |
| 2473 | QEPU01000005.1 | GCA003252955_01233 | CDS | open | 11303-11974 | _na 223_aa | deoC | deoxyribose-phosphate aldolase |
| 2474 | QEPU01000005.1 | GCA003252955_01234 | CDS | open | 12208-13575 | _na 455_aa | Patatin | |
| 2475 | QEPU01000005.1 | GCA003252955_01235 | CDS | open | 13767-14168 | _na 133_aa | Pyrimidine dimer DNA glycosylase | |
| 2476 | QEPU01000005.1 | GCA003252955_01236 | CDS | open | 14475-14789 | _na 104_aa | Lipoprotein | |
| 2477 | QEPU01000005.1 | GCA003252955_01237 | CDS | open | 15078-16259 | _na 393_aa | purT | formate-dependent phosphoribosylglycinamide formyltransferase |
| 2478 | QEPU01000005.1 | GCA003252955_01238 | CDS | open | 16277-16780 | _na 167_aa | luxS | S-ribosylhomocysteine lyase |
| 2479 | QEPU01000005.1 | GCA003252955_01240 | CDS | open | 16981-17469 | _na 162_aa | VTT domain-containing protein | |
| 2480 | QEPU01000005.1 | GCA003252955_01241 | CDS | open | 17462-18076 | _na 204_aa | Acetyltransferase | |
| 2481 | QEPU01000005.1 | GCA003252955_01242 | CDS | open | 18070-18678 | _na 202_aa | ycjU | Phosphatase YqaB |
| 2482 | QEPU01000005.1 | GCA003252955_01243 | CDS | open | 18808-19188 | _na 126_aa | PRD domain-containing protein | |
| 2483 | QEPU01000005.1 | GCA003252955_01247 | CDS | open | 19703-21718 | _na 671_aa | rep | DNA helicase Rep |
| 2484 | QEPU01000005.1 | GCA003252955_01248 | CDS | open | 21728-21958 | _na 76_aa | YceK/YidQ family lipoprotein | |
| 2485 | QEPU01000005.1 | GCA003252955_01249 | CDS | open | 22070-22630 | _na 186_aa | Opacity protein and related surface antigens | |
| 2486 | QEPU01000005.1 | GCA003252955_01250 | CDS | open | 22713-25643 | _na 976_aa | polA | DNA polymerase I |
| 2487 | QEPU01000005.1 | GCA003252955_01251 | CDS | open | 25659-25976 | _na 105_aa | Cupin domain protein | |
| 2488 | QEPU01000005.1 | GCA003252955_01252 | CDS | open | 26086-27267 | _na 393_aa | Glutathionylspermidine synthase pre-ATP-grasp-like domain-containing protein | |
| 2489 | QEPU01000005.1 | GCA003252955_01253 | CDS | open | 27270-27821 | _na 183_aa | Lipoprotein | |
| 2490 | QEPU01000005.1 | GCA003252955_01254 | CDS | open | 28054-29334 | _na 426_aa | Methionine gamma-lyase | |
| 2491 | QEPU01000005.1 | GCA003252955_01255 | CDS | open | 29443-30771 | _na 442_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 2492 | QEPU01000005.1 | GCA003252955_01256 | CDS | open | 30893-32260 | _na 455_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 2493 | QEPU01000005.1 | GCA003252955_01257 | CDS | open | 32343-33473 | _na 376_aa | anhydro-N-acetylmuramic acid kinase | |
| 2494 | QEPU01000005.1 | GCA003252955_01258 | CDS | open | 33470-34384 | _na 304_aa | murQ | N-acetylmuramic acid 6-phosphate etherase |
| 2495 | QEPU01000005.1 | GCA003252955_01259 | CDS | open | 34802-35155 | _na 117_aa | Lipoprotein | |
| 2496 | QEPU01000005.1 | GCA003252955_01260 | CDS | open | 35315-35644 | _na 109_aa | Lipoprotein | |
| 2497 | QEPU01000005.1 | GCA003252955_01261 | CDS | open | 35641-36018 | _na 125_aa | hypothetical protein | |
| 2498 | QEPU01000005.1 | GCA003252955_01262 | CDS | open | 36141-36500 | _na 119_aa | Lipoprotein | |
| 2499 | QEPU01000005.1 | GCA003252955_01263 | CDS | open | 36502-37668 | _na 388_aa | hypothetical protein | |
| 2500 | QEPU01000005.1 | GCA003252955_01264 | CDS | open | 37665-37802 | _na 45_aa | hypothetical protein |

