HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnoanaerobaculum umeaense (GCA_003254255.1)

Select a Genome:
BAKTA Annotations for GCA_003254255.1
Genome Selected: Lachnoanaerobaculum umeaense
ContigsBases CDSrRNA tmRNAtRNA
78 2705257 2496 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5114 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 5114 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 QKZH01000001.1 GCA003254255_00001 CDS open 4-264 _na     86_aa hypothetical protein
2 QKZH01000001.1 GCA003254255_00002 CDS open 508-1143 _na     211_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
3 QKZH01000001.1 GCA003254255_00003 CDS open 1161-1337 _na     58_aa yoeB Putative mRNA interferase YoeB
4 QKZH01000001.1 GCA003254255_00004 CDS open 1384-1965 _na     193_aa Zinc-ribbon domain-containing protein
5 QKZH01000001.1 GCA003254255_00005 CDS open 2221-3984 _na     587_aa mdlB ABC transporter ATP-binding protein
6 QKZH01000001.1 GCA003254255_00006 CDS open 3994-5142 _na     382_aa argE putative succinyl-diaminopimelate desuccinylase
7 QKZH01000001.1 GCA003254255_00007 CDS open 5231-7042 _na     603_aa lepA translation elongation factor 4
8 QKZH01000001.1 GCA003254255_00008 CDS open 7049-8206 _na     385_aa hemW radical SAM family heme chaperone HemW
9 QKZH01000001.1 GCA003254255_00009 CDS open 8223-9245 _na     340_aa gLY1 Aromatic amino acid beta-eliminating lyase/threonine aldolase domain-containing protein
10 QKZH01000001.1 GCA003254255_00010 CDS open 9285-10385 _na     366_aa wecE DegT/DnrJ/EryC1/StrS aminotransferase
11 QKZH01000001.1 GCA003254255_00011 CDS open 10382-12520 _na     712_aa ppsA Pyruvate%2C water dikinase
12 QKZH01000001.1 GCA003254255_00012 CDS open 12513-13577 _na     354_aa N-acetyltransferase domain-containing protein
13 QKZH01000001.1 GCA003254255_00013 CDS open 13593-13958 _na     121_aa dgkA Prokaryotic diacylglycerol kinase
14 QKZH01000001.1 GCA003254255_00014 CDS open 13955-14530 _na     191_aa CDP-archaeol synthase
15 QKZH01000001.1 GCA003254255_00015 CDS open 14547-15128 _na     193_aa pssA CDP-diacylglycerol-serine O-phosphatidyltransferase
16 QKZH01000001.1 GCA003254255_00016 CDS open 15137-16012 _na     291_aa psd Phosphatidylserine decarboxylase
17 QKZH01000001.1 GCA003254255_00017 CDS open 15990-16955 _na     321_aa ubiA Prenyltransferase%2C UbiA family
18 QKZH01000001.1 GCA003254255_00018 CDS open 16970-18067 _na     365_aa glf UDP-galactopyranose mutase
19 QKZH01000001.1 GCA003254255_00019 CDS open 18255-19394 _na     379_aa Lipoprotein
20 QKZH01000001.1 GCA003254255_00020 CDS open 19527-20879 _na     450_aa virD4 Type VI secretion protein
21 QKZH01000001.1 GCA003254255_00021 CDS open 20879-21484 _na     201_aa clpP ATP-dependent Clp protease proteolytic subunit
22 QKZH01000001.1 GCA003254255_00022 CDS open 21696-22451 _na     251_aa hypothetical protein
23 QKZH01000001.1 GCA003254255_00023 CDS open 22519-24435 _na     638_aa Glycoside hydrolase
24 QKZH01000001.1 GCA003254255_00024 CDS open 24445-25641 _na     398_aa Cell wall-binding protein
25 QKZH01000001.1 GCA003254255_00025 CDS open 25999-26292 _na     97_aa AtpZ/AtpI family protein
26 QKZH01000001.1 GCA003254255_00026 CDS open 26285-26698 _na     137_aa ATP synthase I chain
27 QKZH01000001.1 GCA003254255_00027 CDS open 26695-27423 _na     242_aa atpB F0F1 ATP synthase subunit A
28 QKZH01000001.1 GCA003254255_00028 CDS open 27503-27760 _na     85_aa atpE ATP synthase F0 subunit C
29 QKZH01000001.1 GCA003254255_00029 CDS open 27773-28288 _na     171_aa atpF F0F1 ATP synthase subunit B
30 QKZH01000001.1 GCA003254255_00030 CDS open 28276-28809 _na     177_aa atpH ATP synthase F1 subunit delta
31 QKZH01000001.1 GCA003254255_00031 CDS open 28855-30354 _na     499_aa atpA F0F1 ATP synthase subunit alpha
32 QKZH01000001.1 GCA003254255_00032 CDS open 30367-31233 _na     288_aa atpG ATP synthase F1 subunit gamma
33 QKZH01000001.1 GCA003254255_00033 CDS open 31273-32664 _na     463_aa atpD F0F1 ATP synthase subunit beta
34 QKZH01000001.1 GCA003254255_00034 CDS open 32673-33074 _na     133_aa atpC ATP synthase F1 subunit epsilon
35 QKZH01000001.1 GCA003254255_00035 CDS open 33089-33259 _na     56_aa hypothetical protein
36 QKZH01000001.1 GCA003254255_00036 CDS open 33231-34118 _na     295_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
37 QKZH01000001.1 GCA003254255_00037 CDS open 34181-35203 _na     340_aa rfbB dTDP-glucose 4%2C6-dehydratase
38 QKZH01000001.1 GCA003254255_00038 CDS open 35203-36063 _na     286_aa rfbD dTDP-4-dehydrorhamnose reductase
39 QKZH01000001.1 GCA003254255_00039 CDS open 36063-37409 _na     448_aa glmM phosphoglucosamine mutase
40 QKZH01000001.1 GCA003254255_00040 CDS open 37472-39136 _na     554_aa leuA 2-isopropylmalate synthase
41 QKZH01000001.1 GCA003254255_00041 CDS open 39204-40184 _na     326_aa rfaJ Glycosyltransferase family 8 protein
42 QKZH01000001.1 GCA003254255_00042 CDS open 40194-41072 _na     292_aa wcaE Glycosyltransferase family 2 protein
43 QKZH01000001.1 GCA003254255_00043 CDS open 41081-42061 _na     326_aa wcaA Glycosyltransferase%2C group 2 family protein
44 QKZH01000001.1 GCA003254255_00044 CDS open 42061-43488 _na     475_aa rfbX Polysaccharide biosynthesis protein C-terminal domain-containing protein
45 QKZH01000001.1 GCA003254255_00045 CDS open 43518-44525 _na     335_aa carB ATP-grasp domain-containing protein
46 QKZH01000001.1 GCA003254255_00046 CDS open 44539-45771 _na     410_aa rfbX Lantibiotic ABC transporter permease
47 QKZH01000001.1 GCA003254255_00047 CDS open 45768-46703 _na     311_aa bcsA Glycosyltransferase
48 QKZH01000001.1 GCA003254255_00048 CDS open 46706-47401 _na     231_aa wcaA Glycosyltransferase 2-like domain-containing protein
49 QKZH01000001.1 GCA003254255_00049 CDS open 47398-47760 _na     120_aa DUF2304 domain-containing protein
50 QKZH01000001.1 GCA003254255_00050 CDS open 47953-48210 _na     85_aa relB Addiction module antitoxin%2C RelB/DinJ family
51 QKZH01000001.1 GCA003254255_00051 CDS open 48207-48473 _na     88_aa Txe/YoeB family addiction module toxin
52 QKZH01000001.1 GCA003254255_00052 CDS open 48805-49680 _na     291_aa Rpn family recombination-promoting nuclease/putative transposase
53 QKZH01000001.1 GCA003254255_00053 CDS open 49935-50456 _na     173_aa recG ATP-dependent DNA helicase RecG C-terminal domain-containing protein
54 QKZH01000001.1 GCA003254255_00054 CDS open 50905-51324 _na     139_aa putative toxin-antitoxin system toxin component%2C PIN family
55 QKZH01000001.1 GCA003254255_00055 CDS open 51327-51605 _na     92_aa relB Toxin-antitoxin system antitoxin subunit
56 QKZH01000001.1 GCA003254255_00056 CDS open 52065-52382 _na     105_aa rloB RloB domain-containing protein
57 QKZH01000001.1 GCA003254255_00057 CDS open 52665-53351 _na     228_aa hypothetical protein
58 QKZH01000001.1 GCA003254255_00058 CDS open 53500-54540 _na     346_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
59 QKZH01000001.1 GCA003254255_00059 CDS open 54537-54998 _na     153_aa rimI GNAT family N-acetyltransferase
60 QKZH01000001.1 GCA003254255_00060 CDS open 55082-56308 _na     408_aa argJ bifunctional ornithine acetyltransferase/N-acetylglutamate synthase
61 QKZH01000001.1 GCA003254255_00061 CDS open 56376-57239 _na     287_aa argB Acetylglutamate kinase
62 QKZH01000001.1 GCA003254255_00062 CDS open 57241-58425 _na     394_aa argD Acetylornithine aminotransferase
63 QKZH01000001.1 GCA003254255_00063 CDS open 58440-59744 _na     434_aa glnA type I glutamate--ammonia ligase
64 QKZH01000001.1 GCA003254255_00064 CDS open 59711-60334 _na     207_aa amiR ANTAR domain-containing protein
65 QKZH01000001.1 GCA003254255_00065 CDS open 60341-61156 _na     271_aa dapF diaminopimelate epimerase
66 QKZH01000001.1 GCA003254255_00066 CDS open 61482-62570 _na     362_aa cdaR PucR family transcriptional regulator
67 QKZH01000001.1 GCA003254255_00067 CDS open 62675-63991 _na     438_aa ctpA S41 family peptidase
68 QKZH01000001.1 GCA003254255_00068 CDS open 63994-67419 _na     1141_aa hepA ATP-dependent helicase
69 QKZH01000001.1 GCA003254255_00069 CDS open 67453-68382 _na     309_aa hprK HPr(Ser) kinase/phosphatase
70 QKZH01000001.1 GCA003254255_00070 CDS open 68414-69295 _na     293_aa murB UDP-N-acetylmuramate dehydrogenase
71 QKZH01000001.1 GCA003254255_00071 CDS open 69297-70172 _na     291_aa rapZ RNase adapter RapZ
72 QKZH01000001.1 GCA003254255_00072 CDS open 70181-71143 _na     320_aa whiA DNA-binding protein WhiA
73 QKZH01000001.1 GCA003254255_00073 CDS open 71136-71396 _na     86_aa ptsH HPr domain-containing protein
74 QKZH01000001.1 GCA003254255_00074 CDS open 71605-72378 _na     257_aa hisJ Basic amino acid ABC transporter substrate-binding protein
75 QKZH01000001.1 GCA003254255_00075 CDS open 72380-73072 _na     230_aa hisM Amino acid ABC transporter permease
76 QKZH01000001.1 GCA003254255_00076 CDS open 73062-73799 _na     245_aa glnQ Amino acid ABC transporter ATP-binding protein
77 QKZH01000001.1 GCA003254255_00077 CDS open 73994-74689 _na     231_aa MIP family channel protein
78 QKZH01000001.1 GCA003254255_00078 CDS open 74818-76200 _na     460_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
79 QKZH01000001.1 GCA003254255_00079 CDS open 76210-76689 _na     159_aa lspA signal peptidase II
80 QKZH01000001.1 GCA003254255_00080 CDS open 76705-77970 _na     421_aa corB HlyC/CorC family transporter
81 QKZH01000001.1 GCA003254255_00081 CDS open 77973-78617 _na     214_aa gph Phosphoglycolate phosphatase
82 QKZH01000001.1 GCA003254255_00082 CDS open 78611-78931 _na     106_aa Large polyvalent protein associated domain-containing protein
83 QKZH01000001.1 GCA003254255_00083 CDS open 78919-79461 _na     180_aa mutT NUDIX hydrolase
84 QKZH01000001.1 GCA003254255_00084 CDS open 79585-80724 _na     379_aa metC Cystathionine gamma-synthase
85 QKZH01000001.1 GCA003254255_00085 CDS open 80736-81908 _na     390_aa malY cysteine-S-conjugate beta-lyase
86 QKZH01000001.1 GCA003254255_00086 CDS open 82137-84395 _na     752_aa lon endopeptidase La
87 QKZH01000001.1 GCA003254255_00087 CDS open 84464-85633 _na     389_aa yqdH Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
88 QKZH01000001.1 GCA003254255_00088 CDS open 85753-86250 _na     165_aa queT QueT transporter
89 QKZH01000001.1 GCA003254255_00089 CDS open 86951-88603 _na     550_aa sleL Glycosyl hydrolase family 18
90 QKZH01000001.1 GCA003254255_00090 CDS open 88707-90755 _na     682_aa Mac 1
91 QKZH01000001.1 GCA003254255_00091 CDS open 90851-91606 _na     251_aa glpR HTH deoR-type domain-containing protein
92 QKZH01000001.1 GCA003254255_00092 CDS open 91999-93411 _na     470_aa xylB Rhamnulokinase
93 QKZH01000001.1 GCA003254255_00093 CDS open 93424-95205 _na     593_aa fucI L-fucose isomerase
94 QKZH01000001.1 GCA003254255_00094 CDS open 95257-95916 _na     219_aa araD L-fuculose-phosphate aldolase
95 QKZH01000001.1 GCA003254255_00095 CDS open 95929-97428 _na     499_aa ccmA heme ABC exporter ATP-binding protein CcmA
96 QKZH01000001.1 GCA003254255_00096 CDS open 97425-98399 _na     324_aa araH Autoinducer 2 import system permease protein LsrD
97 QKZH01000001.1 GCA003254255_00097 CDS open 98413-99531 _na     372_aa rbsB Periplasmic binding protein domain-containing protein
98 QKZH01000001.1 GCA003254255_00098 CDS open 99548-99979 _na     143_aa fucU Fucose isomerase
99 QKZH01000001.1 GCA003254255_00099 CDS open 100012-101160 _na     382_aa fucO lactaldehyde reductase
100 QKZH01000001.1 GCA003254255_00100 CDS open 101357-101587 _na     76_aa DUF6487 domain-containing protein
101 QKZH01000001.1 GCA003254255_00101 CDS open 101729-102259 _na     176_aa Late embryogenesis abundant protein
102 QKZH01000001.1 GCA003254255_00102 CDS open 102401-103441 _na     346_aa tauA ABC transporter substrate-binding protein
103 QKZH01000001.1 GCA003254255_00103 CDS open 103445-104197 _na     250_aa tauC ABC transporter permease subunit
104 QKZH01000001.1 GCA003254255_00104 CDS open 104197-104742 _na     181_aa tauB ATP-binding cassette domain-containing protein
105 QKZH01000001.1 GCA003254255_00105 CDS open 104749-105753 _na     334_aa Peptidase A2 domain-containing protein
106 QKZH01000001.1 GCA003254255_00106 CDS open 105758-106861 _na     367_aa perM AI-2E family transporter
107 QKZH01000001.1 GCA003254255_00107 CDS open 106995-108251 _na     418_aa degQ Serine protease
108 QKZH01000001.1 GCA003254255_00108 CDS open 108263-109210 _na     315_aa yhaM HD domain-containing protein
109 QKZH01000001.1 GCA003254255_00109 CDS open 109274-110665 _na     463_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
110 QKZH01000001.1 GCA003254255_00110 CDS open 110818-112293 _na     491_aa spoT HD domain-containing protein
111 QKZH01000001.1 GCA003254255_00111 CDS open 112307-113461 _na     384_aa XRE family transcriptional regulator
112 QKZH01000001.1 GCA003254255_00112 CDS open 113969-114694 _na     241_aa Calcineurin-like phosphoesterase domain-containing protein
113 QKZH01000001.1 GCA003254255_00113 CDS open 114791-114991 _na     66_aa hypothetical protein
114 QKZH01000001.1 GCA003254255_00114 CDS open 115815-117257 _na     480_aa Divergent AAA domain protein
115 QKZH01000001.1 GCA003254255_00115 CDS open 117501-118109 _na     202_aa acrR HTH tetR-type domain-containing protein
116 QKZH01000001.1 GCA003254255_00116 CDS open 118096-119850 _na     584_aa mdlB ABC transporter domain-containing protein
117 QKZH01000001.1 GCA003254255_00117 CDS open 119834-121555 _na     573_aa mdlB ABC transporter ATP-binding protein
118 QKZH01000001.1 GCA003254255_00118 CDS open 121565-122146 _na     193_aa TIGR02185 family protein
119 QKZH01000001.1 GCA003254255_00119 CDS open 122167-122748 _na     193_aa Trep-Strep domain-containing protein
120 QKZH01000001.1 GCA003254255_00120 CDS open 122748-123440 _na     230_aa ecfT Cobalt transport protein
121 QKZH01000001.1 GCA003254255_00121 CDS open 123428-124837 _na     469_aa yejF ABC transporter%2C ATP-binding protein
122 QKZH01000001.1 GCA003254255_00122 CDS open 124902-125081 _na     59_aa DUF6440 domain-containing protein
123 QKZH01000001.1 GCA003254255_00123 CDS open 125127-126152 _na     341_aa cvpA CvpA family protein
124 QKZH01000001.1 GCA003254255_00124 CDS open 126165-127190 _na     341_aa Transmembrane protein
125 QKZH01000001.1 GCA003254255_00125 CDS open 127283-127666 _na     127_aa DUF2750 domain-containing protein
126 QKZH01000001.1 GCA003254255_00126 CDS open 128081-128266 _na     61_aa hypothetical protein
127 QKZH01000001.1 GCA003254255_00127 CDS open 128267-128941 _na     224_aa gepA Panacea domain-containing protein
128 QKZH01000001.1 GCA003254255_00128 CDS open 129062-129403 _na     113_aa SMI1/KNR4 family protein
129 QKZH01000001.1 GCA003254255_00129 CDS open 129433-130821 _na     462_aa adhE Aldehyde dehydrogenase
130 QKZH01000001.1 GCA003254255_00130 CDS open 130848-131279 _na     143_aa DUF3806 domain-containing protein
131 QKZH01000001.1 GCA003254255_00131 CDS open 131368-133041 _na     557_aa DUF5050 domain-containing protein
132 QKZH01000001.1 GCA003254255_00132 CDS open 133207-133653 _na     148_aa DUF3806 domain-containing protein
133 QKZH01000001.1 GCA003254255_00133 CDS open 133682-134704 _na     340_aa cvpA CvpA family protein
134 QKZH01000001.1 GCA003254255_00134 CDS open 134903-135727 _na     274_aa Fis family transcriptional regulator
135 QKZH01000001.1 GCA003254255_00135 CDS open 135800-136222 _na     140_aa DUF3806 domain-containing protein
136 QKZH01000001.1 GCA003254255_00136 CDS open 136391-138037 _na     548_aa sUL1 Sulfate permease
137 QKZH01000001.1 GCA003254255_00137 CDS open 138219-138845 _na     208_aa LUD domain-containing protein
138 QKZH01000001.1 GCA003254255_00138 CDS open 139006-140193 _na     395_aa norV MBL fold metallo-hydrolase
139 QKZH01000001.1 GCA003254255_00139 CDS open 140285-141469 _na     394_aa Serine protease
140 QKZH01000001.1 GCA003254255_00140 CDS open 141558-142733 _na     391_aa comEC MBL fold metallo-hydrolase
141 QKZH01000001.1 GCA003254255_00141 CDS open 142873-144894 _na     673_aa comFC ATP-dependent DNA helicase RecQ
142 QKZH01000001.1 GCA003254255_00142 CDS open 144899-146065 _na     388_aa dprA DNA-processing protein DprA
143 QKZH01000001.1 GCA003254255_00143 CDS open 146094-147500 _na     468_aa PF11855 family protein
144 QKZH01000001.1 GCA003254255_00144 CDS open 147500-148075 _na     191_aa PF13835 domain protein
145 QKZH01000001.1 GCA003254255_00145 CDS open 148072-151401 _na     1109_aa ATPase
146 QKZH01000001.1 GCA003254255_00146 CDS open 151388-152593 _na     401_aa jetD Wadjet protein JetD C-terminal domain-containing protein
147 QKZH01000001.1 GCA003254255_00147 CDS open 153034-153570 _na     178_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
148 QKZH01000001.1 GCA003254255_00001 gene open 4-264
149 QKZH01000001.1 GCA003254255_00002 gene open 508-1143
150 QKZH01000001.1 GCA003254255_00003 gene open 1161-1337 yoeB
151 QKZH01000001.1 GCA003254255_00004 gene open 1384-1965
152 QKZH01000001.1 GCA003254255_00005 gene open 2221-3984 mdlB
153 QKZH01000001.1 GCA003254255_00006 gene open 3994-5142 argE
154 QKZH01000001.1 GCA003254255_00007 gene open 5231-7042 lepA
155 QKZH01000001.1 GCA003254255_00008 gene open 7049-8206 hemW
156 QKZH01000001.1 GCA003254255_00009 gene open 8223-9245 gLY1
157 QKZH01000001.1 GCA003254255_00010 gene open 9285-10385 wecE
158 QKZH01000001.1 GCA003254255_00011 gene open 10382-12520 ppsA
159 QKZH01000001.1 GCA003254255_00012 gene open 12513-13577
160 QKZH01000001.1 GCA003254255_00013 gene open 13593-13958 dgkA
161 QKZH01000001.1 GCA003254255_00014 gene open 13955-14530
162 QKZH01000001.1 GCA003254255_00015 gene open 14547-15128 pssA
163 QKZH01000001.1 GCA003254255_00016 gene open 15137-16012 psd
164 QKZH01000001.1 GCA003254255_00017 gene open 15990-16955 ubiA
165 QKZH01000001.1 GCA003254255_00018 gene open 16970-18067 glf
166 QKZH01000001.1 GCA003254255_00019 gene open 18255-19394
167 QKZH01000001.1 GCA003254255_00020 gene open 19527-20879 virD4
168 QKZH01000001.1 GCA003254255_00021 gene open 20879-21484 clpP
169 QKZH01000001.1 GCA003254255_00022 gene open 21696-22451
170 QKZH01000001.1 GCA003254255_00023 gene open 22519-24435
171 QKZH01000001.1 GCA003254255_00024 gene open 24445-25641
172 QKZH01000001.1 GCA003254255_00025 gene open 25999-26292
173 QKZH01000001.1 GCA003254255_00026 gene open 26285-26698
174 QKZH01000001.1 GCA003254255_00027 gene open 26695-27423 atpB
175 QKZH01000001.1 GCA003254255_00028 gene open 27503-27760 atpE
176 QKZH01000001.1 GCA003254255_00029 gene open 27773-28288 atpF
177 QKZH01000001.1 GCA003254255_00030 gene open 28276-28809 atpH
178 QKZH01000001.1 GCA003254255_00031 gene open 28855-30354 atpA
179 QKZH01000001.1 GCA003254255_00032 gene open 30367-31233 atpG
180 QKZH01000001.1 GCA003254255_00033 gene open 31273-32664 atpD
181 QKZH01000001.1 GCA003254255_00034 gene open 32673-33074 atpC
182 QKZH01000001.1 GCA003254255_00035 gene open 33089-33259
183 QKZH01000001.1 GCA003254255_00036 gene open 33231-34118 rfbA
184 QKZH01000001.1 GCA003254255_00037 gene open 34181-35203 rfbB
185 QKZH01000001.1 GCA003254255_00038 gene open 35203-36063 rfbD
186 QKZH01000001.1 GCA003254255_00039 gene open 36063-37409 glmM
187 QKZH01000001.1 GCA003254255_00040 gene open 37472-39136 leuA
188 QKZH01000001.1 GCA003254255_00041 gene open 39204-40184 rfaJ
189 QKZH01000001.1 GCA003254255_00042 gene open 40194-41072 wcaE
190 QKZH01000001.1 GCA003254255_00043 gene open 41081-42061 wcaA
191 QKZH01000001.1 GCA003254255_00044 gene open 42061-43488 rfbX
192 QKZH01000001.1 GCA003254255_00045 gene open 43518-44525 carB
193 QKZH01000001.1 GCA003254255_00046 gene open 44539-45771 rfbX
194 QKZH01000001.1 GCA003254255_00047 gene open 45768-46703 bcsA
195 QKZH01000001.1 GCA003254255_00048 gene open 46706-47401 wcaA
196 QKZH01000001.1 GCA003254255_00049 gene open 47398-47760
197 QKZH01000001.1 GCA003254255_00050 gene open 47953-48210 relB
198 QKZH01000001.1 GCA003254255_00051 gene open 48207-48473
199 QKZH01000001.1 GCA003254255_00052 gene open 48805-49680
200 QKZH01000001.1 GCA003254255_00053 gene open 49935-50456 recG
201 QKZH01000001.1 GCA003254255_00054 gene open 50905-51324
202 QKZH01000001.1 GCA003254255_00055 gene open 51327-51605 relB
203 QKZH01000001.1 GCA003254255_00056 gene open 52065-52382 rloB
204 QKZH01000001.1 GCA003254255_00057 gene open 52665-53351
205 QKZH01000001.1 GCA003254255_00058 gene open 53500-54540 argC
206 QKZH01000001.1 GCA003254255_00059 gene open 54537-54998 rimI
207 QKZH01000001.1 GCA003254255_00060 gene open 55082-56308 argJ
208 QKZH01000001.1 GCA003254255_00061 gene open 56376-57239 argB
209 QKZH01000001.1 GCA003254255_00062 gene open 57241-58425 argD
210 QKZH01000001.1 GCA003254255_00063 gene open 58440-59744 glnA
211 QKZH01000001.1 GCA003254255_00064 gene open 59711-60334 amiR
212 QKZH01000001.1 GCA003254255_00065 gene open 60341-61156 dapF
213 QKZH01000001.1 GCA003254255_00066 gene open 61482-62570 cdaR
214 QKZH01000001.1 GCA003254255_00067 gene open 62675-63991 ctpA
215 QKZH01000001.1 GCA003254255_00068 gene open 63994-67419 hepA
216 QKZH01000001.1 GCA003254255_00069 gene open 67453-68382 hprK
217 QKZH01000001.1 GCA003254255_00070 gene open 68414-69295 murB
218 QKZH01000001.1 GCA003254255_00071 gene open 69297-70172 rapZ
219 QKZH01000001.1 GCA003254255_00072 gene open 70181-71143 whiA
220 QKZH01000001.1 GCA003254255_00073 gene open 71136-71396 ptsH
221 QKZH01000001.1 GCA003254255_00074 gene open 71605-72378 hisJ
222 QKZH01000001.1 GCA003254255_00075 gene open 72380-73072 hisM
223 QKZH01000001.1 GCA003254255_00076 gene open 73062-73799 glnQ
224 QKZH01000001.1 GCA003254255_00077 gene open 73994-74689
225 QKZH01000001.1 GCA003254255_00078 gene open 74818-76200 clpX
226 QKZH01000001.1 GCA003254255_00079 gene open 76210-76689 lspA
227 QKZH01000001.1 GCA003254255_00080 gene open 76705-77970 corB
228 QKZH01000001.1 GCA003254255_00081 gene open 77973-78617 gph
229 QKZH01000001.1 GCA003254255_00082 gene open 78611-78931
230 QKZH01000001.1 GCA003254255_00083 gene open 78919-79461 mutT
231 QKZH01000001.1 GCA003254255_00084 gene open 79585-80724 metC
232 QKZH01000001.1 GCA003254255_00085 gene open 80736-81908 malY
233 QKZH01000001.1 GCA003254255_00086 gene open 82137-84395 lon
234 QKZH01000001.1 GCA003254255_00087 gene open 84464-85633 yqdH
235 QKZH01000001.1 GCA003254255_00088 gene open 85753-86250 queT
236 QKZH01000001.1 GCA003254255_00089 gene open 86951-88603 sleL
237 QKZH01000001.1 GCA003254255_00090 gene open 88707-90755
238 QKZH01000001.1 GCA003254255_00091 gene open 90851-91606 glpR
239 QKZH01000001.1 GCA003254255_00092 gene open 91999-93411 xylB
240 QKZH01000001.1 GCA003254255_00093 gene open 93424-95205 fucI
241 QKZH01000001.1 GCA003254255_00094 gene open 95257-95916 araD
242 QKZH01000001.1 GCA003254255_00095 gene open 95929-97428 ccmA
243 QKZH01000001.1 GCA003254255_00096 gene open 97425-98399 araH
244 QKZH01000001.1 GCA003254255_00097 gene open 98413-99531 rbsB
245 QKZH01000001.1 GCA003254255_00098 gene open 99548-99979 fucU
246 QKZH01000001.1 GCA003254255_00099 gene open 100012-101160 fucO
247 QKZH01000001.1 GCA003254255_00100 gene open 101357-101587
248 QKZH01000001.1 GCA003254255_00101 gene open 101729-102259
249 QKZH01000001.1 GCA003254255_00102 gene open 102401-103441 tauA
250 QKZH01000001.1 GCA003254255_00103 gene open 103445-104197 tauC
251 QKZH01000001.1 GCA003254255_00104 gene open 104197-104742 tauB
252 QKZH01000001.1 GCA003254255_00105 gene open 104749-105753
253 QKZH01000001.1 GCA003254255_00106 gene open 105758-106861 perM
254 QKZH01000001.1 GCA003254255_00107 gene open 106995-108251 degQ
255 QKZH01000001.1 GCA003254255_00108 gene open 108263-109210 yhaM
256 QKZH01000001.1 GCA003254255_00109 gene open 109274-110665 rlmD
257 QKZH01000001.1 GCA003254255_00110 gene open 110818-112293 spoT
258 QKZH01000001.1 GCA003254255_00111 gene open 112307-113461
259 QKZH01000001.1 GCA003254255_00112 gene open 113969-114694
260 QKZH01000001.1 GCA003254255_00113 gene open 114791-114991
261 QKZH01000001.1 GCA003254255_00114 gene open 115815-117257
262 QKZH01000001.1 GCA003254255_00115 gene open 117501-118109 acrR
263 QKZH01000001.1 GCA003254255_00116 gene open 118096-119850 mdlB
264 QKZH01000001.1 GCA003254255_00117 gene open 119834-121555 mdlB
265 QKZH01000001.1 GCA003254255_00118 gene open 121565-122146
266 QKZH01000001.1 GCA003254255_00119 gene open 122167-122748
267 QKZH01000001.1 GCA003254255_00120 gene open 122748-123440 ecfT
268 QKZH01000001.1 GCA003254255_00121 gene open 123428-124837 yejF
269 QKZH01000001.1 GCA003254255_00122 gene open 124902-125081
270 QKZH01000001.1 GCA003254255_00123 gene open 125127-126152 cvpA
271 QKZH01000001.1 GCA003254255_00124 gene open 126165-127190
272 QKZH01000001.1 GCA003254255_00125 gene open 127283-127666
273 QKZH01000001.1 GCA003254255_00126 gene open 128081-128266
274 QKZH01000001.1 GCA003254255_00127 gene open 128267-128941 gepA
275 QKZH01000001.1 GCA003254255_00128 gene open 129062-129403
276 QKZH01000001.1 GCA003254255_00129 gene open 129433-130821 adhE
277 QKZH01000001.1 GCA003254255_00130 gene open 130848-131279
278 QKZH01000001.1 GCA003254255_00131 gene open 131368-133041
279 QKZH01000001.1 GCA003254255_00132 gene open 133207-133653
280 QKZH01000001.1 GCA003254255_00133 gene open 133682-134704 cvpA
281 QKZH01000001.1 GCA003254255_00134 gene open 134903-135727
282 QKZH01000001.1 GCA003254255_00135 gene open 135800-136222
283 QKZH01000001.1 GCA003254255_00136 gene open 136391-138037 sUL1
284 QKZH01000001.1 GCA003254255_00137 gene open 138219-138845
285 QKZH01000001.1 GCA003254255_00138 gene open 139006-140193 norV
286 QKZH01000001.1 GCA003254255_00139 gene open 140285-141469
287 QKZH01000001.1 GCA003254255_00140 gene open 141558-142733 comEC
288 QKZH01000001.1 GCA003254255_00141 gene open 142873-144894 comFC
289 QKZH01000001.1 GCA003254255_00142 gene open 144899-146065 dprA
290 QKZH01000001.1 GCA003254255_00143 gene open 146094-147500
291 QKZH01000001.1 GCA003254255_00144 gene open 147500-148075
292 QKZH01000001.1 GCA003254255_00145 gene open 148072-151401
293 QKZH01000001.1 GCA003254255_00146 gene open 151388-152593 jetD
294 QKZH01000001.1 GCA003254255_00147 gene open 153034-153570 hpf
295 QKZH01000002.1 repeat_region open 105596-105937 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTTACAAAAGATAACCCCGATAAGGGGACGGAAAC and spacer length 38
296 QKZH01000002.1 GCA003254255_00148 CDS open 897-1673 _na     258_aa rpsB 30S ribosomal protein S2
297 QKZH01000002.1 GCA003254255_00149 CDS open 1766-2710 _na     314_aa tsf translation elongation factor Ts
298 QKZH01000002.1 GCA003254255_00150 CDS open 2791-3015 _na     74_aa Nif11 domain-containing protein
299 QKZH01000002.1 GCA003254255_00151 CDS open 2978-3742 _na     254_aa hIS2 Phosphatase
300 QKZH01000002.1 GCA003254255_00152 CDS open 3766-5166 _na     466_aa norM MATE family efflux transporter
301 QKZH01000002.1 GCA003254255_00153 CDS open 5159-6022 _na     287_aa rhaT DMT family transporter
302 QKZH01000002.1 GCA003254255_00154 CDS open 6037-7263 _na     408_aa gltP Dicarboxylate/amino acid:cation symporter
303 QKZH01000002.1 GCA003254255_00155 CDS open 7282-8562 _na     426_aa cdsB UPF0597 protein HMPREF1495_0851
304 QKZH01000002.1 GCA003254255_00156 CDS open 8762-9709 _na     315_aa lysR LysR family transcriptional regulator
305 QKZH01000002.1 GCA003254255_00157 CDS open 9816-11783 _na     655_aa uvrB excinuclease ABC subunit UvrB
306 QKZH01000002.1 GCA003254255_00158 CDS open 11817-12590 _na     257_aa yjjP Threonine/serine exporter-like N-terminal domain-containing protein
307 QKZH01000002.1 GCA003254255_00159 CDS open 12598-13035 _na     145_aa yjjB Threonine/Serine exporter ThrE domain-containing protein
308 QKZH01000002.1 GCA003254255_00160 CDS open 13054-13461 _na     135_aa hypothetical protein
309 QKZH01000002.1 GCA003254255_00161 CDS open 13694-14494 _na     266_aa bglX Periplasmic beta-glucosidase and related glycosidases
310 QKZH01000002.1 GCA003254255_00162 CDS open 14475-14981 _na     168_aa Fibronectin type III-like domain-containing protein
311 QKZH01000002.1 GCA003254255_00163 CDS open 14995-16086 _na     363_aa L-fucose/L-arabinose isomerase family protein
312 QKZH01000002.1 GCA003254255_00164 CDS open 16064-16480 _na     138_aa L-fucose isomerase C-terminal domain-containing protein
313 QKZH01000002.1 GCA003254255_00165 CDS open 16515-17981 _na     488_aa xylB xylulokinase
314 QKZH01000002.1 GCA003254255_00166 CDS open 17994-18449 _na     151_aa bcp thioredoxin-dependent peroxiredoxin
315 QKZH01000002.1 GCA003254255_00167 CDS open 18446-19189 _na     247_aa yaaA peroxide stress protein YaaA
316 QKZH01000002.1 GCA003254255_00168 CDS open 19204-19746 _na     180_aa proX YbaK/proline--tRNA ligase associated domain protein
317 QKZH01000002.1 GCA003254255_00169 CDS open 19748-21211 _na     487_aa dinP DNA methylase
318 QKZH01000002.1 GCA003254255_00170 CDS open 21547-23049 _na     500_aa glpK glycerol kinase GlpK
319 QKZH01000002.1 GCA003254255_00171 CDS open 23046-24485 _na     479_aa lhgO FAD/NAD(P)-binding oxidoreductase
320 QKZH01000002.1 GCA003254255_00172 CDS open 24495-25751 _na     418_aa trxB FAD-dependent oxidoreductase
321 QKZH01000002.1 GCA003254255_00173 CDS open 25753-26121 _na     122_aa DUF1667 domain-containing protein
322 QKZH01000002.1 GCA003254255_00174 CDS open 26171-26443 _na     90_aa pheA Chorismate mutase
323 QKZH01000002.1 GCA003254255_00175 CDS open 26572-27507 _na     311_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
324 QKZH01000002.1 GCA003254255_00176 CDS open 27512-28552 _na     346_aa eis Acetyltransferase (GNAT) domain protein
325 QKZH01000002.1 GCA003254255_00177 CDS open 28651-29295 _na     214_aa Peptidase C39-like domain-containing protein
326 QKZH01000002.1 GCA003254255_00178 CDS open 29426-30274 _na     282_aa TIGR02452 family protein
327 QKZH01000002.1 GCA003254255_00179 CDS open 30338-30457 _na     39_aa hypothetical protein
328 QKZH01000002.1 GCA003254255_00180 CDS open 30740-31834 _na     364_aa gldA Glycerol dehydrogenase
329 QKZH01000002.1 GCA003254255_00181 CDS open 32942-33097 _na     51_aa yozG XRE family transcriptional regulator
330 QKZH01000002.1 GCA003254255_00182 CDS open 33318-33614 _na     98_aa hypothetical protein
331 QKZH01000002.1 GCA003254255_00183 CDS open 33668-35443 _na     591_aa hypothetical protein
332 QKZH01000002.1 GCA003254255_00184 CDS open 35444-35674 _na     76_aa hypothetical protein
333 QKZH01000002.1 GCA003254255_00185 CDS open 35736-39305 _na     1189_aa hepA DEAD/DEAH box helicase
334 QKZH01000002.1 GCA003254255_00186 CDS open 39366-42941 _na     1191_aa ATP-binding protein
335 QKZH01000002.1 GCA003254255_00187 CDS open 42959-46663 _na     1234_aa recD RNA helicase
336 QKZH01000002.1 GCA003254255_00188 CDS open 46675-47019 _na     114_aa DUF4406 domain-containing protein
337 QKZH01000002.1 GCA003254255_00189 CDS open 47436-47621 _na     61_aa hypothetical protein
338 QKZH01000002.1 GCA003254255_00190 CDS open 47652-47873 _na     73_aa hypothetical protein
339 QKZH01000002.1 GCA003254255_00191 CDS open 47956-48570 _na     204_aa DUF1643 domain-containing protein
340 QKZH01000002.1 GCA003254255_00192 CDS open 48677-49699 _na     340_aa ycgL Nucleotidyltransferase
341 QKZH01000002.1 GCA003254255_00193 CDS open 50544-50684 _na     46_aa nucleotidyltransferase domain-containing protein
342 QKZH01000002.1 GCA003254255_00194 CDS open 50885-51130 _na     81_aa hypothetical protein
343 QKZH01000002.1 GCA003254255_00195 CDS open 51093-51296 _na     67_aa hypothetical protein
344 QKZH01000002.1 GCA003254255_00196 CDS open 51417-51590 _na     57_aa nucleotidyltransferase domain-containing protein
345 QKZH01000002.1 GCA003254255_00197 CDS open 51726-52013 _na     95_aa relB Type II toxin-antitoxin system RelB/DinJ family antitoxin
346 QKZH01000002.1 GCA003254255_00198 CDS open 52360-52833 _na     157_aa wzb protein-tyrosine-phosphatase
347 QKZH01000002.1 GCA003254255_00199 CDS open 52820-53623 _na     267_aa Beta-carotene 15%2C15'-monooxygenase
348 QKZH01000002.1 GCA003254255_00200 CDS open 53763-54977 _na     404_aa eutG Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
349 QKZH01000002.1 GCA003254255_00201 CDS open 55158-55565 _na     135_aa fur Transcriptional repressor
350 QKZH01000002.1 GCA003254255_00202 CDS open 55575-56633 _na     352_aa znuA Zinc ABC transporter substrate-binding protein
351 QKZH01000002.1 GCA003254255_00203 CDS open 56645-57316 _na     223_aa znuC ABC transporter ATP-binding protein
352 QKZH01000002.1 GCA003254255_00204 CDS open 57313-58143 _na     276_aa znuB ABC 3 transport family protein
353 QKZH01000002.1 GCA003254255_00205 CDS open 58366-59901 _na     511_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
354 QKZH01000002.1 GCA003254255_00206 CDS open 60192-61298 _na     368_aa SLH domain-containing protein
355 QKZH01000002.1 GCA003254255_00207 CDS open 61310-63034 _na     574_aa acrA Efflux transporter%2C RND family%2C MFP subunit
356 QKZH01000002.1 GCA003254255_00208 CDS open 63034-63738 _na     234_aa lolD ABC transporter domain-containing protein
357 QKZH01000002.1 GCA003254255_00209 CDS open 63722-64900 _na     392_aa salY ABC transporter
358 QKZH01000002.1 GCA003254255_00210 CDS open 64965-65897 _na     310_aa arcC Carbamate kinase
359 QKZH01000002.1 GCA003254255_00211 CDS open 66032-66847 _na     271_aa CPBP family intramembrane metalloprotease
360 QKZH01000002.1 GCA003254255_00212 CDS open 66813-67832 _na     339_aa wcaA Glycosyltransferase 2-like domain-containing protein
361 QKZH01000002.1 GCA003254255_00215 CDS open 68256-69665 _na     469_aa uxaC glucuronate isomerase
362 QKZH01000002.1 GCA003254255_00216 CDS open 69871-70626 _na     251_aa iclR IclR family transcriptional regulator
363 QKZH01000002.1 GCA003254255_00217 CDS open 70751-71401 _na     216_aa eda 2-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase
364 QKZH01000002.1 GCA003254255_00218 CDS open 71426-72457 _na     343_aa rbsK Carbohydrate kinase PfkB domain-containing protein
365 QKZH01000002.1 GCA003254255_00219 CDS open 72518-72715 _na     65_aa hypothetical protein
366 QKZH01000002.1 GCA003254255_00220 CDS open 72699-72971 _na     90_aa Antitoxin
367 QKZH01000002.1 GCA003254255_00221 CDS open 73134-75734 _na     866_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
368 QKZH01000002.1 GCA003254255_00222 CDS open 75797-76552 _na     251_aa cotS Aminoglycoside phosphotransferase domain-containing protein
369 QKZH01000002.1 GCA003254255_00223 CDS open 76698-77864 _na     388_aa Cation diffusion facilitator family transporter
370 QKZH01000002.1 GCA003254255_00224 CDS open 78213-82742 _na     1509_aa pPE hemoblobin-interacting domain-containing protein
371 QKZH01000002.1 GCA003254255_00225 CDS open 83115-86981 _na     1288_aa rpoB DNA-directed RNA polymerase subunit beta
372 QKZH01000002.1 GCA003254255_00226 CDS open 87067-90819 _na     1250_aa rpoC DNA-directed RNA polymerase subunit beta'
373 QKZH01000002.1 GCA003254255_00227 CDS open 91410-92471 _na     353_aa WYL domain-containing protein
374 QKZH01000002.1 GCA003254255_00228 CDS open 93102-93260 _na     52_aa hypothetical protein
375 QKZH01000002.1 GCA003254255_00229 CDS open 93330-93494 _na     54_aa hypothetical protein
376 QKZH01000002.1 GCA003254255_00230 CDS open 93589-94221 _na     210_aa ecsC EcsC family protein
377 QKZH01000002.1 GCA003254255_00231 CDS open 94424-95812 _na     462_aa csm6 type III-A CRISPR-associated CARF protein Csm6
378 QKZH01000002.1 GCA003254255_00232 CDS open 95806-96537 _na     243_aa cas6 CRISPR-associated endoribonuclease Cas6
379 QKZH01000002.1 GCA003254255_00233 CDS open 96530-98737 _na     735_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
380 QKZH01000002.1 GCA003254255_00234 CDS open 98738-99187 _na     149_aa CRISPR system Cms protein Csm2
381 QKZH01000002.1 GCA003254255_00235 CDS open 99198-99875 _na     225_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
382 QKZH01000002.1 GCA003254255_00236 CDS open 99877-100818 _na     313_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
383 QKZH01000002.1 GCA003254255_00237 CDS open 100818-101957 _na     379_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
384 QKZH01000002.1 GCA003254255_00238 CDS open 101966-102127 _na     53_aa CRISPR-associated endonuclease Cas1
385 QKZH01000002.1 GCA003254255_00239 CDS open 102075-102800 _na     241_aa cas1 CRISPR-associated endonuclease Cas1
386 QKZH01000002.1 GCA003254255_00240 CDS open 102814-103113 _na     99_aa cas2 CRISPR-associated endonuclease Cas2
387 QKZH01000002.1 GCA003254255_00241 CDS open 103146-105302 _na     718_aa nrdD anaerobic ribonucleoside-triphosphate reductase
388 QKZH01000002.1 GCA003254255_00242 CDS open 106144-107055 _na     303_aa Transposase (putative) YhgA-like domain-containing protein
389 QKZH01000002.1 GCA003254255_00243 CDS open 107193-108116 _na     307_aa Adenylylsulfate kinase
390 QKZH01000002.1 GCA003254255_00244 CDS open 108126-109841 _na     571_aa Sucrose phosphorylase
391 QKZH01000002.1 GCA003254255_00245 CDS open 109931-111511 _na     526_aa yfbK VWA domain-containing protein
392 QKZH01000002.1 GCA003254255_00246 CDS open 111890-112231 _na     113_aa pcp Pyrrolidone-carboxylate peptidase (N-terminal pyroglutamyl peptidase)
393 QKZH01000002.1 GCA003254255_00247 CDS open 112392-112736 _na     114_aa qdoI Cupin type-2 domain-containing protein
394 QKZH01000002.1 GCA003254255_00248 CDS open 112758-113366 _na     202_aa Phage protein
395 QKZH01000002.1 GCA003254255_00249 CDS open 113368-113931 _na     187_aa Hemerythrin-like domain-containing protein
396 QKZH01000002.1 GCA003254255_00250 CDS open 114144-114530 _na     128_aa ybgA DUF1722 domain-containing protein
397 QKZH01000002.1 GCA003254255_00148 gene open 897-1673 rpsB
398 QKZH01000002.1 GCA003254255_00149 gene open 1766-2710 tsf
399 QKZH01000002.1 GCA003254255_00150 gene open 2791-3015
400 QKZH01000002.1 GCA003254255_00151 gene open 2978-3742 hIS2
401 QKZH01000002.1 GCA003254255_00152 gene open 3766-5166 norM
402 QKZH01000002.1 GCA003254255_00153 gene open 5159-6022 rhaT
403 QKZH01000002.1 GCA003254255_00154 gene open 6037-7263 gltP
404 QKZH01000002.1 GCA003254255_00155 gene open 7282-8562 cdsB
405 QKZH01000002.1 GCA003254255_00156 gene open 8762-9709 lysR
406 QKZH01000002.1 GCA003254255_00157 gene open 9816-11783 uvrB
407 QKZH01000002.1 GCA003254255_00158 gene open 11817-12590 yjjP
408 QKZH01000002.1 GCA003254255_00159 gene open 12598-13035 yjjB
409 QKZH01000002.1 GCA003254255_00160 gene open 13054-13461
410 QKZH01000002.1 GCA003254255_00161 gene open 13694-14494 bglX
411 QKZH01000002.1 GCA003254255_00162 gene open 14475-14981
412 QKZH01000002.1 GCA003254255_00163 gene open 14995-16086
413 QKZH01000002.1 GCA003254255_00164 gene open 16064-16480
414 QKZH01000002.1 GCA003254255_00165 gene open 16515-17981 xylB
415 QKZH01000002.1 GCA003254255_00166 gene open 17994-18449 bcp
416 QKZH01000002.1 GCA003254255_00167 gene open 18446-19189 yaaA
417 QKZH01000002.1 GCA003254255_00168 gene open 19204-19746 proX
418 QKZH01000002.1 GCA003254255_00169 gene open 19748-21211 dinP
419 QKZH01000002.1 GCA003254255_00170 gene open 21547-23049 glpK
420 QKZH01000002.1 GCA003254255_00171 gene open 23046-24485 lhgO
421 QKZH01000002.1 GCA003254255_00172 gene open 24495-25751 trxB
422 QKZH01000002.1 GCA003254255_00173 gene open 25753-26121
423 QKZH01000002.1 GCA003254255_00174 gene open 26171-26443 pheA
424 QKZH01000002.1 GCA003254255_00175 gene open 26572-27507
425 QKZH01000002.1 GCA003254255_00176 gene open 27512-28552 eis
426 QKZH01000002.1 GCA003254255_00177 gene open 28651-29295
427 QKZH01000002.1 GCA003254255_00178 gene open 29426-30274
428 QKZH01000002.1 GCA003254255_00179 gene open 30338-30457
429 QKZH01000002.1 GCA003254255_00180 gene open 30740-31834 gldA
430 QKZH01000002.1 GCA003254255_00181 gene open 32942-33097 yozG
431 QKZH01000002.1 GCA003254255_00182 gene open 33318-33614
432 QKZH01000002.1 GCA003254255_00183 gene open 33668-35443
433 QKZH01000002.1 GCA003254255_00184 gene open 35444-35674
434 QKZH01000002.1 GCA003254255_00185 gene open 35736-39305 hepA
435 QKZH01000002.1 GCA003254255_00186 gene open 39366-42941
436 QKZH01000002.1 GCA003254255_00187 gene open 42959-46663 recD
437 QKZH01000002.1 GCA003254255_00188 gene open 46675-47019
438 QKZH01000002.1 GCA003254255_00189 gene open 47436-47621
439 QKZH01000002.1 GCA003254255_00190 gene open 47652-47873
440 QKZH01000002.1 GCA003254255_00191 gene open 47956-48570
441 QKZH01000002.1 GCA003254255_00192 gene open 48677-49699 ycgL
442 QKZH01000002.1 GCA003254255_00193 gene open 50544-50684
443 QKZH01000002.1 GCA003254255_00194 gene open 50885-51130
444 QKZH01000002.1 GCA003254255_00195 gene open 51093-51296
445 QKZH01000002.1 GCA003254255_00196 gene open 51417-51590
446 QKZH01000002.1 GCA003254255_00197 gene open 51726-52013 relB
447 QKZH01000002.1 GCA003254255_00198 gene open 52360-52833 wzb
448 QKZH01000002.1 GCA003254255_00199 gene open 52820-53623
449 QKZH01000002.1 GCA003254255_00200 gene open 53763-54977 eutG
450 QKZH01000002.1 GCA003254255_00201 gene open 55158-55565 fur
451 QKZH01000002.1 GCA003254255_00202 gene open 55575-56633 znuA
452 QKZH01000002.1 GCA003254255_00203 gene open 56645-57316 znuC
453 QKZH01000002.1 GCA003254255_00204 gene open 57313-58143 znuB
454 QKZH01000002.1 GCA003254255_00205 gene open 58366-59901 gpmI
455 QKZH01000002.1 GCA003254255_00206 gene open 60192-61298
456 QKZH01000002.1 GCA003254255_00207 gene open 61310-63034 acrA
457 QKZH01000002.1 GCA003254255_00208 gene open 63034-63738 lolD
458 QKZH01000002.1 GCA003254255_00209 gene open 63722-64900 salY
459 QKZH01000002.1 GCA003254255_00210 gene open 64965-65897 arcC
460 QKZH01000002.1 GCA003254255_00211 gene open 66032-66847
461 QKZH01000002.1 GCA003254255_00212 gene open 66813-67832 wcaA
462 QKZH01000002.1 GCA003254255_00215 gene open 68256-69665 uxaC
463 QKZH01000002.1 GCA003254255_00216 gene open 69871-70626 iclR
464 QKZH01000002.1 GCA003254255_00217 gene open 70751-71401 eda
465 QKZH01000002.1 GCA003254255_00218 gene open 71426-72457 rbsK
466 QKZH01000002.1 GCA003254255_00219 gene open 72518-72715
467 QKZH01000002.1 GCA003254255_00220 gene open 72699-72971
468 QKZH01000002.1 GCA003254255_00221 gene open 73134-75734 adhE
469 QKZH01000002.1 GCA003254255_00222 gene open 75797-76552 cotS
470 QKZH01000002.1 GCA003254255_00223 gene open 76698-77864
471 QKZH01000002.1 GCA003254255_00224 gene open 78213-82742 pPE
472 QKZH01000002.1 GCA003254255_00225 gene open 83115-86981 rpoB
473 QKZH01000002.1 GCA003254255_00226 gene open 87067-90819 rpoC
474 QKZH01000002.1 GCA003254255_00227 gene open 91410-92471
475 QKZH01000002.1 GCA003254255_00228 gene open 93102-93260
476 QKZH01000002.1 GCA003254255_00229 gene open 93330-93494
477 QKZH01000002.1 GCA003254255_00230 gene open 93589-94221 ecsC
478 QKZH01000002.1 GCA003254255_00231 gene open 94424-95812 csm6
479 QKZH01000002.1 GCA003254255_00232 gene open 95806-96537 cas6
480 QKZH01000002.1 GCA003254255_00233 gene open 96530-98737 cas10
481 QKZH01000002.1 GCA003254255_00234 gene open 98738-99187
482 QKZH01000002.1 GCA003254255_00235 gene open 99198-99875 csm3
483 QKZH01000002.1 GCA003254255_00236 gene open 99877-100818 csm4
484 QKZH01000002.1 GCA003254255_00237 gene open 100818-101957 csm5
485 QKZH01000002.1 GCA003254255_00238 gene open 101966-102127
486 QKZH01000002.1 GCA003254255_00239 gene open 102075-102800 cas1
487 QKZH01000002.1 GCA003254255_00240 gene open 102814-103113 cas2
488 QKZH01000002.1 GCA003254255_00241 gene open 103146-105302 nrdD
489 QKZH01000002.1 GCA003254255_00242 gene open 106144-107055
490 QKZH01000002.1 GCA003254255_00243 gene open 107193-108116
491 QKZH01000002.1 GCA003254255_00244 gene open 108126-109841
492 QKZH01000002.1 GCA003254255_00245 gene open 109931-111511 yfbK
493 QKZH01000002.1 GCA003254255_00246 gene open 111890-112231 pcp
494 QKZH01000002.1 GCA003254255_00247 gene open 112392-112736 qdoI
495 QKZH01000002.1 GCA003254255_00248 gene open 112758-113366
496 QKZH01000002.1 GCA003254255_00249 gene open 113368-113931
497 QKZH01000002.1 GCA003254255_00250 gene open 114144-114530 ybgA
498 QKZH01000002.1 GCA003254255_00213 gene open 67935-68007 trnV
499 QKZH01000002.1 GCA003254255_00214 gene open 68038-68111 trnM
500 QKZH01000002.1 GCA003254255_00213 tRNA open 67935-68007 trnV tRNA-Val(tac)